SNP molecular marker linked to major qtl of thickness of fruit flesh of winter melon and its application

Abstract

The application discloses a SNP molecular marker linked with a main-effect QTL of winter melon pulp thickness and application thereof, and belongs to the technical field of plant molecular genetics and breeding. The SNP molecular marker is located at the position of 1821713bp of a 12th chromosome of the winter melon, and the polymorphism is G / A. The SNP molecular marker provided by the application can be identified at the early stage of the winter melon seed or seedling. In addition, the marker technology can directly detect the phenotype characteristics of the pulp thickness of the fruit in the market period without cutting the fruit. The SNP genotyping provided by the application has the advantages of high accuracy, low cost and short time. The technology can be widely applied to the molecular marker assisted selection breeding of the pulp thickness and quality of the winter melon, and effectively improves the product yield of the winter melon in the processing and fresh eating process.

Description

Technical Field

[0001] The present invention relates to the technical field of plant molecular genetic breeding, in particular to a SNP molecular marker linked to a major effect QTL of wax gourd flesh thickness and an application thereof. Background Art

[0002] SLAF-Seq (locus-specific amplified fragment sequencing) is a simplified genome sequencing technology based on second-generation high-throughput sequencing. It uses double-end sequencing of fragments produced by specific enzyme cleavage to obtain genetic polymorphism markers and accurately identify and type single nucleotide polymorphism (SNP) sites. SLAF-Seq combines simplified library construction, fragment amplification, and high-throughput sequencing to efficiently develop polymorphic markers, avoid interference from repetitive sequences, and simplify complex genome analysis. Therefore, SLAF-Seq has a wide range of applications in polymorphic marker discovery, genetic linkage map construction, QTL mapping, genetic diversity analysis, and whole-genome sequencing, providing strong technical support.

[0003] Single nucleotide polymorphisms (SNPs) are a new generation of genetic markers. KASP (competitive allele-specific PCR) is one of the leading SNP typing methods currently available, capable of accurately identifying SNPs and loci-specific insertions and deletions (Indels). This technology, which performs typing through specific matching of primer ends, is widely used for large-scale SNP genotyping, shortening verification time and reducing costs. KASP utilizes universal fluorescent primers for amplification, reducing reagent costs while ensuring high accuracy. It is widely used in plant molecular marker localization and large-scale population scanning, and holds great promise for application in medicine and agronomy.

[0004] Winter melon (Winter melon) is an important vegetable crop suitable for transportation from southern China to the north and for processing. Its flesh thickness significantly impacts both processing and fresh consumption. Flesh thickness directly determines fruit shape and yield; thicker flesh increases utilization and affects transportation and storage costs. Flesh thickness is a key agronomic trait of winter melon after the fruit is fully mature and is significantly influenced by environmental factors, making it a challenging trait to improve. Traditional breeding methods typically require assessing flesh thickness only after the fruit matures, a time-consuming, labor-intensive, and costly process. Therefore, utilizing modern molecular biotechnology to improve germplasm and select thick-fleshed varieties is of great practical significance. Currently, research on genes regulating winter melon flesh thickness is still in its early stages, and the development of molecular markers is limited. This has, to a certain extent, hindered the innovation and development of thick-fleshed winter melon varieties. Therefore, there is an urgent need to further identify molecular markers closely associated with winter melon flesh thickness and to utilize molecular marker technology for high-throughput screening at the seedling stage. This will not only improve breeding efficiency and reduce costs, but also accelerate the pace of winter melon molecular breeding, thereby providing more powerful technical support for the sustainable development of the winter melon industry. Summary of the Invention

[0005] The present invention aims to provide a SNP molecular marker linked to a major QTL for wax gourd flesh thickness and its application to solve the problems of the above-mentioned prior art. The SNP molecular marker provided by the present invention can quickly and easily identify wax gourd flesh thickness.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] Technical solution 1: A SNP molecular marker linked to the major effect QTL of wax gourd flesh thickness, the SNP molecular marker is located at the position of 1821713bp on chromosome 12 of wax gourd, and its polymorphism is G / A.

[0008] Preferably, thick flesh is G and thin flesh is A.

[0009] Furthermore, the SNP molecular marker is located at the 25th base from the 5' end of the sequence shown in SEQ ID NO.1.

[0010] The present invention adopts SLAF-Seq technology, which can efficiently and quickly screen molecular markers related to traits, thereby providing support for the construction of molecular marker-assisted breeding systems and can be quickly and large-scale applied in breeding practice.

[0011] Technical solution 2: A kit for detecting the SNP molecular markers described in typing.

[0012] Furthermore, the kit includes a KASP primer pair.

[0013] Furthermore, the KASP primer pair includes two forward primers and one reverse primer. The nucleotide sequences of the forward primers are shown in SEQ ID NO.2 and SEQ ID NO.3, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.4.

[0014] The forward primers include forward primer 1 and forward primer 2;

[0015] The nucleotide sequence of forward primer 1 is:

[0016] 5'-GAAGGTGACCAAGTTCATGCTCTACTTTTCAACTTCACTGTCTCCG-3';

[0017] The nucleotide sequence of forward primer 2 is:

[0018] 5'-GAAGGTCGGAGTCAACGGATTCTACTTTTCAACTTCACTGTCTCCA-3';

[0019] The nucleotide sequence of the reverse primer is:

[0020] 5'-GTTATGAAAGAGGTTGAAATGAAGG-3'.

[0021] The SNP molecular marker or the kit is used for winter melon flesh thickness identification and / or preparation of a product for winter melon flesh thickness identification.

[0022] The 5' ends of the two forward primers are respectively connected with different fluorescent label sequences of FAM and HEX groups (i.e., the first to 21 bases of the forward primer are detection linker sequences), and the 3' end bases are different SNP sites. The fluorescent groups can be replaced with commonly used fluorescent groups in the art, and the application does not make special limitations.

[0023] The SNP molecular marker or the kit is used for winter melon molecular marker assisted breeding and / or preparation of a product for winter melon molecular marker assisted breeding.

[0024] The SNP molecular marker or the kit is used for winter melon germplasm improvement and / or preparation of a product for winter melon germplasm improvement.

[0025] The application further discloses a method for identifying winter melon flesh thickness, which comprises the following steps: extracting a nucleic acid sample of a winter melon to be detected, detecting the sample by using the kit, and determining the flesh thickness of the winter melon according to the genotype of the SNP molecular marker.

[0026] Further, if the genotype of the SNP molecular marker of the winter melon to be detected is GG, the winter melon is determined as an extremely thick-fleshed winter melon; if the genotype of the SNP molecular marker of the winter melon to be detected is AA, the winter melon is determined as an extremely thin-fleshed winter melon; and if the genotype of the SNP molecular marker of the winter melon to be detected is GA, the winter melon is determined as a winter melon with a medium thickness.

[0027] In some embodiments of the application, the reaction procedure of the detection comprises: 94℃ hot start activation for 15min; 94℃ (20sec), 65-57℃ (60sec), each cycle decreases by 0.8℃, 10 cycles; 94℃ (20sec), 57℃ (60sec), 32 cycles. After the reaction is completed, the fluorescence signal is read by a TECAN infinite M1000 enzyme label instrument, then the fluorescence signal is analyzed and converted by using snpdecoder (http: / / www.snpway.com / snpdecoder / ) software to present in the form of a chart, according to the color difference, the genotype result is output, and the flesh thickness of the winter melon is determined.

[0028] The application discloses the following technical effects:

[0029] The present invention discovered a SNP molecular marker linked to the main effect QTL of wax gourd flesh thickness. The SNP molecular marker is located at the position of 1821713bp on chromosome 12 of wax gourd, and its polymorphism is G / A. The wax gourd flesh thickness trait is a quality trait that can only be clearly identified based on cross-section measurements during the commercial maturity period of the fruit. The molecular marker of the present invention can be used for identification in the early stages of wax gourd seeds or seedlings. In addition, this marker technology can directly detect the phenotypic characteristics of the flesh thickness of commercial fruits without cutting the fruit. The present invention adopts KASP technology to achieve SNP typing and detection through specific matching of primer terminal bases, which has the advantages of high accuracy, low cost and short time. The technology provided by the present invention can be widely used in molecular marker-assisted selection breeding of wax gourd quality, effectively improving the yield of wax gourd products during processing and fresh consumption. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0031] Figure 1 The test results of wax gourd flesh thickness; A is the cross-section of the parent wax gourd, and the position marked by the red line frame is the location of the cross-section where the wax gourd flesh thickness is measured; B is the F2 population frequency distribution diagram of wax gourd flesh thickness;

[0032] Figure 2 This is a QTL mapping map for flesh thickness based on SLAF-seq sequencing data and phenotypic data; A is the lod value distribution curve; B is the additive effect and dominant effect curve corresponding to position A;

[0033] Figure 3 Figure 1 is the validation result of markers FT_SNP1 and KASP in the F2 population; A is the validation result of marker FT_SNP1 in the F2 population. As shown in the figure, individuals with extremely thick flesh are clustered near the X-axis (homozygous GG, blue dots), individuals with extremely thin flesh are clustered near the Y-axis (homozygous AA, green dots), and individuals with intermediate flesh are clustered near the diagonal (heterozygous GA, red dots); B is the frequency distribution of KASP marker genotypes in the F2 population;

[0034] Figure 4 To verify the linked marker SNP_1821713; A is the typing diagram of marker FT_SNP1 in the natural population of wax gourd; B is the box plot of flesh thickness corresponding to the differential marker. DETAILED DESCRIPTION

[0035] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0036] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0037] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0038] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0039] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0040] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

[0041] Example 1 Obtaining SNP Molecular Markers Linked to the Major QTL for Wax Melon Flesh Thickness

[0042] 1. Construction of genetic population and genetic analysis

[0043] 1.1 Materials and Reagents

[0044] The F1 generation was obtained by hybridizing the recombinant inbred line BNH367 (thick flesh) of winter melon with the male parent B606 (thin flesh). Subsequently, 198 F2 lines were obtained by self-pollination. This population was planted in the experimental fields of the Vegetable Research Institute of the Guangdong Academy of Agricultural Sciences in the spring of 2021.

[0045] Primers were synthesized by Shanghai Biotechnology, all PAGE level purification.

[0046] 1.2 Genetic rule analysis of winter melon fruit thickness trait

[0047] The thickness of winter melon fruit was measured by steel ruler. The measurement site was the length from the pericarp to the heart chamber of the cross section of the middle part of the fruit. Each fruit was measured three times, and the average value was calculated. The measurement results are shown in Table 1. Figure 1 Phenotypic analysis of fruit thickness of F2 plants showed that the trait frequency distribution was shown in Figure 1. Figure 2 The results showed that the trait frequency distribution was shown in Figure 1.

[0048] 2. QTL mapping of winter melon fruit thickness trait

[0049] 2.1 Extraction of gene DNA

[0050] The genomic DNA of winter melon parents and F2 generation was extracted by cetyltrimethylammonium bromide (CTAB) method. The quality and concentration of DNA were detected by 2% agarose gel electrophoresis, and then diluted to 50-100 ng / μL for standby.

[0051] 2.2 SLAF sequencing and map construction

[0052] HighMap software was used to develop high-density molecular markers for winter melon F2 genetic segregation population (2 parents and 198 offspring) for genetic map construction. Through winter melon genome prediction, HaeIII and Hpy166II enzyme digestion combination was selected, SLAF tag length was 364-414 bp, and 130,480 tags were obtained, which were evenly distributed. Illumina HiSeq 2500 platform was used for sequencing, and 621.69 Mbp data were obtained, Q30 was 94.55%, GC content was 40.26%, and the distribution was normal. A total of 617,440 SLAF tags were obtained, of which 79,535 were polymorphic tags, 20,493 could be used for genetic map construction, and the effective polymorphism of parents was 3.32%. Twelve linkage groups were constructed, 4,096 markers, total map distance 1,944.26 cM, average map distance 0.48 cM, marker completeness 99.66%, and double exchange ratio 0.01. The sequencing depth of the parents was 22.115x, and that of the offspring was 11.65x.

[0053] 2.3 Preliminary QTL mapping

[0054] QTL association analysis for wax gourd flesh thickness identified molecular signatures closely associated with the trait. Using QTLLiciMapping software, the composite interval mapping (CIM) method was used to map the trait. Phenotypic data and genetic map information for flesh thickness were analyzed and calculated to identify relevant QTLs. Permutation tests were performed 1000 times, and the LOD threshold corresponding to a p-value less than 0.01 was used as the screening threshold, indicated by a dashed line in the figure. A confidence level of 0.99 corresponds to an LOD threshold of 3. Intervals exceeding this threshold indicate linkage to the target gene.

[0055] FleshThickness detected a major QTL (FT12.1), located on linkage group LG12, with the starting and ending positions on the genetic map at (5.32-5.59cM), a positioning interval of 0.27cM, and three tags located between markers Marker5348242 and Marker5235751, with a contribution rate PVE of 8.85% and an LOD value of 4.38. However, on linkage group LG5, there is also a marker site Marker2876633 at the 18.095cM position on the genetic map, with a corresponding LOD value of 8.05 and a contribution rate of 14.98%, but it has no other linked markers on the flank. Therefore, the project developed polymorphic SNPs near this marker site Marker2876633 based on the deep resequencing data of the parents, but none of them are tightly linked to the trait, so linkage group LG12 is the focus of the next study.

[0056] Based on deep resequencing data from the parents, we screened for polymorphic markers within the major QTL (FT12.1) on linkage group LG12. We identified a polymorphic marker, SNP_1821713, located in the coding region of the gene and linked to the trait. This SNP marker, named FT_SNP1, is located at bp 1821713 on chromosome 12 of winter melon and has a G / C polymorphism. The genome website is http: / / cucurbitgenomics.org / v2 / ftp / genome / WaxGourd / . The nucleotide sequence of this site is shown in SEQ ID NO. 1. The polymorphism at base 25 of this sequence is G / A; thick flesh is associated with G, while thin flesh is associated with A.

[0057] CTACTTTTCAACTTCACTGTCTCCTACCTGTTTGACGAAAATTTCTTAACCTTCATTT CAACCTCTTTCATAACTATTTAGTTTTTATTTTT (SEQ ID NO. 1).

[0058] Example 2 KASP technology is used to genotype wax gourd flesh thickness

[0059] Preparation: PrimerMix consisting of two forward primers with different terminal bases for each allele and one reverse primer. The 5' ends of the two forward primers are connected to different fluorescent label sequences of FAM and HEX groups (i.e., bases 1-21 of the forward primers are detection adapter sequences); 2× PARMS Master mix; DNA template, HO.

[0060] The KASP reaction system was as follows: DNA (10-100 ng), 2×PARMS Master mix (5 μL), primer mix (0.7 μL) [forward primer 1 (0.15 μL), forward primer 2 (0.15 μL), reverse primer (0.4 μL)], H2O (N / A), and the total reaction volume was 10 μL.

[0061] KASP reaction program: hot start activation at 94°C for 15 min; 94°C (20 sec), 65-57°C (60 sec), decreasing 0.8°C each cycle, 10 cycles; 94°C (20 sec), 57°C (60 sec), 32 cycles.

[0062] PCR reaction I: The denatured template binds and anneals with the matching primers in the Primer Mix, and the detection adapter sequence is added to the extended sequence;

[0063] PCR reaction II: synthesis of complementary strands of allele-specific terminal sequences;

[0064] PCR Reaction III: Signal Generation—The detection sequence corresponding to the specific sequence grows exponentially with the PCR reaction, and the corresponding signal is detected.

[0065] The present invention relates to a SNP molecular marker KSAP primer pair linked to a major QTL for wax gourd flesh thickness. The KSAP primer pair comprises two forward primers 1 and 2 and a reverse primer. The nucleotide sequences of the KSAP primer pair are as follows:

[0066] Forward primer 1: 5'-GAAGGTGACCAAGTTCATGCTCTACTTTTCAACTTCACTGTCTCCG-3' (SEQ ID NO. 2), wherein bases 1-21 are the detection linker sequence (fluorescent tag sequence of the FAM group);

[0067] Forward primer 2: 5'-GAAGGTCGGAGTCAACGGATTCTACTTTTCAACTTCACTGTCTCCA-3' (SEQ ID NO. 3), wherein bases 1-21 are the detection linker sequence (fluorescent tag sequence of the HEX group);

[0068] Reverse primer: 5'-GTTATGAAAGAGGTTGAAATGAAGG-3' (SEQ ID NO. 4).

[0069] After PCR, fluorescence signals were read using a TECAN infinite M1000 microplate reader. The signals were then analyzed and converted using the online software snpdecoder (http: / / www.snpway.com / snpdecoder / ), resulting in a clear and intuitive genotyping chart. The chart is divided into X and Y axes, with each data point representing an independent DNA sample. Samples with the same genotype are clustered together and displayed in the same color. Genotypes near the X and Y axes are homozygous (blue dots FAM, green dots HEX), while those near the diagonal lines are heterozygous (red dots FAMHEX). Genotypes of thick-fleshed individuals (maternal parent) are G, located near the X axis (blue dots FAM), while genotypes of thin-fleshed individuals (paternal parent) are A, located near the Y axis (green dots HEX). The population typing results show that individuals with extremely thick flesh are clustered near the X axis (homozygous GG, blue dots), while individuals with extremely thin flesh are clustered near the Y axis (homozygous AA, green dots). Most of the flesh thickness indices at the intermediate level were clustered near the diagonal line (heterozygous GA, red dots), proving that this marker was linked to the trait.

[0070] The results of the F2 generation population verification are as follows Figure 3 As shown, Figure 3 A in the figure is the validation result of marker FT_SNP1 in the F2 generation population. Individuals with extremely thick flesh are clustered near the X-axis (homozygous GG, blue dots), individuals with extremely thin flesh are clustered near the Y-axis (homozygous AA, green dots), and individuals with intermediate flesh are clustered near the diagonal (heterozygous GA, red dots). Figure 3 Figure B is the frequency distribution of KASP marker differential genotypes in the F2 population.

[0071] Example 3 Validation of linked SNP markers in a natural wax gourd population

[0072] 43 high-generation inbred lines of wax gourd with rich field pulp thickness polymorphism and relatively distant genetic background were selected. The pulp thickness was measured with a steel ruler. The measurement position was the length from the cross-section of the peel to the periphery of the ventricle. There were three biological replicates. The pulp thickness ranged from 3.47 cm to 6.48 cm, and the coefficient of variation was 0.15. The accuracy of the SNP markers used in Example 1 for molecular marker-assisted selection was determined by population validation. The linked marker SNP_1821713 was validated, and the natural population typing results are shown in Figure 2. Figure 4 A in , and to explore the correlation between markers and phenotypes see Figure 4 Figure B shows a box plot showing that the FAM marker type (GG, homozygous, blue dots) has higher flesh thickness than the HEX marker type (AA, homozygous, green dots), while the FAMHEX marker type (GA, heterozygous, red dots) has intermediate flesh thickness. This demonstrates that the SNP markers provided in this example are closely linked to the wax gourd flesh thickness trait.

[0073] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. The application of the kit in identification of wax gourd pulp thickness is characterized in that: The following steps are involved: Extracting DNA from a sample to be tested; detecting the genotype of the SNP molecular marker using the kit; and determining the flesh thickness based on the genotype: if the genotype is GG, the flesh is determined to be extremely thick; if the genotype is AA, the flesh is determined to be extremely thin; and if the genotype is GA, the flesh is determined to be of medium thickness. The kit contains a KASP primer pair, which includes: forward primer 1: the nucleotide sequence is shown in SEQ ID NO.2; forward primer 2: the nucleotide sequence is shown in SEQ ID NO.3; reverse primer: the nucleotide sequence is shown in SEQ ID NO.

4.

2. Application of the kit in molecular marker-assisted breeding of wax gourd, characterized in that: The breeding method is aimed at the flesh thickness trait of wax gourd, and comprises the following steps: extracting DNA of a sample to be tested; detecting the genotype of the SNP molecular marker using the kit; selecting an individual with a genotype of GG as a thick flesh parent material; The kit contains a KASP primer pair, which includes: forward primer 1: the nucleotide sequence is shown in SEQ ID NO.2; forward primer 2: the nucleotide sequence is shown in SEQ ID NO.3; reverse primer: the nucleotide sequence is shown in SEQ ID NO.

4.

3. A method for identifying the thickness of wax gourd flesh, characterized in that: The following steps are involved: Extracting DNA from the sample to be tested; KASP was amplified using a kit; SNP genotypes were analyzed using fluorescence signals; and flesh thickness was determined based on genotype: genotype GG corresponds to extremely thick flesh; genotype AA corresponds to extremely thin flesh; and genotype GA corresponds to intermediate flesh thickness. The kit contains a KASP primer pair, which includes: forward primer 1: the nucleotide sequence is shown in SEQ ID NO.2; forward primer 2: the nucleotide sequence is shown in SEQ ID NO.3; reverse primer: the nucleotide sequence is shown in SEQ ID NO.4.

Images