Co-dominant molecular marker for detecting low-phosphorus-resistant site Pup1 of rice and application of co-dominant molecular marker
By developing detection methods based on SNP markers in rice, the problem of lack of co-dominant molecular markers in the prior art for detecting rice Pup1 loci is solved, and the accurate identification of rice Pup1 loci genotype is achieved, and rapid screening and breeding of low-phosphorus-resistant rice varieties are promoted.
Patent Information
- Application Number
- CN202411825056.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-12
- Publication Date
- 2025-04-04
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
There is a lack of methods for detecting co-dominant molecular markers of Pup1 sites in rice in the prior art, which makes it difficult to quickly screen and breed low-phosphorus resistant rice varieties.
A detection method based on SNP marker was developed, using the Pup1 site and specific SNP sites on the PSTOL1 gene located at chromosome 12, Jiujiri Hyo-12, and designed AS-PCR primers for genotype identification.
The accurate identification of three different genotypes (low phosphorus tolerance, low phosphorus tolerance and heterozygous type) of rice Pup1 loci was achieved, which simplified the breeding process, reduced costs, and was suitable for commercial large-scale breeding.
Smart Images
Figure CN119753206A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of molecular biology and plant molecular breeding, and in particular to a co-dominant molecular marker for detecting a rice low-phosphorus tolerance site Pup1 and an application thereof. Background Art
[0002] Phosphorus is one of the macroelements necessary for plant growth and development. Phosphorus is not only a component of many important compounds in plants, but also participates in various metabolic processes in plants in various ways. The main source of phosphorus required by plants is absorbed from the soil through the root system. The soil contains a lot of phosphorus, but the effective phosphorus content that plants can absorb and utilize is very low. The lack of effective phosphorus in the soil is a common problem worldwide. Rice is the main food crop in my country and even in the world. With the increase in population, the reduction in cultivated land area and the rapid improvement of people's living standards, the production of high-yield and high-quality rice has become an important issue of concern in agricultural production. However, the low effective phosphorus content in the soil has become an important factor limiting the increase in rice production. On the other hand, in order to pursue yield, the long-term and large-scale use of chemical fertilizers such as phosphate fertilizers has caused a series of problems such as waste of resources, depletion of phosphorus sources, environmental pollution, and increased agricultural production costs. Therefore, cultivating and screening low-phosphorus-tolerant rice varieties that can improve soil phosphorus utilization is an effective way to solve this problem.
[0003] The study found that Pup1 (GenBank ID AB458444.1) is a QTL related to phosphorus deficiency tolerance in the rice variety Kasalath. Further study of this locus revealed a Pup1 Specific protein kinase gene PSTOL1 , PSTOL1 It can act as an enhancer of early root growth, allowing the plant to obtain more phosphorus and other nutrients, thereby increasing rice yield in phosphorus-deficient soils. Pup1 Related reports on site co-dominant molecular markers, so the development Pup1 Efficient detection of molecular markers is of great practical significance for accelerating the breeding of rice varieties with efficient phosphorus utilization or tolerance to low phosphorus. Summary of the invention
[0004] 1. Technical issues to be solved The purpose of the present invention is to solve the problem that there is no method for detecting rice in the prior art. Pup1 In order to solve the problems in the related reports of co-dominant molecular markers of the locus, a co-dominant molecular marker for detecting the rice low-phosphorus tolerance locus Pup1 and its application were proposed.
[0005] 2. Technical solution
[0006] In order to achieve the above object, the present invention adopts the following technical solutions: The co-dominant molecular marker of the rice low-phosphorus tolerance site Pup1 is a SNP marker located at 15459877 bp on chromosome 12 of rice Nipponbare ( Pup1 locus), whose polymorphism is A or C; and the Pup1 locus on rice chromosome 12 PSTOL1 Genetically (missing in rice Nipponbare), its polymorphism is T or C.
[0007] The present invention also proposes a rice low-phosphorus tolerance locus Pup1 co-dominant molecular marker combination composed of the above molecular markers.
[0008] The present invention also proposes AS-PCR primers for detecting the above molecular markers, including PUP1-PF, PUP1-PR, PUP1-NF, and PUP1-NR, whose nucleotide sequences are as follows: PUP1-NF:CTTCCAGTGATAGCGATGTGC PUP1-NR:GCGAATGTGGTGTCTGCTT PUP1-PF:TTTCCTACAAAAGCAAGAACCT PUP1-PR:GGACAGAAATCTTGAGCCAGTA.
[0009] The present invention also proposes any of the following applications of the above-mentioned molecular markers, molecular marker combinations, primers or detection reagents or kits: 1) In rice low phosphorus tolerance sites Pup1 Application in genotyping of 2) Application in identifying the low-phosphorus tolerance trait of rice; 3) Application in identification and screening of germplasm resources with low-phosphorus tolerance traits; 4) Application in molecular marker-assisted breeding of rice for tolerance to low phosphorus.
[0010] The present invention also proposes a rice low phosphorus tolerance site Pup1 The genotyping method comprises the following steps: S1: Extract genomic DNA of rice to be tested; S2: using the genomic DNA obtained in step (1) as a template, and performing PCR amplification using the primers described in claim 3; S3: Analyze the amplified product.
[0011] Preferably, the amplification products are analyzed by agarose gel electrophoresis.
[0012] Preferably, S3 is specifically: if the amplified product shows a characteristic band of 492 bp, the rice to be tested is determined to be Pup1If the amplified product shows a characteristic band of 287 bp, the rice to be tested is judged to be Pup1 The low-phosphorus intolerance allele is homozygous; if the amplified product shows two band types, 492 bp and 287 bp, the rice to be tested is judged to be a heterozygous genotype.
[0013] 3. Beneficial effects
[0014] Compared with the prior art, the advantages of the present invention are: In the present invention, by Pup1 Sequence analysis was performed by Pup1 Dominant markers were designed in both functional and relatively conservative regions to detect low-phosphorus-tolerant alleles and low-phosphorus-intolerant alleles respectively, and then combined for Pup1 Genotyping can be achieved through Pup1 Identification of three different genotypes.
[0015] In the present invention, the sizes of different bands of the amplified products of the provided molecular markers vary greatly, and the genotype of the rice material to be tested can be determined by agarose gel electrophoresis. The invention has low cost, does not require enzyme cutting, and has a convenient and fast detection procedure. It can shorten the breeding cycle of low-phosphorus-tolerant rice and reduce breeding costs.
[0016] In the present invention, when molecular markers are used for assisted breeding, the offspring can be Pup1 It can accurately, simply and efficiently detect genotypes, and realize non-destructive detection in the early stage of rice growth, which is suitable for large-scale commercial breeding. Pup1 Large-scale screening of genotypes and the Pup1 Identification of alleles.
[0017] In the present invention, the molecular marker primers provided are suitable for Pup1 Large-scale screening of genotypes and screening of new Pup1 Genotype tolerant to low phosphorus parent. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 The electrophoresis diagram of the detection of the rice breeding parents in Example 4 of the present invention, wherein M: DL1000 DNA marker, wherein lanes 1-26 correspond to Kasalath, Nipponbare, Huazhan, 9311, R1141, R6444, Zhendao 819, Yandao 531, Zhejing 75, Hujing 5, Nongken 31, Yuzhenxiang, Liaoyan 287, Fukuniski, Jiangsujing 2, IR29, R1212, R608, Long 5, Yuejing 0618, Yishang S01, Huijing 602, Hujing 6, IR64, Teqing, Kasalath / Huazhan F1; Figure 2This is an electrophoresis diagram of the BC1F2 population constructed by hybridizing KASALATH and 9311 in Example 5, wherein M: DL1000 DNA marker, lanes 1 and 2 are the low-phosphorus-tolerant parent Kasalath and the low-phosphorus-intolerant parent 9311, respectively, lanes 3-36 are single plants of the BC1F2 population constructed using Kasalath and 9311, and the genotype of each material is marked above the corresponding lane, "-" represents the low-phosphorus-intolerant allele type, "+" represents the low-phosphorus-tolerant allele type, and H represents the heterozygous type. DETAILED DESCRIPTION
[0019] The technical solutions in the embodiments of the present invention will be described clearly and completely below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments. Example 1
[0020] Pup1 Development of co-dominant molecular markers: By analyzing Pup1 , PSTOL1 The sequence difference between Kasalath and Nipponbare, 9311, R498, Bio-226 and other varieties is located at 15459877bp on chromosome 12 of rice Nipponbare ( Pup1 A specific SNP locus was found in the low-phosphorus tolerant variety Kasalath, where A was found, and the other low-phosphorus intolerant varieties were found to be C; PSTOL1 A specific SNP site was found in the gene, of which the low-phosphorus-tolerant variety Kasalath was T, and the other low-phosphorus-intolerant varieties were C or missing. Molecular markers were developed for these two SNPs, which can achieve Pup1 Identification of locus genotypes. Example 2
[0021] Pup1 Design of detection primers (AS-PCR primers) for gene co-dominant molecular markers: Two developed for Example 1 Pup1 AS-PCR detection primers are designed for gene-specific SNP sites. The primer design principles are as follows: First, for PSTOL1 Primers that specifically amplify the low-phosphorus-tolerant allele were designed at the specific SNP site in the gene. The forward primer PUP1-PF was designed with the T base in the SNP as the 3' end of the primer, and the third base at the 3' end was changed to C. Then, a reverse primer PUP1-PR was designed upstream to match it. Primers PUP1-PF and PUP1-PR can only specifically amplify PSTOL1 The low-phosphorus tolerant allele produced a 492 bp band, while PSTOL1If the allele is not tolerant to low phosphorus or the deletion type, no band will be amplified.
[0022] Secondly, for Pup1 Primers for specific amplification of the low-phosphorus-intolerant allele were designed based on the sequence of the specific SNP (located at 15459877bp on chromosome 12 of Nipponbare). The forward primer PUP1-NF was designed with the C base of the SNP site as the 3' end of the primer, and the second base at the 3' end was changed to G. A matching reverse primer PUP1-NR was designed downstream. PUP1-NF and PUP1-NR specifically amplified the low-phosphorus-intolerant allele and obtained a 287bp band.
[0023] The specific primer sequences are shown in Table 1. The four primers were mixed to form Pup1 The functional co-dominant molecular marker detection primer set is used. When the amplified product is only 492 bp, the tested rice carries Pup1 low-phosphorus tolerance allele; when the amplified product has only a 287bp band, the tested rice does not contain the low-phosphorus tolerance allele; when the amplified product has two band types, 492bp and 287bp, the tested rice is Pup1 Heterozygous rice genotype.
[0024] Table 1 Pup1 Specific molecular marker primer sequences and related parameters Example 3
[0025] Rice low phosphorus tolerance locus Pup1 Establishment of specific molecular marker detection method: Designed according to Example 2 Pup1 The detection primers of two molecular markers were used to design the PCR reaction program and reaction system. After continuous optimization, the following reaction program and system were determined: PCR reaction system (10 µL): 1 µL of 10× PCR reaction buffer, 0.8 µL of 10 mM dNTP, 0.15 µL of each of the four primers (10 µM), 0.1 µL of Taq DNA polymerase (2.5 U / ul); 2 µL of DNA template, and double distilled water to make up the balance.
[0026] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 45 seconds, for a total of 35 cycles; and extension at 72°C for 8 minutes. Example 4
[0027] Pup1 Application of specific molecular markers in detecting rice germplasm parent resources: 1. Rice material Pup1The donor materials Kasalath, hybrid F1 of Kasalath and 9311, and 24 breeding parent materials or commercially available rice varieties include: Nipponbare, Huazhan, 9311, R1141, R6444, Zhendao 819, Yandao 531, Zhejing 75, Hujing 5, Nongken 31, Yuzhenxiang, Liaoyan 287, Fukuniski, Jiangsujing 2, IR29, R1212, R608, Long 5, Yuejing 0618, Yishang S01, Huijing 602, Hujing 6, IR64, and Teqing.
[0028] 2. Rice genomic DNA extraction and primer synthesis The genomic DNA of the above rice materials was extracted using the TPS method and the primer sequences shown in Table 1 were synthesized.
[0029] 3. PCR testing The reaction system and reaction procedure of PCR are as described in Example 3. The amplified product was electrophoresed in 1.5-2.5% agarose gel, and the result was scanned and recorded by gel imager.
[0030] 4. Results Analysis The electrophoresis results of PCR amplification products are as follows Figure 2 As shown, lane 1 Pup1 The low-phosphorus-tolerant donor material Kasalath specifically amplified a 492bp band, the parental materials corresponding to lanes 2-25 all amplified a 287bp band, and Kasalath / 9311 F1 amplified two band types of 492bp and 287bp. In order to verify the accuracy of the PCR test results, the molecular marker regions corresponding to Kasalath and the remaining 22 parental materials were sequenced and compared. The results showed that the molecular marker test results were consistent with the sequencing results, proving that the primers provided by the present invention can accurately identify Pup1 Genotypes can realize accurate and efficient screening of rice variety resources. Example 5
[0031] Rice low phosphorus tolerance locus Pup1 Detection of single gene segregation in the BC1F2 population: 1. Rice material The low-phosphorus-tolerant parent Kasalath, the low-phosphorus-intolerant parent 9311, and the BC1F2 population constructed from the two parents.
[0032] 2. Extraction and PCR detection of rice genomic DNA The primers, reaction procedures and system for rice genomic DNA extraction and PCR detection are as described in Example 4.
[0033] 3. Results Analysis The electrophoresis results of 100 strains of the BC1F2 population of the low-phosphorus tolerant parents Kasalath and 9311 and the hybrids of the two parents are shown in the figure below. Figure 2 As shown, lanes 1 and 2 are the low-phosphorus tolerant parents Kasalath and 9311, respectively, and lanes 3-36 are the genotype detection results of some individual plants in the BC1F2 population. The genotypes of each material are marked above the corresponding lanes, where "+" represents the presence of Pup1 Low phosphorus tolerance allele, "-" means no Pup1 The results showed that the separation ratio of the three different genotypes in the 100 BC1F2 materials was 28 "-": 52H: 20 "+", which was consistent with the Mendelian single gene separation ratio of 1:2:1 by the chi-square test (χ 2 =1.44 less than χ 2 0.05 =5.99), therefore, the marker is a codominant marker that can distinguish two different homozygous and heterozygous genotypes, and the detection site also shows single gene separation.
[0034] The present invention provides Pup1 Co-dominant molecular markers and their detection primers can achieve low-phosphorus tolerance sites Pup1 The genotype of rice can be efficiently and accurately identified, which can be used for screening and identification of rice resources, and can also be used for rice low-phosphorus tolerance sites Pup1 Molecular genetic breeding.
[0035] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.
Claims
1. A co-dominant molecular marker for the low-phosphorus tolerance locus Pup1 in rice, characterized in that: It is a SNP marker located at 15459877bp on chromosome 12 of rice Nipponbare ( Pup1 locus), whose polymorphism is A or C; and the Pup1 locus on rice chromosome 12 PSTOL1 Genetically (missing in rice Nipponbare), its polymorphism is T or C.
2. A co-dominant molecular marker combination for the rice low-phosphorus tolerance locus Pup1, characterized in that: Composed of the molecular marker according to claim 1.
3. The AS-PCR primers for detecting the molecular marker according to claim 1, characterized in that: It includes PUP1-PF, PUP1-PR, PUP1-NF, PUP1-NR, and its nucleotide sequence is as follows: PUP1-NF:CTTCCAGTGATAGCGATGTGC PUP1-NR:GCGAATGTGGTGTCTGCTT PUP1-PF:TTTCCTACAAAAGCAAGAACCT PUP1-PR:GGACAGAAATCTTGAGCCAGTA.
4. A detection reagent or kit containing the primers according to claim 3.
5. Any of the following uses of the molecular marker according to claim 1, the molecular marker combination according to claim 2, the primer according to claim 3, or the detection reagent or kit according to claim 4: 1) In rice low phosphorus tolerance sites Pup1 Application in genotyping of 2) Application in identifying the low-phosphorus tolerance trait of rice; 3) Application in identification and screening of germplasm resources with low-phosphorus tolerance traits; 4) Application in molecular marker-assisted breeding of rice for tolerance to low phosphorus.
6. Rice low phosphorus tolerance site Pup1 A genotyping method, characterized in that The steps include: S1: Extract genomic DNA of rice to be tested; S2: using the genomic DNA obtained in step (1) as a template, and performing PCR amplification using the primers described in claim 3; S3: Analyze the amplified product.
7. The method according to claim 6, characterized in that The amplified products were analyzed by agarose gel electrophoresis.
8. The method according to claim 6, characterized in that S3 is as follows: If the amplified product shows a characteristic band of 492 bp, the rice to be tested is determined to be Pup1 If the amplified product shows a characteristic band of 287 bp, the rice to be tested is judged to be Pup1 Homozygous for the low-phosphorus intolerant allele; If the amplified product shows two band types, 492 bp and 287 bp, the rice to be tested is determined to be a heterozygous genotype.