Preparation method and application of targeted co-delivery system based on pMMP-1 and hydroxychloroquinoline

Abstract

The invention provides a preparation method and application of a targeted co-delivery system based on pMMP-1 and hydroxychloroquinoline, retinol with specific targeting to activated hepatic stellate cells is selected as a modification group, a targeted nano drug delivery system is obtained after a delivery carrier is modified, electronegative pMMP-1 is electrostatically adsorbed by utilizing the electropositive property of PR, and the targeted co-delivery system is obtained by utilizing the electronegative property of PR. An autophagy inhibitor HCQ is wrapped while electrostatic adsorption is carried out, so that a targeting co-delivery system which has an active targeting effect on aHSCs and is based on pMMP-1 and HCQ is obtained. The invention inhibits the autophagy of aHSCs, reduces the energy supply of activation of aHSCs, reduces the expression of fibrosis-related proteins, promotes the degradation of ECM, and blocks the promotion effect of mechanical force generated by ECM on the activation of HSCs. According to the present invention, the HSCs activation is inhibited while the ECM deposited outside the HSCs is degraded, such that the synergetic anti-hepatic fibrosis treatment effect is well achieved, the problems of complex hepatic fibrosis pathogenesis and poor effect of the single treatment means are solved, and the good clinical application prospect is provided.

Description

Technical Field

[0001] The present invention relates to the field of targeted drugs, in particular to a method for preparing a targeted co-delivery system loaded with hydroxychloroquine (HCQ), an autophagy inhibitor, and a plasmid MMP-1 (pMMP-1) that promotes matrix degradation and modified with retinol (ROL). Such drug delivery systems can be used for the treatment of liver fibrosis. Background Art

[0002] Liver fibrosis is a chronic pathological injury to the liver caused by alcohol, viruses, and drugs, which can lead to the activation of hepatic stellate cells (HSCs) and excessive deposition of extracellular matrix (ECM). If not treated promptly, liver fibrosis can develop into cirrhosis and even liver cancer. Currently, there are no effective drugs approved for the treatment of liver fibrosis in clinical practice. Due to the complex pathological mechanism of liver fibrosis, treating liver fibrosis in a synergistic way is an important strategy.

[0003] In the development of liver fibrosis, activated hepatic stellate cells are the main driving cells. Studies have shown that autophagy of other types of liver cells can maintain cell homeostasis and reduce the occurrence of liver fibrosis. However, the autophagy of HSCs promotes the metabolism of lipid droplets (LDs) and provides energy for the activation of HSCs, so the occurrence of autophagy promotes the activation of HSCs [Li-Shuang Hou (Hou Lishuang), et al. Pharmacol Ther, 2022; 234: 108117]. Activated hepatic stellate cells (aHSCs) synthesize and secrete a large amount of ECM deposited outside the cells. The reactivation of HSCs caused by the mechanical traction of ECM can promote the occurrence of liver fibrosis and form a vicious cycle of liver fibrosis development. Previous studies have found that targeted inhibition of autophagy in aHSCs can reverse the activation of HSCs and improve liver fibrosis, but the effect on the degradation of ECM already formed in the liver is not satisfactory, which will still lead to the continuous deterioration of liver fibrosis. Therefore, inhibiting the autophagy of HSCs alone cannot completely solve the fundamental problem of liver fibrosis, and the degradation of ECM must be promoted at the same time. It is of great significance to use the strategy of drug co-loading and targeted aHSCs delivery to reduce the vicious cycle of liver fibrosis development.

[0004] Our previous studies have found that hydroxychloroquine (HCQ), as an autophagy inhibitor, has a good effect in inhibiting HSCs autophagy and activation [Li-Shuang Hou (Hou Lishuang), et al. Liver Int, 2024; 44: 1937-1951], which laid an experimental foundation for the development of anti-liver fibrosis therapeutic drugs. In view of the great potential of gene drugs in disease treatment, it is expected to become an important means of treating liver fibrosis. In this study, pcDNA3.1-MMP-1 (pMMP-1) plasmid was used to promote the expression of MMP-1, increase ECM degradation, and reduce its deposition, thereby avoiding ECM-induced HSCs reactivation. However, the plasmid is easily degraded by nucleases, and the plasmid and free HCQ have no cell targeting, which weakens the therapeutic effect and produces side effects. Therefore, it is necessary to construct a targeted aHSCs co-delivery system based on pMMP-1 and hydroxychloroquine to ensure the targeted delivery of drugs to aHSCs, and solve the problem of complex etiology of liver fibrosis and poor effect of single treatment methods in a synergistic treatment manner, which is of great significance for the treatment of liver fibrosis. Summary of the invention

[0005] In order to overcome the deficiencies of the prior art, the present invention provides a method for preparing and applying a targeted co-delivery system based on pMMP-1 and hydroxychloroquine. The purpose of the present invention is to utilize ROL to modify a nano drug delivery system and load HCQ and pMMP-1 to target aHSCs to inhibit autophagy, thereby reducing the expression of autophagy-related proteins and fibrosis-related proteins, and promoting the degradation of the extracellular matrix, blocking the mechanical force generated by the ECM to cause the reactivation of aHSCs, and preparing a targeted nano drug delivery system that can synergistically treat liver fibrosis. This type of drug delivery system utilizes ROL to have specific targeted recognition of aHSCs to achieve targeted delivery of drugs. Reduce the accumulation of small molecule drugs HCQ in other parts of the body and the uptake of other cells in the liver, while protecting the plasmid from being degraded by nucleases, thereby better achieving the specificity and targeting of autophagy inhibition and ECM degradation, and providing new strategies and ideas for the research of anti-liver fibrosis drugs.

[0006] The present invention discloses a preparation method and application of a targeted co-delivery system based on pMMP-1 and hydroxychloroquine. A drug delivery system of co-loaded autophagy inhibitor hydroxychloroquine (HCQ) and plasmid MMP-1 (pMMP-1) for degrading extracellular matrix with targeted modification of retinol (ROL) is prepared, and used for active targeted treatment of liver fibrosis. The present invention selects ROL, which has a specific recognition effect on activated hepatic stellate cells (aHSCs), as a targeting group to construct a co-delivery drug delivery system for synergistic treatment of genes and drugs with active targeted delivery of HSCs. Compared with free drugs or gene drugs alone, the present invention realizes active targeted drug delivery and synergistic treatment of HSCs, which can better solve the problems of complex etiology of liver fibrosis and poor effect of single treatment methods, and has good clinical application prospects.

[0007] The technical solution adopted by the present invention to solve its technical problem is:

[0008] A targeted co-delivery system based on pMMP-1 and hydroxychloroquine is prepared. Retinol (ROL) with specific targeting to activated hepatic stellate cells (aHSCs) is selected as a modification group to modify the delivery carrier PR to obtain a targeted nano drug delivery system. The positive charge of PR is used to electrostatically adsorb the negatively charged pMMP-1, and the autophagy inhibitor hydroxychloroquine HCQ is encapsulated during the electrostatic adsorption, thereby obtaining the targeted co-delivery system HCQ / pMMP-1@PR based on pMMP-1 and HCQ with active targeting to aHSCs.

[0009] The present invention also provides a method for preparing a targeted co-delivery system based on pMMP-1 and hydroxychloroquine, which specifically comprises the following steps:

[0010] (1) Dissolving retinol succinate in N,N-dimethylformamide (DMF) to obtain a DMF solution of retinol succinate, wherein the mass ratio of retinol succinate to DMF is A1, and then 2K -NH2, benzotriazol-1-yl-oxytripyrrolidinophosphine hexafluorophosphate (PyBOP) and N,N-diisopropylethylamine (DIPEA) were added to the DMF solution of retinol succinate. 2K The mass ratio of -NH2 is A2, the mass ratio of retinol succinate and PyBOP is A3, and the mass ratio of retinol succinate and DIPEA is A4; the reaction time is T1 at 25°C, and the SH-PEG is obtained by vacuum rotary evaporation. 2K -ROL solution, SH-PEG 2K -ROL solution was added to ice ether for washing 4 times, and SH-PEG 2K The mass ratio of -ROL to glacial ether is A5, and the precipitate is collected and vacuum dried to obtain SH-PEG2K -ROL;

[0011] (2) SH-PEG with a mass ratio of B1 2K -ROL and polyethyleneimine (PEI)-succinimide 3-(2-pyridyldisulfide)-propionate) SPDP (PEI-SPDP, PS) were dissolved in dimethyl sulfoxide (DMSO), SH-PEG 2K The mass ratio of -ROL to DMSO is B2, and the mass ratio of PS to DMSO is B3. 2K The DMSO solution of -ROL was added dropwise to the DMSO solution of PS, and after reflux time T2 at temperature W1, the reaction yielded PS-SH-PEG. 2K -ROL (PR) solution, the reaction mixture was dialyzed in deionized water using a dialysis bag with a molecular weight cut-off of 7000 (molecular weight cut-off 7K, MWCO 7K), the deionized water was replaced every 6 hours, the mass ratio of PR to deionized water was B4, after dialysis time T3,

[0012] By freeze drying, the carrier material PR is obtained;

[0013] (3) PR, hydroxychloroquine sulfate and pcDNA3.1-MMP-1 (pMMP-1) with a mass ratio of C1 were dissolved in deionized water, the mass ratio of PR to deionized water was C2, the mass ratio of hydroxychloroquine sulfate to deionized water was C3, and the mass ratio of pMMP-1 to deionized water was C4, thereby obtaining a PR solution, a hydroxychloroquine sulfate solution and a pMMP-1 solution, respectively. Under stirring conditions, the PR solution and the hydroxychloroquine sulfate solution were mixed, and then the pMMP-1 solution was added to obtain a mixed solution HCQ / pMMP-1@PR. After standing at 25°C for T4 time, the mixed solution HCQ / pMMP-1@PR was placed in a dialysis bag with a molecular weight cutoff of 7000, and the mixed solution HCQ / pMMP-1@PR was dialyzed with deionized water. The mass ratio of HCQ / pMMP-1@PR to deionized water was C5, the dialysis time was T5, and the deionized water was replaced once every 6 hours. After the dialysis time was reached, freeze-drying was performed to obtain a targeted co-delivery system HCQ / pMMP-1@PR based on pMMP-1 and HCQ.

[0014] In the step (1), the mass ratio A1 is 20:1 to 1:500, the mass ratio A2 is 30:1 to 1:100, the mass ratio A3 is 35:1 to 1:100, the mass ratio A4 is 100:1 to 1:400, the reaction time T1 is 0.1 to 40 hours, and the mass ratio A5 is 200:1 to 1:8000.

[0015] In the step (2), the mass ratio B1 is 100:1 to 1:150, the mass ratio B2 is 600:1 to 1:300, the mass ratio B3 is 500:1 to 1:1000, the temperature W1 is 25 to 300°C, the reflux time T2 is 1 to 300 hours, the mass ratio B4 is 500:1 to 1:250000, and the dialysis time T3 is 1 to 400 hours.

[0016] In the step (3), the mass ratio C1 is 1:5:10-900:100:1, the mass ratio C2 is 150:1-1:250, the mass ratio C3 is 100:1-1:200, the mass ratio C4 is 300:1-1:30000, the standing time T4 is 1-200 min, the mass ratio C5 is 1000:1-1:5000000, and the dialysis time T5 is 0.5-500 h.

[0017] The targeted co-delivery system based on pMMP-1 and hydroxychloroquine is applied to targeted delivery to hepatic stellate cells, and exerts a better effect in treating liver fibrosis. The activity evaluation experimental results show that compared with free drugs, the drug delivery system can achieve targeted delivery of aHSCs, reduce the impact on other types of liver cells, inhibit the activation of HSCs, the main driving cells of liver fibrosis, and promote the degradation of extracellular matrix, effectively exert the synergistic anti-liver fibrosis effect of drugs, and has good clinical application prospects.

[0018] The beneficial effect of the present invention is that ROL with a specific recognition effect on aHSCs is selected as a targeting modification group, and the autophagy inhibitor HCQ and pMMP-1 that promotes the degradation of the extracellular matrix are encapsulated to obtain a targeted co-delivery system (HCQ / pMMP-1@PR) based on pMMP-1 and hydroxychloroquine with active targeting effect on aHSCs. Through the targeted delivery of HCQ, the autophagy of aHSCs is inhibited to reduce the energy supply for its activation, and the expression of fibrosis-related proteins is reduced. By targeting aHSCs to deliver pMMP-1, the expression of MMP-1 is enhanced, the degradation of ECM is promoted, and the mechanical force generated by ECM is blocked to promote the activation of HSCs. Therefore, the present invention is a targeted co-delivery system (HCQ / pMMP-1@PR) based on pMMP-1 and hydroxychloroquine, which not only inhibits the activation of HSCs but also degrades the ECM deposited outside HSCs, so as to better play a synergistic anti-liver fibrosis therapeutic effect, solve the problem of complex etiology of liver fibrosis and poor effect of single treatment means, and has good clinical application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1The preparation and characterization of the targeted co-delivery system based on pMMP-1 and hydroxychloroquine, (a) is a schematic diagram of the scanning electron microscopy of the targeted co-delivery system, (b) is a schematic diagram of the transmission electron microscopy of the targeted co-delivery system, (c) is the PDI and particle size distribution diagram of the targeted co-delivery system, (d) is the potential distribution diagram of the targeted co-delivery system, (e) is the storage stability of the targeted co-delivery system in different solvents, (f) is a schematic diagram of the loading capacity of the targeted co-delivery system for pMMP-1 at different mass ratios of PR to pMMP-1, and (g) is the anti-nuclease protection ability of the targeted co-delivery system for pMMP-1 at different mass ratios of PR to pMMP-1.

[0020] Figure 2 This is an in vitro targeting experiment of the targeted co-delivery system based on pMMP-1 and hydroxychloroquine. (a) is the immunofluorescence of aHSCs, AML-12, HUVEC and RAW 264.7 cells, scale bar = 10 μm; (b) is the statistical analysis of Figure A, aHSCs group vs AML-12, HUVEC and RAW 264.7 groups, n = 3, ***P<0.001; (c) is flow cytometry analysis of aHSCs, AML-12, HUVEC, and RAW 264.7.

[0021] Figure 3 Competitive uptake inhibition experiment based on the targeted co-delivery system of pMMP-1 and hydroxychloroquine, (a) Cell immunofluorescence of aHSCs treated with or without ROL (scale = 10 μm); (b) Statistical analysis of Figure A; (c) Flow cytometry detection of the uptake of the delivery system by aHSCs treated with or without ROL; (d) Statistical analysis of Figure C; Control group vs ROL group, n = 3, ***P<0.001.

[0022] Figure 4 Quantitative detection of the expression plasmid in HSCs based on the targeted co-delivery system of pMMP-1 and hydroxychloroquine. (a) is the mRNA expression level of MMP-1, TGF-β group vs Normal group, n=3, ### P<0.001; TGF-β+pMMP-1@PR group, TGF-β+HCQ / pMMP-1@PR group vs TGF-β group, n=3, ***P<0.001; (b) is the protein expression and statistical analysis of MMP-1, TGF-β group vs Normal group, n=3, ###P<0.001; TGF-β+pMMP-1@PR group, TGF-β+HCQ / pMMP-1@PR group, TGF-β+HCQ@PR group vs TGF-β group, n=3, *** P<0.001, TGF-β+pMMP-1@PR group, TGF-β+HCQ@PR group vs TGF-β+HCQ / pMMP-1@PR group, n=3, & P<0.05; (c) Cellular immunofluorescence expression of MMP-1, I: Normal, II: TGF-β, III: TGF-β+HCQ@PR, IV: TGF-β+pMMP-1@PR, V: TGF-β+HCQ / pMMP-1@PR.

[0023] Figure 5 This is an in vivo anti-liver fibrosis effect experiment based on the targeted co-delivery system of pMMP-1 and hydroxychloroquine, (a) is a photo of the liver (scale bar = 0.5 cm), H&E staining, Masson staining and Sirius red staining of the liver (scale bar = 50 μm); (b) is the immunohistofluorescence staining of α-SMA, MMP-1 and ATG7 (scale bar = 50 μm).

[0024] Figure 6 It is a biosafety evaluation of the targeted co-delivery system based on pMMP-1 and hydroxychloroquine. DETAILED DESCRIPTION

[0025] The present invention is further described below in conjunction with the accompanying drawings and embodiments.

[0026] Example 1

[0027] Preparation and characterization of targeted co-delivery system based on pMMP-1 and hydroxychloroquine

[0028] Step (1): Dissolve 100 mg of retinol in 4 mL of pyridine, then add 175 mg of succinic anhydride and 21 mg of DMAP to completely dissolve it. The reaction mixture is kept at 25°C overnight and evaporated under reduced pressure. Add 10 mL of dichloromethane, wash with 10% citric acid 3 times, and then wash with saturated brine 2 times. Dry with sodium sulfate to obtain retinol succinate, add 5 mL of DMF to redissolve it, and then add 700 mg of SH-PEG 2K -NH2, 220 mg of PyBOP) and 200 μL of DIPEA were completely dissolved and reacted at 25°C for 0.5 h. The solution was concentrated by rotary evaporation under reduced pressure, and the reaction solution was added to 50 mL of ice ether for 4 times. The precipitate was collected and dried under vacuum to obtain SH-PEG. 2K -ROL.

[0029] Step (2): 366 mg of SH-PEG 2K -ROL was dissolved in 3 mL of DMSO and added dropwise to 7 mL of DMSO solution of PEI-SPDP (PS), with a PS content of 1800 mg. After reflux at 65 °C for 24 h, the reaction yielded PS-SH-PEG 2K -ROL(PR) solution. SH-PEG was dialyzed in deionized water using a dialysis bag (MWCO 7K). 2K -ROL and PS reaction mixture. Deionized water was replaced every 6 h, 5000 mL of deionized water each time. After dialysis for 72 h, PEI-PEG was obtained by freeze drying. 2k -ROL(PR).

[0030] Step (3): Dissolve 60 mg of PR in 2 mL of deionized water and 51 mg of hydroxychloroquine sulfate in 1 mL of deionized water. After mixing the PR solution and the hydroxychloroquine sulfate solution, add 12 mL of 1 mg / mL pMMP-1 under stirring. After standing at 25°C for 20 min, place the mixture in a dialysis bag (MWCO 7K) and dialyze with 5000 mL of deionized water for 48 h, replacing the deionized water every 6 h. After dialysis, freeze-drying was performed to obtain a targeted co-delivery system HCQ / pMMP-1@PR based on pMMP-1 and HCQ. Single-drug delivery systems HCQ@PR or pMMP-1@PR were prepared by the same method.

[0031] The characterization results are as follows Figure 1 As shown in A and B, the transmission electron microscopy and scanning electron microscopy results of the HCQ / pMMP-1@PR delivery system showed that the shape of the delivery system was uniformly spherical and the particle size was uniform. Figure 1 As shown in C and D, the particle size of the delivery system is 128.5±5.0nm, the dispersion coefficient PDI is 0.194±0.022, and the particle size distribution range is narrow (PDI<0.3). Thus, a delivery system with a small particle size and uniform distribution was obtained, and the zeta potential of the delivery system was 20.7±2.0mV. The above characterization of the delivery system can meet the requirements of targeted delivery of aHSCs. Figure 1 As shown in E, the particle size and PDI of the HCQ / pMMP-1@PR delivery system did not change significantly after being stored in deionized water, PBS, DMEM, and 10% FBS for 1-28 days, and the stability was good. Gel electrophoresis showed that when the mass ratio of carrier PR to pMMP-1 was 1:1, pMMP-1 could be well loaded ( Figure 1F). After adding DNase I, when the mass ratio of PR to pMMP-1 was 1:1, the delivery system could protect pMMP-1 from being degraded by DNase I to a certain extent. The HCQ loading in the HCQ / pMMP-1@PR delivery system was detected by high performance liquid chromatography and was 20.13%. Considering the drug loading and clinical dosage of HCQ, the loading of PR on pMMP-1 and the protection ability of anti-DNase I on plasmid, the mass ratio of PR to pMMP-1 was 5:1 for subsequent experiments.

[0032] Example 2

[0033] In vitro targeting experiment of targeted co-delivery system based on pMMP-1 and hydroxychloroquine

[0034] Quiescent HSCs (qHSCs) were seeded on 20 mm diameter cell culture slides and stimulated with transforming growth factor-β (TGF-β) at a concentration of 10 ng / mL for 24 h to convert them into aHSCs. Normal hepatocytes (AML-12), liver sinusoidal endothelial cells (HUVEC) and macrophages (RAW 264.7) were also seeded on 20 mm diameter cell culture slides. After the cells adhered to the wall, the four slides were placed together in a 100 mm diameter cell culture dish for co-culture to simulate the in vivo environment. HCQ / pMMP-1@PR was labeled with EFGP green fluorescent protein and added to the culture medium at a 12.5 μM HCQ. After culturing the cells for 4 h, the supernatant was discarded and the cells were washed 3 times with PBS. After fixing the cells with 4% paraformaldehyde, the fixative was discarded and the cell nuclei were stained with DAPI. The cell slides were scanned using a confocal fluorescence microscope to obtain fluorescence images.

[0035] The results show (such as Figure 2 A and B), the green fluorescence intensity of aHSCs was significantly stronger than that of AML-12, HUVEC and RAW264.7, indicating that HCQ / pMMP-1@PR has good targeting to aHSCs. In addition, the results of flow cytometry also confirmed the above conclusion ( Figure 2 C). Therefore, ROL-modified HCQ / pMMP-1@PR exhibits good targeting to aHSCs and can reduce the uptake of HCQ / pMMP-1@PR by other types of liver cells, laying a good foundation for the therapeutic effect of liver fibrosis in vivo.

[0036] Example 3

[0037] Competitive uptake inhibition experiment based on pMMP-1 and hydroxychloroquine targeted co-delivery system

[0038] First, qHSCs were activated with TGF-β, and after 24 hours of stimulation, they were transformed into aHSCs. aHSCs cells were incubated with 2 mg / mL of ROL for 1 hour, and the culture medium without ROL was used as the control group (Control). Then the supernatant was discarded and the cells were washed 3 times with PBS to remove the residual free ROL. Then aHSCs were incubated with HCQ / pMMP-1@PR labeled with mCherry red fluorescent protein (HCQ concentration was 12.5μM, pMMP-1 concentration was 2μg / mL) for 4 hours, and the cell surface was washed 3 times with PBS. The cells were fixed with 4% paraformaldehyde for 15 minutes, and the paraformaldehyde was discarded. The cell nucleus was stained with the nuclear dye DAPI for 15 minutes, the cell surface was washed 3 times with PBS, and finally the slide was sealed with glycerol.

[0039] The results of competitive uptake experiments of the delivery system are shown in Figure 3 As shown in A and B, after adding free ROL, the red fluorescence of HCQ / pMMP-1@PR was significantly weakened compared with the Control group, while the red fluorescence intensity of the Control group was stronger. This shows that after adding ROL, the entry of HCQ / pMMP-1@PR into the cell was significantly inhibited, and the HCQ / pMMP-1@PR targeted co-delivery system can enter the cell after binding to the retinol binding protein receptor on the surface of HSCs through ROL. Therefore, free ROL has a competitive inhibitory effect on the entry of HCQ / pMMP-1@PR into the cell. In addition, the results of flow cytometry also confirmed the above conclusion ( Figure 3 C and D).

[0040] Example 4

[0041] Quantitative detection of plasmid expression in HSCs based on pMMP-1 and hydroxychloroquine targeted co-delivery system

[0042] qHSCs were seeded into 6-well plates. After adherence, qHSCs were activated with TGF-β for 24 hours to convert them into aHSCs. After culturing aHSCs with HCQ / pMMP-1@PR (pMMP-1 content was 2 μg / mL) for 48 hours, the cells were collected. RNA of the cells was extracted using an RNA extraction kit. qRT-PCR analysis was performed using a QuantStudio 6Flex system PCR instrument. The MMP-1 primer sequences are as follows: forward primer

[0043] CTAGGTCTGGATCACTCCAAGG, reverse primer TGAACGTCATCATCAGGAAGC. The primer sequences of the internal reference GAPDH are as follows: forward primer TGAAGGGTGGAGCCAAAAG, reverse primer AGTCTTCTGGGTGGCAGTGAT. In addition, after the cells were treated with TGF-β and HCQ / pMMP-1@PR, the cell proteins were extracted and the proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The polyvinylidene fluoride membrane was incubated with the primary antibody (MMP-1) at 4°C overnight, and then incubated with the secondary antibody at room temperature for 1 hour the next day. Finally, Prism Demo 10 and Image J software were used for quantitative analysis. On the other hand, the cell immunofluorescence method was also used to detect the transfection effect of HCQ / pMMP-1@PR in HSCs. qHSCs were incubated with 10 3 The cells were seeded on a 20 mm glass slide at a density of 100 cells / well and stimulated with TGF-β for 24 h to transform into aHSCs. The supernatant was discarded, and the cells were washed 3 times with PBS.

[0044] 1@PR was added to the culture medium, and the cells were cultured for 48 hours, and the supernatant was discarded. After the cells were washed with PBS three times, the cell slides were incubated with the primary antibody (MMP-1) at 4°C overnight. The next day, the slides were incubated with the secondary antibody for 1 hour at room temperature in the dark. The cells were fixed with paraformaldehyde for 15 minutes, and the cell nuclei were stained with DAPI for 15 minutes. The fluorescence images were scanned with a confocal fluorescence microscope.

[0045] The experimental results are as follows Figure 4 As shown in A, TGF-β treatment significantly reduced the mRNA expression of MMP-1 compared with the normal group HSCs. However, after HSCs were treated with HCQ / pMMP-1@PR loaded with pMMP-1, the mRNA expression of MMP-1 was significantly enhanced in both the HCQ / pMMP-1@PR and pMMP-1@PR groups compared with the TGF-β group ( Figure 4 A). In addition, after TGF-β treatment, the protein expression of MMP-1 was inhibited compared with the normal group. Compared with the TGF-β group, the HCQ / pMMP-1@PR, pMMP-1@PR and HCQ@PR treatment groups significantly enhanced the expression of MMP-1, and the effect of the HCQ / pMMP-1@PR group was significantly better than that of the pMMP-1@PR and HCQ@PR groups ( Figure 4 B). In addition, the results of cell immunofluorescence also confirmed the above conclusions ( Figure 4 C). In summary, the HCQ / pMMP-1@PR targeted co-delivery system can promote the expression of MMP-1 mRNA and protein in HSCs and has a good transfection effect.

[0046] Example 5

[0047] In vivo anti-liver fibrosis effect experiment based on pMMP-1 and hydroxychloroquine targeted co-delivery system

[0048] BALB / c mice (male, 5 weeks, 22±2 g) were allowed to eat and drink freely for 7 days and then randomly divided into 5 groups: normal group, TAA group, TAA+HCQ@PR group, TAA+pMMP-1@PR group and TAA+HCQ / pMMP-1@PR group. The normal group was injected with saline, and the other groups were injected with TAA intraperitoneally to establish the liver fibrosis model. In the first week, 100 mg / kg of TAA was injected three times. From the second to the fifth week, 200 mg / kg of TAA was injected twice a week. Except for the TAA group and the normal group, the other groups were injected with therapeutic drugs through the tail vein twice a week. The concentration of HCQ was 10 mg / kg and the concentration of pMMP-1 was 1 mg / mL. After 5 weeks, serum and organs were collected for subsequent experiments. The liver tissues of mice with liver fibrosis were embedded in paraffin and then sectioned and stained. The morphology and structure of liver tissues were stained with hematoxylin-eosin (H&E) staining according to the instructions of the kit. The liver tissue was embedded in paraffin and sliced, dewaxed with xylene twice, 5min / time, and then rinsed with distilled water for 3min. Hematoxylin staining for 10min, 1% hydrochloric acid alcohol color separation for 5s, and rinsed with running water for 3min. Then it was stained with 1% eosin for 2min, washed with distilled water 3 times, dehydrated with 95% alcohol for 1min, and finally sealed with neutral gum. At the same time, according to the instructions for use of the Masson staining kit (Beijing Solaibao), the liver tissue was embedded in paraffin and sliced, dewaxed with xylene for 10min, stained with iron hematoxylin staining solution for 8min, washed with water for 3min, stained with Ponceau fuchsin staining solution for 5min, stained with aniline blue staining solution for 2min, quickly dehydrated with 95% ethanol twice, 5s / time, dehydrated with anhydrous ethanol 3 times, 10s / time, transparentized with xylene 3 times, 2min / time, and finally sealed with neutral gum. In addition, according to the Sirius red staining kit, the liver tissue was embedded in paraffin and sliced, dewaxed with xylene for 20 minutes, dehydrated with anhydrous ethanol for 10 minutes, dehydrated with 95% alcohol for 5 minutes, dehydrated with 90% alcohol for 5 minutes, dehydrated with 80% alcohol for 5 minutes, dehydrated with 70% alcohol for 5 minutes, and washed with distilled water 3 times, 1 minute / time. 10% Sirius red staining for 8 minutes. The slices were rinsed with anhydrous alcohol for 2 minutes and sealed with neutral gum. The liver tissue of mice with liver fibrosis was embedded with an embedding agent and sliced, and the liver tissue was incubated with primary antibodies (α-SMA, ATG7, MMP-1) and stored in a refrigerator at 4°C overnight. The next day, the liver tissue slices were incubated with secondary antibodies for 1 hour at room temperature. Finally, scanning fluorescence imaging was performed under a confocal microscope.

[0049] The results are as follows Figure 5 As shown in A, compared with the normal group, the liver photos of TAA-induced liver fibrosis mice had obvious granularity and hard texture. After treatment in each treatment group, the liver regained its rosy luster and soft texture, and the HCQ / pMMP-1@PR group had the best effect. H&E staining showed that TAA-induced liver fibrosis led to disordered liver cell structure accompanied by infiltration of inflammatory cells. After treatment with HCQ@PR, pMMP-1@PR and HCQ / pMMP-1@PR, the liver cell structure gradually recovered, especially the HCQ / pMMP-1@PR group had the best effect ( Figure 5 A). The results of Masson staining and Sirius red staining showed that compared with the TAA group, the collagen deposition in each treatment group was significantly reduced after treatment, and the HCQ / pMMP-1@PR group had the best effect ( Figure 5 A). In addition, after TAA induced liver fibrosis, the expression of tissue fluorescence of α-SMA and ATG7 was significantly increased, and the expression of MMP-1 was inhibited. After treatment in each treatment group, the fluorescence expression of α-SMA and ATG7 was significantly reduced, and the fluorescence expression of MMP-1 was enhanced, and the effect of HCQ / pMMP-1@PR group was the most significant ( Figure 5 B). The above results show that HCQ / pMMP-1@PR treatment significantly reduced the inflammatory infiltration of the liver and improved the pathological damage of liver fibrosis, reduced the collagen deposition in the liver, inhibited autophagy, and had a good therapeutic effect on improving liver fibrosis.

[0050] Example 6

[0051] Biosafety evaluation of targeted co-delivery system based on pMMP-1 and hydroxychloroquine

[0052] According to the instructions for the kit for hematoxylin-eosin (H&E) staining, the liver tissue was embedded in paraffin and then sliced. Dewaxed twice with xylene, 5 minutes each time, and then rinsed with distilled water for 3 minutes. Stained with hematoxylin for 10 minutes, separated with 1% hydrochloric acid alcohol for 5 seconds, and rinsed with running water for 3 minutes. Then stained with 1% eosin for 2 minutes, washed with distilled water 3 times, dehydrated with 95% alcohol for 1 minute, and finally sealed with neutral gum.

[0053] The results are as follows Figure 6 As shown, the HCQ / pMMP-1@PR, HCQ@PR and pMMP-1@PR groups had no obvious damage to the heart, spleen, lungs and kidneys. This shows that HCQ / pMMP-1@PR, HCQ@PR and pMMP-1@PR have good biosafety, can be verified for in vitro and in vivo pharmacodynamics, and have good clinical application prospects.

Claims

1. A targeted co-delivery system based on pMMP-1 and hydroxychloroquine, characterized in that: Retinol ROL, which has specific targeting for activated hepatic stellate cells (aHSCs), was selected as the modifying group to modify the delivery carrier PR to obtain a targeted nano-drug delivery system. The positive charge of PR was used to electrostatically adsorb the negatively charged pMMP-1, and the autophagy inhibitor hydroxychloroquine HCQ was encapsulated during the electrostatic adsorption, thus obtaining the targeted co-delivery system HCQ / pMMP-1@PR based on pMMP-1 and HCQ with active targeting effect on aHSCs.

2. A method for preparing the targeted co-delivery system based on pMMP-1 and hydroxychloroquine according to claim 1, characterized in that The steps include: (1) Dissolve retinol succinate in N,N-dimethylformamide (DMF) to obtain a DMF solution of retinol succinate, wherein the mass ratio of retinol succinate to DMF is A1, and then SH-PEG 2K - NH2, benzotriazole-1-yl-oxytripyrrolidinophosphine hexafluorophosphate PyBOP and N,N-diisopropylethylamine DIPEA were added to the DMF solution of retinol succinate. 2K The mass ratio of -NH2 is A2, the mass ratio of retinol succinate and PyBOP is A3, and the mass ratio of retinol succinate and DIPEA is A4; the reaction time is T1 at 25°C, and the SH-PEG is obtained by vacuum rotary evaporation. 2K -ROL solution, SH-PEG 2K -ROL solution was added to ice ether for washing 4 times, and SH-PEG 2K The mass ratio of -ROL to glacial ether is A5, and the precipitate is collected and vacuum dried to obtain SH-PEG 2K -ROL; (2) SH-PEG with a mass ratio of B1 2K -ROL and polyethyleneimine (PEI)-succinimide 3-(2-pyridyldisulfide)-propionate) SPDP were dissolved in dimethyl sulfoxide (DMSO), SH-PEG 2K The mass ratio of -ROL to DMSO is B2, the mass ratio of PS to DMSO is B3, and the SH-PEG 2K -ROL DMSO solution was added dropwise to PS DMSO solution, and after reflux time T2 at temperature W1, PS-SH-PEG was obtained. 2K -ROL solution, dialyze the reaction mixture in deionized water using a dialysis bag with a molecular weight cutoff of 7000, replace the deionized water every 6 hours, the mass ratio of PR to deionized water is B4, and the dialysis time is T3 Afterwards, the carrier material PR is obtained by freeze drying; (3) PR, hydroxychloroquine sulfate and pcDNA3.1-MMP-1 (pMMP-1) in a mass ratio of C1 are dissolved in deionized water, the mass ratio of PR to deionized water is C2, the mass ratio of hydroxychloroquine sulfate to deionized water is C3, and the mass ratio of pMMP-1 to deionized water is C4, thereby obtaining a PR solution, a hydroxychloroquine sulfate solution and a pMMP-1 solution, respectively; the PR solution and the hydroxychloroquine sulfate solution are mixed under stirring, and then the pMMP-1 solution is added to obtain a mixed solution HCQ / pMMP-1@PR, after standing at 25°C for T4 time, the mixed solution HCQ / pMMP-1@PR was placed in a dialysis bag with a molecular weight cutoff of 7000, and the mixed solution HCQ / pMMP-1@PR was dialyzed with deionized water. The mass ratio of HCQ / pMMP-1@PR to deionized water was C5, the dialysis time was T5, and the deionized water was replaced once every 6 hours. After the dialysis time was reached, freeze-drying was carried out to obtain the targeted co-delivery system HCQ / pMMP-1@PR based on pMMP-1 and HCQ.

3. The method for preparing the targeted co-delivery system based on pMMP-1 and hydroxychloroquine according to claim 2, characterized in that: In the step (1), the mass ratio A1 is 20:1 to 1:500, the mass ratio A2 is 30:1 to 1:100, the mass ratio A3 is 35:1 to 1:100, the mass ratio A4 is 100:1 to 1:400, the reaction time T1 is 0.1 to 40 hours, and the mass ratio A5 is 200:1 to 1:8000.

4. The method for preparing the targeted co-delivery system based on pMMP-1 and hydroxychloroquine according to claim 2, characterized in that: In the step (2), the mass ratio B1 is 100:1 to 1:150, the mass ratio B2 is 600:1 to 1:300, the mass ratio B3 is 500:1 to 1:1000, the temperature W1 is 25 to 300°C, the reflux time T2 is 1 to 300 hours, the mass ratio B4 is 500:1 to 1:250000, and the dialysis time T3 is 1 to 400 hours.

5. The method for preparing the targeted co-delivery system based on pMMP-1 and hydroxychloroquine according to claim 2, characterized in that: In the step (3), the mass ratio C1 is 1:5:10-900:100:1, the mass ratio C2 is 150:1-1:250, the mass ratio C3 is 100:1-1:200, the mass ratio C4 is 300:1-1:30000, the standing time T4 is 1-200 min, the mass ratio C5 is 1000:1-1:5000000, and the dialysis time T5 is 0.5-500 h.

6. An application of a targeted co-delivery system based on pMMP-1 and hydroxychloroquine prepared according to the method of claim 2, characterized in that: The targeted co-delivery system based on pMMP-1 and hydroxychloroquine is applied to targeted delivery to hepatic stellate cells, exerts a better effect in treating liver fibrosis, realizes targeted drug delivery of aHSCs, reduces the impact on other types of liver cells, inhibits the activation of HSCs, the main driving cells of liver fibrosis, and promotes the degradation of extracellular matrix, effectively exerting the synergistic anti-liver fibrosis effect of drugs.

Images