A method for quantifying lentiviral titer

Abstract

The present invention belongs to the technical field of biological product analysis, and specifically relates to a method for quantitatively measuring the titer of a lentivirus. The method of the present invention detects the RRE element and the hALB gene in the genome of a target cell infected with a lentivirus by real-time fluorescence quantitative PCR, and calculates the titer of the lentivirus according to the copy number of the RRE element and the copy number of the hALB gene. The present invention amplifies the genome of the target cell infected with a lentivirus with specific primers, and can accurately and quantitatively measure the titer of the lentivirus without the aid of a fluorescent marker, and the method is simple and highly operable.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological product analysis, and in particular relates to a method for quantitatively measuring the titer of a lentivirus. Background Art

[0002] Lentivirus vector is a gene therapy tool developed based on HIV-1 (human immunodeficiency virus type 1). Because it can act on the G0 / G1 phase of the cell cycle and is nucleophilic, it can infect almost all mammalian cells, stem cells and primary cultured cells. Its toxic genes have been removed and replaced by exogenous target genes, and it is a pseudotype virus. Lentivirus vectors are widely used in gene function research, gene editing, transgenic animal preparation, cell therapy and gene therapy due to their safety, stability and wide host range, and are particularly valuable in cancer immunotherapy, rare disease treatment and vaccine development.

[0003] In the preparation process of lentiviral vectors, accurate determination of viral titer is an important indicator for evaluating the success and quality of viral vector preparation. At present, the main methods for determining lentiviral titer are flow cytometry (FACS), enzyme-linked immunosorbent assay (ELISA), gold label test paper method and quantitative PCR method. Among them, flow cytometry (FACS) is the most commonly used and relatively accurate method for determining lentiviral titer. Although this method can truly reflect the infection ability of lentivirus, it relies on marker genes and is affected by differences in cell status and fluorescent protein expression. It is also complicated to operate and costly, making it difficult to adapt to the high-throughput requirements of conventional laboratories. When the ELISA method is used for quantitative detection, it will be affected by free P24 protein, which may lead to high results and affect accuracy. The gold label test paper method can only achieve qualitative detection and cannot meet the needs of quantitative analysis of viral titer. The traditional quantitative PCR (qPCR) method has a strong control dependence and requires a virus containing a fluorescent marker gene of known titer as a control sample for titer calculation, which increases the experimental steps and complexity. In addition, the primer design and reaction conditions in the traditional method are not optimized enough, which may lead to false positives or insufficient detection sensitivity.

[0004] Therefore, there is an urgent need for a new qPCR-based lentiviral titer determination method that can achieve rapid, sensitive and accurate viral titer determination without fluorescent marker genes, while simplifying the experimental process and reducing operational complexity to meet the drug development needs of cell therapy products. Summary of the invention

[0005] To achieve the above object, the present invention provides a method for quantitatively measuring the titer of a lentivirus, wherein the method comprises detecting the RRE element and the hALB gene in the genome of a target cell infected with a lentivirus by real-time fluorescence quantitative PCR, and calculating the titer of the lentivirus according to the copy number of the RRE element and the copy number of the hALB gene;

[0006] The nucleotide sequence of the RRE element is shown in SEQ ID NO.5;

[0007] The nucleotide sequence of the hALB gene is shown in SEQ ID NO.6;

[0008] The calculation formula of the lentiviral titer is:

[0009] Lentivirus titer = (total number of target cells × average number of lentivirus particles in each target cell) / volume of the sample to be tested;

[0010] The average number of lentiviral particles in each target cell = (the number of copies of the RRE element / the number of copies of the hALB gene) × 2.

[0011] Furthermore, the method comprises the following steps:

[0012] 1) Preparation of standard curve

[0013] Take the RRE element standard and the hALB gene standard respectively, add water to dilute into a series of concentrations, take the standard solution of the series of concentrations, add primers to perform real-time fluorescence quantitative PCR amplification, and draw a standard curve based on the Ct value in the amplification curve and the content of the standard in the standard solution;

[0014] 2) Determination of lentiviral titer

[0015] Take the target cells, add the sample to be tested to infect, extract the genomic DNA in the infected target cells, add primers to perform real-time fluorescence quantitative PCR amplification, record the Ct value, and then obtain the content of the RRE element and the content of the hALB gene according to the standard curve of step 1), calculate the copy number of the RRE element and the copy number of the hALB gene according to the content of the RRE element and the content of the hALB gene by the following formula, and finally calculate the lentivirus titer in the virus suspension sample to be tested;

[0016] The copy number of RRE element = (N A × the content of RRE element) / standard molecular weight of RRE element;

[0017] The copy number of hALB gene = (N A × the content of hALB gene) / the standard molecular weight of hALB gene;

[0018] Among them, N Arepresents the Avogadro constant, the standard molecular weight of the RRE element is: the average molecular weight of a pair of bases × the number of base pairs of the RRE element standard, and the standard molecular weight of the hALB gene is the average molecular weight of a pair of bases × the number of base pairs of the hALB gene standard;

[0019] Furthermore, the nucleotide sequences of the primers in step 1) and step 2) when amplifying the RRE element are shown as SEQ ID Nos. 1 to 2, and the nucleotide sequences when amplifying the hALB gene are shown as SEQ ID Nos. 3 to 4.

[0020] Furthermore, the conditions for the real-time fluorescence quantitative PCR amplification are: 95°C for 30 seconds, enter the cycle; 95°C for 5 seconds, 60°C for 30 seconds, end point plate reading, a total of 40 cycles.

[0021] Furthermore, the RRE element standard product in step 1) is a gene fragment having a nucleotide sequence as shown in SEQ ID NO.5, which is connected to a T vector to obtain a recombinant plasmid;

[0022] The hALB gene standard is a recombinant plasmid obtained by connecting a gene fragment with a nucleotide sequence as shown in SEQ ID NO.6 to a T vector.

[0023] Furthermore, the amplified fragment is obtained by PCR amplification reaction, and the reaction conditions are: 98°C for 10s, 1 cycle; 98°C for 10s, 55°C for 10s, 72°C for 60s, 30 cycles; 72°C for 5min, 1 cycle.

[0024] Furthermore, the contents of the RRE element standard and the hALB gene standard in the standard solution of step 1) are 0.005-500 ng respectively.

[0025] Furthermore, the target cells are Jurkat cells.

[0026] Furthermore, the sample to be tested is a virus suspension containing a lentivirus.

[0027] Furthermore, the lentivirus includes a lentiviral vector; the lentiviral vector includes an HIV-1 type vector.

[0028] The beneficial effects of the present invention are:

[0029] The method for quantitatively measuring the titer of a lentivirus of the present invention first infects a target cell with a sample to be tested containing a lentivirus, extracts genomic DNA from the infected target cell, and then measures the copy number of the RRE element and the copy number of the hALB gene in the genomic DNA. The average number of lentivirus particles in each target cell is calculated based on the copy number of the RRE element and the copy number of the hALB gene. The number of lentivirus particles per unit volume of the sample to be tested is then calculated based on the total number of target cells and the average number of lentivirus particles in each target cell, thereby obtaining the titer of the lentivirus in the sample to be tested ( Figures 1-2 ). The quantitative detection method of the present invention has been verified by experiments and has been determined to be able to accurately and quantitatively determine the titer of the lentivirus without the aid of fluorescent markers, and the method is simple and has strong operability.

[0030] After a lot of exploration and research in the early stage of the present invention, it was found that after the lentivirus successfully infects the target cell, the entire exogenous gene expression frame containing the RRE element can be introduced into the genome of the target cell, and the RRE element does not exist in the animal cell body under normal conditions. Therefore, the RRE element is used as a quantitative detection marker after the lentivirus is inserted into the target cell genome. The hALB gene is a stable single-copy gene in the target cell. Using the hALB gene as an internal reference gene to correct the error when quantifying the lentivirus titer can ensure the accuracy of the measurement results. When the lentivirus infects the target cell, the Jurkat cell infection efficiency is high, which can reduce the systematic error in the process of measuring the lentivirus titer. Therefore, Jurkat cells are very suitable as target cells infected by the lentivirus. After determining these key factors affecting the determination of lentiviral titer, it was also found that when amplifying the RRE element and hALB gene in the genome of the target cells after lentivirus infection, the selection and design of primers directly affected the amplification efficiency and the accuracy of the quantitative detection results. After screening, only the primers shown in SEQ ID No. 1 to 2 were able to amplify the RRE element, and the primers shown in SEQ ID No. 3 to 4 were able to ensure specific amplification when amplifying the hALB gene, thereby achieving accurate determination of the lentiviral titer.

[0031] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.

[0032] The above contents of the present invention are further described in detail below through specific implementation methods in the form of embodiments. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. All technologies realized based on the above contents of the present invention belong to the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 A flowchart of a method for quantitatively detecting the titer of a lentivirus;

[0034] Figure 2 A flow chart of a method for determining the copy number of the RRE element in genomic DNA and the copy number of the hALB gene during the detection of lentiviral titer;

[0035] Figure 3 It is the agarose gel electrophoresis comparison diagram of the PCR products of the RRE element and the hALB gene (M represents Marker, 1 and 2 represent the PCR products of the RRE gene, and 3 and 4 represent the PCR products of the hALB element);

[0036] Figure 4 is the amplification curve of the RRE element standard;

[0037] Figure 5 This is the melting curve of the RRE element standard;

[0038] Figure 6 A standard curve graph is drawn with the logarithm of the content of the RRE component standard product as the abscissa and the Ct value of the RRE component standard product as the ordinate;

[0039] Figure 7 is the amplification curve of hALB gene standard;

[0040] Figure 8 is the melting curve diagram of hALB gene standard;

[0041] Fig. 9 The standard curve is plotted with the logarithm of the content of the hALB gene standard as the abscissa and the Ct value of the hALB gene standard as the ordinate. DETAILED DESCRIPTION

[0042] The raw materials, reagents and equipment used in the specific embodiments of the present invention are all purchased from the market. The nucleotide sequence information involved is shown in Table 1:

[0043] Table 1. Sequence list

[0044] sequence name Base sequence (5'-3') Serial Number RRE-F AAACTCATTTGCACCACTGC SEQ ID NO:1 RRE-R AATTTCTCTGTCCCACTCCATC SEQ ID NO:2 hALB-F GCTGTCATCTCTTGTGGGCTGT SEQ ID NO:3 hALB-R ACTCATGGGAGCTGCTGGTTC SEQ ID NO:4

[0045] Note: The RRE element upstream primer shown in SEQ ID No.1 and the RRE element downstream primer shown in SEQ ID No.2 can specifically amplify the RRE element; the hALB gene upstream primer shown in SEQ ID No.3 and the hALB gene downstream primer shown in SEQ ID No.4 can specifically amplify the hALB gene;

[0046] The nucleotide sequence of the amplified RRE element is SEQ ID NO.5:

[0047] aaactcatttgcaccactgctgtgccttggaatgctagttggagtaataaatctctggaacagatttggaatcacacgacctggatgga gtgggacagagaaatt

[0048] The nucleotide sequence of the amplified hALB gene is SEQ ID NO.6:

[0049] gctgtcatct cttgtgggct gtaatcatcg tctaggctta agagtaatat tgcaaaacctgtcatgccca cacaaatctc tccctggcat tgttgtcttt gcagatgtca gtgaaagag

[0050] The specific calculation formula involved is as follows:

[0051] Lentivirus titer = (total number of target cells × average number of lentivirus particles in each target cell) / volume of the sample to be tested;

[0052] The average number of lentiviral particles in each target cell = (the number of copies of the RRE element / the number of copies of the hALB gene) × 2.

[0053] The copy number of RRE element = (N A × the content of RRE element) / standard molecular weight of RRE element;

[0054] The copy number of hALB gene = (N A × the content of hALB gene) / the standard molecular weight of hALB gene;

[0055] Among them, N A represents Avogadro's constant. The standard molecular weight of the RRE element is: the average molecular weight of a pair of bases × the number of base pairs of the RRE element standard. The standard molecular weight of the hALB gene is: the average molecular weight of a pair of bases × the number of base pairs of the hALB gene standard.

[0056] Example 1 Quantitative detection of lentivirus titer by the present invention

[0057] 1) Preparation of RRE element standards and hALB gene standards

[0058] Using the pCDH-EF1-copGFP plasmid as a template, the upstream primer of the RRE element template shown in SEQ ID No.1 and the downstream primer of the RRE element template shown in SEQ ID No.2 were added according to the system recommended by the Phanta Max Super-Fidelity DNA Polymerase kit to carry out PCR amplification reaction. The reaction conditions were 98°C for 10 s, 1 cycle; 98°C for 10 s, 55°C for 10 s, 72°C for 60 s, 30 cycles; 72°C for 5 min, 1 cycle.

[0059] Using the Jurkat cell genome as a template, the upstream primer of the hALB element template shown in SEQ ID No.3 and the downstream primer of the hALB gene template shown in SEQ ID No.4 were added according to the system recommended by the Phanta Max Super-Fidelity DNA Polymerase kit to carry out PCR amplification reaction. The reaction conditions were 98°C for 10 s, 1 cycle; 98°C for 10 s, 55°C for 10 s, 72°C for 60 s, 30 cycles; 72°C for 5 min, 1 cycle.

[0060] After the reaction was completed, the generation of RRE element PCR products and hALB gene PCR products was detected by 1% agarose gel electrophoresis. The results are as follows: Figure 3 shown.

[0061] from Figure 3 It can be seen that the position of the PCR product of the RRE element is between 100bp and 250bp, and the position of the PCR product of the hALB gene is near 100bp, which is consistent with the expectation (139bp and 105bp). In addition, the product bands of both are single, indicating that the PCR specific amplification of the RRE element and the hALB gene is very successful.

[0062] The two PCR products were recovered separately using a DNA gel recovery kit, and then connected to the T vector. A plasmid extraction kit was used to extract high-purity recombinant plasmids. The plasmid concentration was then determined using a Thermo Nanodrop 2000 spectrophotometer and diluted to 100 ng / μL with double distilled water to obtain RRE element standards and hALB gene standards.

[0063] 2) Establish the standard curve of RRE element standard and hALB gene standard

[0064] a: Standard curve of RRE component standard

[0065] Take 5 μL of the RRE element standard obtained in step 1) with a concentration of 100 ng / μL (mass is 500 ng), and dilute it in a gradient with double distilled water in multiples of 10, and dilute it 5 times to obtain a total of 6 levels of RRE element standards. According to the system recommended by the iTaq Universal SYBR Green (Bio-Rad) kit, these 6 levels of RRE element standards are used as templates, and the RRE element upstream primer shown in SEQ ID NO: 1 and the RRE element downstream primer shown in SEQ ID NO: 2 are added respectively to carry out real-time fluorescence quantitative PCR amplification reaction. The reaction conditions are: 95°C for 30 seconds, enter the cycle; 95°C for 5 seconds, 60°C for 30 seconds, read the plate at the end point, and a total of 40 cycles. The following is obtained: Figure 4 The amplification curves shown and Figure 5 Melting curves are shown.

[0066] according to Figure 4 The amplification curve shown in FIG. 1 is used to obtain the Ct value of each RRE component standard amplified. The standard curve of the RRE component standard is established according to the corresponding relationship between the Ct value and the content of the RRE component standard. Figure 6 The curve equation is Y = -0.9610*X + 36.40, R 2 =0.9918, wherein the ordinate is the logarithm of the copy number of the RRE element standard (log10), and the abscissa is the Ct value of the RRE element standard.

[0067] b: Standard curve of hALB gene standard

[0068] Take 5 μL of the hALB gene standard obtained in step 1) with a concentration of 100 ng / μL (mass is 500 ng), and dilute it in a gradient with double distilled water in multiples of 10, and dilute it 5 times to obtain a total of 6 levels of hALB gene standards. According to the system recommended by the iTaq Universal SYBR Green (Bio-Rad) kit, these 6 levels of hALB gene standards are used as templates, and the hALB gene standard upper primer shown in SEQ ID NO: 3 and the hALB gene standard downstream primer shown in SEQ ID NO: 4 are added respectively to carry out real-time fluorescence quantitative PCR amplification reaction. The reaction conditions are: 95°C for 30 seconds, enter the cycle; 95°C for 5 seconds, 60°C for 30 seconds, end point reading, a total of 40 cycles. The following is obtained: Figure 7 The amplification curves shown and Figure 8 Melting curves are shown.

[0069] according to Figure 7The amplification curve shown in FIG. 1 is used to obtain the Ct value of each hALB gene standard amplified. The standard curve of the hALB gene standard is established according to the corresponding relationship between the Ct value and the content of the hALB gene standard. Fig. 9 The curve equation is Y=-0.9738*X+36.57, R2=0.9902, wherein the ordinate is the logarithm of the copy number of the hALB gene standard with log10 as the base, and the abscissa is the Ct value of the hALB gene standard.

[0070] from Figure 4 Amplification curves of the RRE element standard and Figure 7 As shown in the amplification curve of the hALB gene standard, it can be seen that the amplification curves of the RRE element standards with different content gradients and the hALB gene standard are distributed relatively evenly on the amplification curve graph, indicating that the linearity of PCR amplification is good.

[0071] from Figure 5 The melting curves of the RRE element standards and Figure 8 As can be seen from the melting curve of the hALB gene standard, the amplification products of the RRE element and the hALB gene each have only one peak, indicating that the PCR product has good specificity.

[0072] from Figure 6 The standard curve of the RRE element standard is shown as well as Fig. 9 As can be seen from the standard curves of the hALB gene standard, the R2 of both standard curves is greater than 0.99, which again shows that the linear amplification degree of PCR is good, indicating that the quantitative PCR primers of the RRE element and the hALB gene can be well used for the subsequent lentiviral titer determination.

[0073] 3) Quantitative determination of lentiviral titer

[0074] Take 4×10 5 Jurkat cells were inoculated in a 6-well plate, 8 μL of the sample to be tested (i.e., the virus suspension containing the lentiviral HIV-1 vector) and 1 mL of 1640 complete medium were added, and polybrene with a final concentration of 4 μg / mL was added and mixed, and then transferred to a culture dish for culture. After 24 hours, the medium containing the lentivirus was replaced with 1640 complete medium, and the Jurkat cells were collected after continued culture for 72 hours, and their genomic DNA was extracted using a genomic DNA extraction kit.

[0075] According to the system recommended by the iTaq Universal SYBR Green (Bio-Rad) kit, genomic DNA was used as an amplification template, and the upstream primer of the RRE element shown in SEQ ID No. 1 and the downstream primer of the RRE element shown in SEQ ID No. 2 were added to perform real-time fluorescence quantitative PCR amplification reaction. The reaction conditions were: 95°C for 30 seconds, entering the cycle; 95°C for 5 seconds, 60°C for 30 seconds, end point reading, and a total of 40 cycles. The amplification of genomic DNA was recorded by a fluorescence quantitative PCR instrument, and the obtained Ct value was recorded. The Ct value of the amplified RRE element was 19.84.

[0076] According to the system recommended by the iTaq Universal SYBR Green (Bio-Rad) kit, genomic DNA was used as an amplification template, and the upstream primers of the hALB gene shown in SEQ ID No.3 and the downstream primers of the hALB gene shown in SEQ ID No.4 were added to perform real-time fluorescence quantitative PCR amplification reaction. The reaction conditions were: 95°C for 30 seconds, entering the cycle; 95°C for 5 seconds, 60°C for 30 seconds, end point plate reading, and a total of 40 cycles. The amplification of genomic DNA was recorded by a fluorescence quantitative PCR instrument, and the obtained Ct value was recorded. The Ct value of the amplified hALB gene was 21.75.

[0077] The Ct value of the amplified RRE element was taken into Figure 6 In the standard curve shown, the total copy number of the RRE element in the genomic DNA was calculated to be 155500.7486.

[0078] Next, the Ct value of the amplified hALB element was inserted into Fig. 9 In the standard curve shown, the total copy number of the hALB element in the genomic DNA was calculated to be 45324.39053.

[0079] The average number of lentiviral particles in each Jurkat cell (Particles of 293T) was calculated = (number of copies of the RRE element / number of copies of the hALB gene) × 2 = (155500.7486÷45324.39053) × 2 = 6.861680731.

[0080] Then calculate the number of lentivirus particles per unit volume of the sample to be tested (i.e., the lentivirus titer in the sample to be tested, Titer, TU / mL) = (total number of target cells × average number of lentivirus particles per target cell) / volume of the sample to be tested = (4 × 10 5 ×6.861680731)÷8*1000=3.43×10 8 .

[0081] From the above results of quantitative detection of lentivirus titer, it can be seen that amplifying the genome of Jurkat cells infected with lentivirus with specific primers can accurately and quantitatively determine the titer of lentivirus without the aid of fluorescent markers, and the method is simple and highly operable.

Claims

1. A method for quantifying lentiviral titer, characterized in that: The method comprises detecting the RRE element and the hALB gene in the genome of the target cell infected with the lentivirus by real-time fluorescence quantitative PCR, and calculating the lentivirus titer according to the copy number of the RRE element and the copy number of the hALB gene; The nucleotide sequence of the RRE element is shown in SEQ ID NO.5; The nucleotide sequence of the hALB gene is shown in SEQ ID NO.6; The calculation formula of the lentiviral titer is: Lentivirus titer = (total number of target cells × average number of lentivirus particles in each target cell) / volume of the sample to be tested; The average number of lentiviral particles in each target cell = (the number of copies of the RRE element / the number of copies of the hALB gene) × 2.

2. The method according to claim 1, characterized in that: The method comprises the following steps: 1) Preparation of standard curve Take the RRE element standard and the hALB gene standard respectively, add water to dilute into a series of concentrations, take the standard solution of the series of concentrations, add primers to perform real-time fluorescence quantitative PCR amplification, and draw a standard curve based on the Ct value in the amplification curve and the content of the standard in the standard solution; 2) Determination of lentiviral titer Take the target cells, add the sample to be tested to infect, extract the genomic DNA in the infected target cells, add primers to perform real-time fluorescence quantitative PCR amplification, record the Ct value, and then obtain the content of the RRE element and the content of the hALB gene according to the standard curve of step 1), calculate the copy number of the RRE element and the copy number of the hALB gene according to the content of the RRE element and the content of the hALB gene by the following formula, and finally calculate the lentivirus titer in the virus suspension sample to be tested; The copy number of RRE element = (N A × the content of RRE element) / standard molecular weight of RRE element; The copy number of hALB gene = (N A × the content of hALB gene) / the standard molecular weight of hALB gene; Among them, N A represents Avogadro's constant. The standard molecular weight of the RRE element is: the average molecular weight of a pair of bases × the number of base pairs of the RRE element standard. The standard molecular weight of the hALB gene is: the average molecular weight of a pair of bases × the number of base pairs of the hALB gene standard.

3. The method according to claim 2, characterized in that: The nucleotide sequences of the primers used in step 1) and step 2) for amplifying the RRE element are shown in SEQ ID Nos. 1 to 2, and the nucleotide sequences used in amplifying the hALB gene are shown in SEQ ID Nos. 3 to 4.

4. The method according to claim 2 or 3, characterized in that: The conditions of the real-time fluorescence quantitative PCR amplification are: 95° C. for 30 seconds, enter the cycle; 95° C. for 5 seconds, 60° C. for 30 seconds, read the plate at the end point, for a total of 40 cycles.

5. The method according to claim 2, characterized in that: Step 1) The RRE element standard is a gene fragment having a nucleotide sequence as shown in SEQ ID NO.5, connected to a T vector to obtain a recombinant plasmid; The hALB gene standard is a recombinant plasmid obtained by connecting a gene fragment with a nucleotide sequence as shown in SEQ ID NO.6 to a T vector.

6. The method according to claim 5, characterized in that: The amplified fragment was obtained by PCR amplification reaction, and the reaction conditions were: 98°C for 10s, 1 cycle; 98°C for 10s, 55°C for 10s, 72°C for 60s, 30 cycles; 72°C for 5min, 1 cycle.

7. The method according to claim 2, characterized in that: Step 1) The contents of the RRE element standard and the hALB gene standard in the standard solution are 0.005-500 ng, respectively.

8. The method according to any one of claims 1 to 7, characterized in that: The target cells are Jurkat cells.

9. The method according to any one of claims 1 to 7, characterized in that: The sample to be tested is a virus suspension containing lentivirus.

10. The method according to any one of claims 9, characterized in that: The lentivirus includes a lentiviral vector; the lentiviral vector includes an HIV-1 type vector.

Images