Application of a modified DNA carrier to detect human thrombin based on solid-state nanopores

Abstract

The invention discloses an application of a modified DNA carry for detecting human thrombin based on solid-state nanopores. The modified double-stranded DNA (dsDNA) molecule is connected to the binding region of a specific protein to accurately detect the protein molecule to be detected. The designed double-stranded DNA forgings respectively contain 3'-end cholesterol (circle structure) modification to facilitate the capture of the perforation rate; the 5'-end contains biotin (small rectangle) modification to facilitate the specific purification of streptavidin magnetic beads. The modified DNA carry of the invention is easy to construct and has a high negative charge. The target selectivity and binding affinity (usually from nM to pM) can be improved by protein engineering design. The selectivity and affinity are particularly important in the detection and identification of rare biomolecules or disease diagnosis in clinical samples or other biological fluids, thereby further reducing the interaction of nonspecific binding analytes and preventing the commonly reported pore blockage.

Description

Technical Field

[0001] The present invention belongs to the field of protein single molecule detection, and specifically relates to an application of a modified DNA carrier in detecting human thrombin based on a solid-state nanopore. Background Art

[0002] Measurable changes in protein concentrations in serum and other physiological fluids are often indicative of disease; with early diagnosis, accurate and effective treatments can be implemented to prevent disease progression. While many different biosensors have been demonstrated to have the ability to identify and quantify proteins, they often lack the specificity and / or sensitivity to perform early diagnosis in real samples containing many (thousands) of background proteins, which are often present at concentrations several orders of magnitude higher than the target marker. Nanoparticles have been shown to be promising tools for the detection of DNA, RNA, proteins, DNA-binding proteins, and other molecules because they allow single-molecule-level and rare event analysis that is often obscured by ensemble averaging. The detection method is straightforward; individual molecules are identified by transient modulations of the ionic (nanopore) current as each analyte molecule passes through the pore under the influence of an applied potential. These current modulations often depend on the volume, charge, and conformation of the individual molecules in the pore. However, the detection of proteins using nanopores is often challenging due to their uneven charge, fast translocation times, poor signal-to-noise ratios, especially for small proteins (<15 kDa), and nonspecific adsorption to the pore. While some advances have been made, such as the use of high-bandwidth amplifiers, the biggest limitation of nanopore protein sensing may be its lack of specificity, which makes it challenging to distinguish between multiple analytes, let alone try to obtain meaningful data from complex biological matrices such as serum or cerebrospinal fluid.

[0003] To date, several strategies have been used to develop solutions to these fundamental problems. For example, selectivity has been improved by optimizing the pore surface and incorporating mobile lipid bilayer ligands, allowing the detection of amyloid-β oligomers and fibrils.

[0004] The shape, volume, charge, rotational diffusion coefficient, and dipole moment of individual proteins are quantified. Strategies for detecting PNAs bound to large DNA molecules increase the signal-to-noise ratio of subscale ionic currents caused by the complex passing through the pore. High concentrations of RecA are used to detect protein patterns naturally bound to DNA to ensure the ability to fully coat the DNA. However, they still require extensive engineering design, complex immobilization or coupling steps, relatively high analyte concentrations, and are limited by selective and nonspecific binding. In addition, nanopore detection is usually performed at high ionic strength (up to 4 M LiCl), where the buffer ionic strength and composition deviate significantly from physiological salt concentrations and may have a huge impact on protein binding and conformation.

[0005] The protein target is human α-thrombin (α-thrombin) (mw 37.5 kDa; pI 7.0-7.4), a trypsin-like serine protease that is the only enzyme capable of catalyzing the conversion of soluble fibrinogen to insoluble fibrin. Elevated pM range of thrombin in the blood is associated with thrombotic diseases, and for early detection of thrombosis, trace levels of this protein must be detected with high sensitivity. Summary of the invention

[0006] In view of the defects and problems of existing human thrombin detection, the present invention aims to provide a new protein detection application based on modified DNA vectors and solid-state nanopore technology. By rationally designing DNA vectors and optimizing nanopore performance, rapid, sensitive, specific and low-cost detection of protein markers can be achieved, thus overcoming the limitations of traditional methods.

[0007] The solution adopted by the present invention to solve its technical problem is: application of a modified DNA carrier based on solid-state nanopore to detect human thrombin.

[0008] The DNA carry is constructed by hybridization of a template strand and a complementary strand.

[0009] The sequence of the template strand is: 5'- GGTGACGTATGGTGTGGTTGG AGGTCGCCGCCCAGCTAGCTACATCGATC-cholesterol-3'; the sequence of the complementary chain is: 3'-TCCAGCGGCGGGTCGATCGATGTAGCTAG GGTGACGTAT GGTGTGGTTGG -Biotin-5'.

[0010] The forging of the template strand can optimize the capture perforation rate; the complementary strand can optimize the specific purification of streptavidin magnetic beads.

[0011] The solid-state nanopore modification comprises the following steps:

[0012] Step 1, cleaning a silicon nitride chip with a pore diameter of 50 nm with anhydrous ethanol;

[0013] Step 2, the cleaned silicon nitride chip is placed in a mixture of methanol and ethanol for 15 minutes and then rinsed with deionized water;

[0014] Step 3, drying the silicon nitride chip under a nitrogen flow;

[0015] Step 4, soaking the dried silicon nitride chip in a 1M NaOH ethanol solution for 5 minutes;

[0016] Step 5: Wash the soaked silicon nitride chip multiple times with deionized water and dry it under a nitrogen flow.

[0017] The mixing ratio of methanol to ethanol in the methanol and ethanol mixture in step 2 is 1:1.

[0018] The number of washings in step 5 is 3 times.

[0019] Beneficial effects of the present invention: The present invention provides a modified DNA carry based on solid-state nanopore detection of human thrombin, which accurately detects the protein molecules to be detected by utilizing modified double-stranded DNA (dsDNA) molecules to connect to the binding region of specific proteins.

[0020] The present invention uses a synthetic terminal modified overhang as an ideal attachment site for the aptamer sequence to form a specific detection probe. dsDNA is a universal carrier that can select the aptamer to bind or debind to the carrier, while overcoming the transport restrictions caused by the heterogeneous surface charge of the protein; the charge of the designed DNA carry-protein complex is mainly dominated by the negative charge of the DNA carrier backbone, so this method facilitates the effective transport of net positive / negative or even neutral proteins without modifying the measurement conditions, and without sample pretreatment or purification, and can be directly detected at near physiological salt concentrations.

[0021] The designed double-stranded DNA forgings contain cholesterol (circle structure) modification at the 3' end to facilitate the capture of perforation rate; and biotin (small rectangle) modification at the 5' end to facilitate the specific purification of streptavidin magnetic beads.

[0022] The constructed DNA carry vector can selectively detect proteins. Compared with traditional immunoassays or existing multiplexed nanopore methods, it does not require repeated target binding steps, expensive oligomer modification or the use of high concentrations of cultured antibodies, thus greatly reducing operation time and cost. Modified DNA carries are easy to construct and highly negatively charged, and their target selectivity and binding affinity (usually from nM to pM) can be improved through protein engineering. Selectivity and affinity are particularly important in the detection and identification of rare biomolecules or disease diagnosis in clinical samples or other biological fluids, thereby further reducing nonspecific binding analyte interactions and preventing the commonly reported pore clogging. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 It is a schematic diagram of the modified DNA carry structure of the present invention.

[0024] Figure 2 It is a schematic diagram of the template chain and complementary chain sequence of the present invention.

[0025] Figure 3It is a schematic diagram of the result of the DNA carry-thrombin complex of the present invention passing through a solid-state nanopore at +180 mV. DETAILED DESCRIPTION

[0026] The present invention is further described below in conjunction with the accompanying drawings and embodiments.

[0027] Example 1

[0028] This embodiment provides a modified DNA carrier for use in solid-state nanopore detection of human thrombin. The modified DNA carrier is constructed by hybridization of a template strand and a complementary strand. The sequence of the template strand is: 5'- GGTGACGTATGGTGTG GTTGG AGGTCGCCGCCCAGCTAGCTACATCGATC-cholesterol-3'; the sequence of the complementary chain is: 3'-TCCAGCGGCGGGTCGATCGATGTAGCTAG GGTGACGTATGGTGTGGTTGG -Biotin-5'.

[0029] The template strand and complementary strand are oligonucleotides synthesized by Shanghai Bioengineering. α-Thrombin comes from Sigma. The nucleic acid sequence marked with horizontal lines is the region that binds to thrombin.

[0030] The hybridization construction steps of the modified DNA carry vector are as follows: the template chain and the complementary chain are added to 20 μL of hybridization buffer (150 mM sodium chloride, 10 mM MgCl2, 1 mM Tris-EDTA, pH 7.5) in a 1:1 ratio, and the hybridization program is set on the Macrostone PCR instrument as follows: heating to 95°C for 5 minutes, annealing at 65°C for 10 minutes, cooling to room temperature for 10 minutes, and storing at -20°C.

[0031] Solid-state nanopore modification involves the following steps:

[0032] Step 1: Clean the silicon nitride chip with a pore diameter of 50 nm with anhydrous ethanol for 30 minutes.

[0033] Step 2: After cleaning, the silicon nitride chip is placed in a mixture of methanol and ethanol for 15 minutes, and then rinsed with deionized water; the mixing ratio of methanol to ethanol in the mixture of methanol and ethanol is 1:1.

[0034] Step 3, drying the silicon nitride chip under a nitrogen flow.

[0035] Step 4, soak the dried silicon nitride chip in a 1M NaOH (4 g NaOH + 10 mL EtOH + 90 mL deionized water) ethanol solution for 5 minutes;

[0036] Step 5, washing the soaked silicon nitride chip three times with deionized water and drying it under a nitrogen flow.

[0037] The measurement and detection of ion current, the experiments of this embodiment were all carried out at room temperature, the detection buffer was 100mM KCl, 10mM Tris, 10mM HEPES and 1mM EDTA, pH 8.0, the DNA carry concentration was 100pM, and the thrombin protein concentration was 1.6nM-4.8nM.

[0038] In this example, the streptavidin magnetic bead kit of Donna Biotechnology (Mag3301) was used for purification to capture the biotinylated DNA carry-thrombin complex. The specific steps are as follows:

[0039] 1) Incubate the DNA carrier with thrombin at a ratio of 1:3, 1:2 or 1:3 at room temperature for 30 minutes.

[0040] 2) Gently vortex the beads for 20 seconds before use. Add 100 μL of streptavidin magnetic beads to a 1.5 mL microcentrifuge tube. Place the tube in a magnetic rack to collect the beads and remove and discard the supernatant. Note: It is recommended to use a ratio of 1:1 or 2:1 between biotinylated molecules and magnetic beads to achieve saturation of bead binding. The amount of biotinylated molecules needs to be optimized based on experimental conditions.

[0041] 3) Add 1 mL of Wash Buffer A to the tube. Mix by repeatedly inverting the tube or gently vortexing. Collect the beads using a magnetic rack, then remove and discard the supernatant, and repeat this step twice.

[0042] 4) Add 500 μL of biotinylated nucleic acid diluted in wash buffer A (to achieve a bead concentration of 2 mg / mL), mix thoroughly by shaking, and agitate at room temperature for 30 minutes.

[0043] 5) Collect the beads using a magnetic rack and transfer the supernatant to a new tube.

[0044] 6) Repeat “Step 2” twice to wash the magnetic beads.

[0045] Data detection: Axopatch 200B patch clamp amplifier (Molecular Devices, USA) was used for measurement. The analyte was placed in a negatively charged quartz nanopore and connected to the connector through an Ag / AgCl electrode that had been chlorinated with sodium hypochlorite for 30 minutes. The signal was filtered at 5 or 10 kHz using a low-pass Bessel filter and digitized using a Digidata1440A at a sampling rate of 50-100 kHz. The data was processed using the matching Clampfit11.2 software, and the processing results are shown inFigure 3 shown.

[0046] The selectivity and affinity of the modified DNA carry of this embodiment are particularly important in the detection and identification of rare biomolecules or diseases in clinical samples or other biological fluids, and proteins can be selectively detected by constructing DNA carry carriers. Compared with traditional immunoassays or existing multi-channel nanopore methods, there is no need for repeated targeted binding steps, expensive oligomer modification or the use of high concentrations of cultured antibodies, thus greatly reducing the operation time and cost. DNA carry is easy to construct, with a high negative charge, and can be designed by protein engineering to improve their target selectivity and binding affinity (usually from nM to pM), thereby further reducing the interaction of non-specific binding analytes and preventing the commonly reported pore blockage. It should be understood that the above-mentioned specific embodiments of the present invention are only used to illustrate or explain the principles of the present invention, and do not constitute a limitation of the present invention. Therefore, any modifications, equivalent substitutions, improvements, etc. made without departing from the spirit and scope of the present invention should be included in the scope of protection of the present invention. In addition, the claims attached to the present invention are intended to cover all changes and modifications that fall within the scope and boundaries of the attached claims, or the equivalent forms of such scopes and boundaries.

Claims

1. Application of a modified DNA carrier for solid-state nanopore-based detection of human thrombin.

2. The use according to claim 1, characterized in that: The modified DNA carry is constructed by hybridization of a template strand and a complementary strand.

3. The use according to claim 2, characterized in that: The sequence of the template strand is: 5'- GGTGACGTATGGT GTGGTTGG AGGTCGCCGCCCAGCTAGCTACATCGATC-cholesterol-3'; the sequence of the complementary chain is: 3'-TCCAGCGGCGGGTCGATCGATGTAGCTAG GGTGACGTATGGTGTGGTTGG -Biotin-5'.

4. The use according to claim 3, characterized in that: The forging of the template strand can optimize the capture perforation rate; the complementary strand can optimize the specific purification of streptavidin magnetic beads.

5. The use according to claim 1, characterized in that: The solid-state nanopore modification comprises the following steps: Step 1, cleaning a silicon nitride chip with a pore diameter of 50 nm with anhydrous ethanol; Step 2, the cleaned silicon nitride chip is placed in a mixture of methanol and ethanol for 15 minutes and then rinsed with deionized water; Step 3, drying the silicon nitride chip under a nitrogen flow; Step 4, soaking the dried silicon nitride chip in a 1M NaOH ethanol solution for 5 minutes; Step 5: Wash the soaked silicon nitride chip multiple times with deionized water and dry it under a nitrogen flow.

6. The use according to claim 5, characterized in that: The mixing ratio of methanol to ethanol in the methanol and ethanol mixture in step 2 is 1:

1.

7. The use according to claim 5, characterized in that: The number of washings in step 5 is 3 times.

Images