Heart-targeted nano-liposome delivery carrier, circular RNA (Ribonucleic Acid) medicine for treating cardiovascular diseases as well as preparation method and application of circular RNA medicine

Abstract

The invention provides a heart-targeted nano-liposome delivery carrier, a circular RNA (Ribonucleic Acid) medicine for treating cardiovascular diseases as well as a preparation method and application of the circular RNA medicine, and belongs to the technical field of biomedicine. The heart-targeted nano-liposome delivery carrier comprises saccular nano-liposome particles and heart-targeted peptide CMP (chemical mechanical polishing) modified on the surfaces of the nano-liposome particles, the amino acid sequence of the heart targeting peptide CMP is shown as SEQ ID NO: 6. The heart-targeted nano-liposome delivery carrier has a good heart-targeted effect, and the nano-liposome delivery carrier is used as a delivery tool to accurately deliver a circular RNA drug to a heart part, so that the effect of treating cardiovascular diseases (such as cardiac hypertrophy) is greatly improved; a new treatment mode is provided for clinical treatment of cardiovascular diseases, and the purpose of efficiently preventing and treating heart diseases is achieved.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology, and in particular relates to a cardiac-targeted nanoliposome delivery carrier, a circular RNA drug for treating cardiovascular diseases, and a preparation method and application thereof. Background Art

[0002] Cardiovascular disease is the leading cause of death worldwide. Among them, diseases such as cardiac ischemia-reperfusion injury and myocardial hypertrophy have a high incidence and lack of treatment. With the innovation of technology, the use of RNA molecules to treat human diseases has attracted widespread attention. Compared with linear mRNA, circRNA has higher stability and tissue specificity, making it an ideal candidate for disease markers and therapeutic targets.

[0003] In order to effectively and stably express RNA preparations in vivo, lipid nanoparticles (LNPs) are commonly used at this stage. Lipid nanoparticles are a nanoscale carrier for drug delivery, composed of structural lipids and polyethylene glycol (PEG)-modified lipids. They can prevent LNP aggregation and unnecessary interactions with the biological environment, and are widely used to deliver small molecules and nucleic acid drugs. Typical LNPs have only one phospholipid outer layer wrapped around an electron-dense core, and ionizable lipids aggregate into inverted micelles surrounding trapped RNA molecules. Under acidic conditions in the body, these ionizable lipids will be protonated and can bind to the negatively charged endosomal membrane, causing endosomal rupture, thereby achieving endosomal release. At present, there are no reports on cardiac-targeted nanoliposome delivery carriers. Summary of the invention

[0004] In view of this, the object of the present invention is to provide a cardiac-targeted nanoliposome delivery vector, by modifying the surface of the nanoliposome with a cardiac-targeting peptide CMP, so as to achieve specific targeting of the nanoliposome delivery vector to the heart.

[0005] The present invention provides a cardiac-targeted nanoliposome delivery carrier, comprising a vesicular nanoliposome particle and a cardiac-targeted peptide CMP modified on the surface of the nanoliposome particle;

[0006] The amino acid sequence of the cardiac targeting peptide CMP is shown in SEQ ID NO:6.

[0007] Preferably, the components of the nanoliposome particles include ionizable lipids, cholesterol, distearoylphosphatidylcholine, DMG-PEG2K and DSPE-PEG2K-carboxy-NHS in a molar ratio of 50:38.5:10:1.2:0.3. 。

[0008] Preferably, the molar ratio of the cardiac targeting peptide CMP to DSPE-PEG2K-carboxy-NHS is (10-100):1.

[0009] Preferably, the cardiac targeting peptide CMP is coupled to the nanoliposome particles via an amide bond formed between the amino group and the NHS group in DSPE-PEG2K-carboxy-NHS.

[0010] The invention provides a circular RNA drug for treating cardiovascular diseases, comprising the nanoliposome delivery carrier and the circular RNA molecule for treating cardiovascular diseases encapsulated in the nanoliposome delivery carrier.

[0011] Preferably, the circular RNA molecule comprises Circ-UTRN;

[0012] The nucleotide sequence of the Circ-UTRN is shown in SEQ ID NO:5.

[0013] Preferably, the mass ratio of the circular RNA molecule to the nanoliposome delivery vector is 5.67:1.

[0014] The present invention provides a method for preparing the circular RNA drug, comprising the following steps:

[0015] Circular RNA molecules, ionizable lipids, cholesterol, distearoylphosphatidylcholine, DMG-PEG2K and DSPE-PEG2K-carboxy-NHS were mixed by microfluidics technology to obtain nanoliposomes encapsulating circular RNA molecules;

[0016] The nanoliposomes encapsulating the circular RNA molecules are mixed and stirred with the cardiac targeting peptide CMP to obtain a circular RNA drug.

[0017] Preferably, when the microfluidic technology is mixed, the flow rate of the material is 4 ml / min;

[0018] During the mixing and stirring, the system temperature was 4° C.; the mixing and stirring speed was 100 rpm.

[0019] The invention provides application of the nanoliposome delivery carrier in preparing medicine for preventing and / or treating cardiovascular diseases.

[0020] The present invention provides a cardiac-targeted nanoliposome delivery carrier, comprising a vesicular nanoliposome particle and a cardiac-targeted peptide CMP modified on the surface of the nanoliposome particle; the amino acid sequence of the cardiac-targeted peptide CMP is shown in SEQ ID NO:5. The present invention modifies the cardiac-targeted peptide CMP on the surface of the nanoliposome to obtain a cardiac-targeted nanoliposome. Studies have shown that the cardiac-targeted nanoliposome delivery carrier has a good cardiac-targeted effect, and the nanoliposome delivery carrier can be used as a new delivery tool system for cardiac-targeted therapy, providing a new means for the delivery of nucleic acid drugs for cardiovascular diseases.

[0021] The present invention also provides a circular RNA drug for treating cardiovascular diseases, which is loaded with circular RNA molecules for treating cardiovascular diseases in a cardiac-targeted nanoliposome delivery carrier to obtain a circular RNA drug for treating cardiovascular diseases, which has a significant effect in treating cardiovascular diseases (such as myocardial hypertrophy) and provides a new treatment method for clinical treatment of cardiovascular diseases. At the same time, the present invention uses cardiac-targeted LNP for targeted delivery of therapeutic drugs to achieve the purpose of efficiently preventing and treating heart diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 :The electrophoresis of DNA template of in vitro transcribed circular RNA;

[0023] Figure 2 : Electrophoresis of in vitro transcribed circular RNA;

[0024] Figure 3 :qPCR detection of CT value of UTRN after RNaseR digestion;

[0025] Figure 4 :Sequencing results of Circ-UTRN reverse splicing sites;

[0026] Figure 5 : Uptake results of CON-LNP and CMP-LNP by AC16 cells, HEK293T cells, Beas-2b cells and HepG2 cells, respectively; **p<0.01, ***p<0.005;

[0027] Figure 6 :Flowchart of animal experiments on nanoliposome delivery of Circ-UTRN;

[0028] Figure 7 :The results of in vivo fluorescence imaging of small animals to detect the expression of GFP protein in mouse heart;

[0029] Figure 8 :qPCR detection of GFP expression levels in heart and liver; **p<0.01, ***p<0.005

[0030] Fig. 9 : The expression of GFP protein in cardiac tissue sections was detected by laser confocal microscopy; *p<0.05, ***p<0.005;

[0031] Fig.10 :Schematic diagram of nanoliposome encapsulating circular RNA;

[0032] Fig.11 :The results of the effect of Circ-UTRN on cardiomyocyte morphology;

[0033] Fig.12 :The expression results of Circ-UTRN in AC16 cells; **p<0.01;

[0034] Fig.13 :LDH detected the toxicity of LNP-Circ-UTRN to AC16;

[0035] Fig.14 :The expression results of Circ-UTRN in mouse heart and liver;

[0036] Fig.15 :The therapeutic effect of LNP-Circ-UTRN on PE-induced NRCM cell hypertrophy was detected by immunofluorescence staining;

[0037] Fig.16 : Immunofluorescence staining was used to detect the therapeutic effect of LNP-Circ-UTRN on PE+ISO-induced NMCM cell hypertrophy; *p<0.05. DETAILED DESCRIPTION

[0038] The present invention provides a cardiac-targeted nanoliposome delivery carrier, comprising vesicular nanoliposome particles and cardiac-targeted peptide CMP modified on the surface of the nanoliposome particles; the amino acid sequence of the cardiac-targeted peptide CMP is shown in SEQ ID NO:6.

[0039] In the present invention, the particle size of the vesicular nanoliposome particles is preferably 80 to 120 nm, and can be 100 nm. The vesicular nanoliposome particles are hollow nanoparticles formed by liposome membranes, which can be used as drug delivery carriers to encapsulate drug molecules using hollow structures. The nanoliposome particles, also known as cationic lipids and lipid compositions, are used in the field of drug delivery. "Lipid nanoparticles" or "LNPs" (lipid nanoparticles) refer to nanoscale (such as 1 to 1000 nm) particles containing one or more types of lipid molecules. The LNP may contain at least one non-lipid payload molecule, for example, one or more nucleic acid molecules. The lipid component of the LNP contains at least one cationic lipid and at least one pegylated lipid. It can be expected that cationic lipids can interact with negatively charged payload molecules and promote the incorporation and / or encapsulation of payloads into LNPs during LNP formation. The "cationic lipid" refers to a lipid that is positively charged at any pH value or hydrogen ion activity of its environment, or a lipid that can be positively charged in response to the pH value or hydrogen ion activity of its environment (e.g., its intended use environment). Therefore, the term "cationic" covers the range of "permanent cation" and "cationizable". The "lipid" is also called "lipid", including but not limited to esters of fatty acids, and is characterized by generally having poor solubility in water but being soluble in many non-polar organic substances. Although lipids generally have poor solubility in water, certain categories of lipids (e.g., lipids modified by polar groups such as DMG-PEG2k) have limited water solubility and can be dissolved in water under certain conditions. It also includes phospholipids, sphingolipids, glycolipids, steroids and sterols, and lipoproteins. The derived lipids, including simple lipid derivatives and complex lipid derivatives, have the general properties of lipids. In a specific embodiment of the present invention, the components of the nanoliposome particles include ionizable lipids, DMG-PEG2K, cholesterol, DSPC, and DSPE-PEG2K-carboxy-NHS. The ionizable lipids include SM-102. The function of the ionizable lipids is that after the nanoliposome particles enter the body, in an acidic environment, the ionizable lipids are protonated and can bind to the negatively charged endosomal membrane, causing the nanoliposome particles to rupture and release the encapsulated nucleic acid drugs. The DMG-PEG2K carries a polar group, which functions to improve the solubility of the nanoliposomes in water; the function of the DSPC is to improve the rigidity and stability of the nanoliposomes. The function of the cholesterol is to increase the stability of the nanoliposomes and help cell membrane fusion. The function of the DSPE-PEG2K-carboxy-NHS is to be used for subsequent coupling with the cardiac targeting peptide CMP.In the present invention, the components of the nanoliposome particles preferably include ionizable lipid (SM-102), cholesterol, distearoylphosphatidylcholine, DMG-PEG2K and DSPE-PEG2K-carboxy-NHS in a molar ratio of 50:38.5:10:1.2:0.3. 。 The molar ratio of the cardiac targeting peptide CMP and DSPE-PEG2K-carboxy-NHS is preferably (10-100):1, can be 20-80:1, can also be 30-70:1, and can also be 50:1. The cardiac targeting peptide CMP is preferably coupled to the nanoliposome particles through an amino group and the NHS group in DSPE-PEG2K-carboxy-NHS to form an amide bond. The cardiac targeting peptide CMP has cardiac targeting, which can make the coupled nanoliposome delivery carrier move to the heart, increase the uptake rate of myocardial cells, and thus improve the efficacy of the delivered drug.

[0040] In the present invention, the method for preparing the nanoliposome particles preferably comprises mixing ionizable lipids, cholesterol, distearoylphosphatidylcholine, DMG-PEG2K and DSPE-PEG2K-carboxy-NHS in a specific molar ratio by microfluidic technology to obtain nanoliposomes encapsulating circular RNA molecules.

[0041] In the present invention, the microfluidic technology includes using a microfluidic instrument to complete the mixing. The flow rate of the microfluidic instrument is controlled to be 4 ml / min. The mixing temperature is preferably room temperature, specifically 18-25°C, and can be 20°C.

[0042] The invention provides a circular RNA drug for treating cardiovascular diseases, comprising the nanoliposome delivery carrier and the circular RNA molecule for treating cardiovascular diseases encapsulated in the nanoliposome delivery carrier.

[0043] In the present invention, the nanoliposome delivery vector comprises a circular RNA molecule partially or completely encapsulated inside the liposome shell. The circular RNA molecule is a negatively charged molecule, such as an in vitro transcribed circular RNA-Circ-UTRN. In one embodiment of the present invention, the circular RNA molecule preferably includes Circ-UTRN. The nucleotide sequence of Circ-UTRN is shown in SEQ ID NO: 3. The mass ratio of the circular RNA molecule to the nanoliposome delivery vector is 5.67:1.

[0044] In the present invention, the preparation method of Circ-UTRN preferably includes the following steps: using PCR to amplify the DNA fragment of Circ-UTRN, using T7 polymerase system in combination with GMP system to produce phosphorylated linear in vitro transcribed Circ-UTRN RNA; using T4 DNA ligase system with the aid of DNA splints with complementary sequences at both ends of circ-UTRN to achieve linear RNA cyclization, and obtain in vitro transcribed circular RNA-Circ-UTRN drug. The primers for PCR amplification of the DNA fragment of Circ-UTRN include SEQ ID NO: 1 and SEQ ID NO: 2. The nucleotide sequence of the DNA fragment of PCR amplification of Circ-UTRN is shown in SEQ ID NO: 3. The nucleotide sequence of the DNA splint with complementary sequences at both ends of Circ-UTRN is shown in SEQ ID NO: 4.

[0045] The present invention provides a method for preparing the circular RNA drug, comprising the following steps:

[0046] Circular RNA molecules, ionizable lipids (SM-102), cholesterol, distearoylphosphatidylcholine, DMG-PEG2K and DSPE-PEG2K-carboxy-NHS were mixed by microfluidics technology to obtain nanoliposomes encapsulating circular RNA molecules;

[0047] The nanoliposomes encapsulating the circular RNA molecules are mixed and stirred with the cardiac targeting peptide CMP to obtain a circular RNA drug.

[0048] In the present invention, the microfluidic mixing is preferably completed in a microfluidic instrument. During the microfluidic mixing, the flow rate of the material is preferably 3 to 15 ml / min, and can be 4 ml / min. During the mixing and stirring, the system temperature is 3 to 5° C., and can be 4° C. The mixing and stirring speed is preferably 100 to 300 rpm, and can be 200 rpm.

[0049] The invention provides application of the nanoliposome delivery carrier in preparing medicine for preventing and / or treating cardiovascular diseases.

[0050] In the present invention, the cardiovascular disease includes heart failure and / or myocardial hypertrophy. The heart failure includes acute heart failure or chronic heart failure.

[0051] In the present invention, the drug includes at least one of the following administration routes: injection, oral administration, transdermal administration and nasal administration. The injection includes intravenous injection, intramuscular injection or subcutaneous injection. Oral administration includes the preparation of oral preparations for the drug, which is absorbed into the blood circulation through the digestive tract. Pulmonary administration: transdermal administration allows the drug to be absorbed into the body through the skin. Nasal administration is administered in the form of nasal sprays, etc., which are suitable for brain or systemic administration.

[0052] The following is a detailed description of a cardiac-targeted nanoliposome delivery carrier, a circular RNA drug for treating cardiovascular diseases, and a preparation method and application thereof provided by the present invention in conjunction with the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0053] Example 1

[0054] A method for preparing in vitro transcribed circular RNA for treating cardiovascular diseases, comprising the following steps:

[0055] 1. Obtaining DNA sequence of in vitro transcribed circular RNA (IVT-Circ-UTRN)

[0056] Using Circ-UTRN DNA as a template, PCR amplification was used to obtain the DNA sequence of in vitro transcribed circular RNA.

[0057] The primers used for PCR amplification are as follows:

[0058] IVT-Circ-UTRN-T7-G F: TAATACGACTCACTATATGGATCTCTTAGAG TTGAGT (SEQ IDNO: 1);

[0059] IVT-Circ-UTRN-T7-G R: AGGTATACAATATTCCACCA (SEQ ID NO: 2).

[0060] The nucleotide sequence of circ-UTRN DNA is as follows:

[0061] TGGATCTCTTAGAGTTGAGTACAACAAATGAAATTTTCAAACAGCACA

[0062] AGTTGAACCAAAATGACCAGCTCCTCAGTGTTCCAGATGTCATCAACTGTC

[0063] TGACAACAACTTATGATGGACTTGAGCAAATGCATAAGGACCTGGTCAAC

[0064] GTTCCACTCTGTGTTGATATGTGTCTCAATTGGTTGCTCAATGTCTATGACA

[0065] CGGGTCGAACTGGAAAAATTAGAGTGCAGAGTCTGAAGATTGGATTAATG

[0066] TCTCTCTCAAAGGTCTCTTGGAAGAAAAATACAGATATCTCTTTAAGGAA

[0067] GTTGCAGGGCCAACAGAAATGTGTGACCAGAGGCAGCTGGGCCTGTTACT

[0068] TCATGATGCCATCCAGATCCCCCGGCAGCTAGGTGAAGTAGCAGCTTTTGG

[0069] AGGCAGTAATATTGAGCCTAGTGTTCGCAGCTGCTTCCAACAGAATAACAA

[0070] TAAACCAGAAATAAGTGTGAAAGAGTTTATAGATTGGATGCATTTGGAACC

[0071] ACAGTCCATGGTTTTGGCTCCCAGTTTTACATCGAGTGGCAGCAGCGGAGA

[0072] CTGCAAAACATCAGGCCAAATGCAACATCTGTAAAGAATGTCCAATTGTCG

[0073] GGTTCAGGTATAGAAGCCTTAAGCATTTTAACTATGATGTCTGCCAGAGTTG

[0074] TTTCTTTTCGGGTCGAACAGCAAAAGGTCACAAATTACATTACCCAATGGT

[0075] GGAATATTGTATACCT (SEQ ID NO: 3). The DNA sequence of Circ-UTRN was synthesized by conventional synthesis methods in the art. The synthesized sequence was synthesized by a commercial gene synthesis company and then inserted into the pcDNA plasmid to obtain a recombinant plasmid containing the DNA sequence of Circ-UTRN.

[0076] The PCR reaction conditions are as follows:

[0077] According to the PCR reaction described in Table 1, each reagent was added to a 0.1 mL eight-tube tube and the PCR reaction was performed, i.e., 98°C, 30s to first heat-activate Q5 high-fidelity polymerase, 98°C, 5s to denature, 60°C, 10s to anneal DNA, 72°C, 1min to extend DNA, and 35 cycles were performed; then 72°C, 2 minutes later, the temperature was cooled to 4°C. After the PCR is completed, the PCR product can be stored in a -20°C refrigerator for later use. The PCR system is as follows:

[0078] Table 1 PCR reaction system

[0079] Reagents Final concentration 1× 8× RNAse-free water - Add to 25 μl Make up to 200 μl Q5 High Fidelity 2x Master Mix 1× 12.5μl 100μl Primer 10 μM 5μM 2.5μl 20μl DNA template (1ng-10ng) 2μl 2μl total 25μl 200 μl

[0080] The PCR product is a DNA fragment of in vitro transcribed circular RNA. After preliminary identification by agarose gel electrophoresis, it contains a target fragment of approximately 741 bp in length with correct sequencing. Subsequently, an agarose gel recovery kit is used to recover the correctly identified product as a DNA template for in vitro transcription (see Figure 1 ).

[0081] 2. Production of Phosphorylated Linear In Vitro Transcribed Circ-UTRN RNA

[0082] The in vitro transcribed RNA reaction system was produced using the RiboMax Large RNA kit (RiboMax large RNA production system, Promega). The 100 μl reaction system included the following components: 5-10 μg of PCR-amplified T7 DNA template, 10 μl of T7 RNA polymerase enzyme mixture, 25 mM ATP, 25 mM CTP, 25 mM GTP, 20 mM GMP, and 5 mM UTP. The configured reaction system was incubated at 37°C for 2 h, and then treated with DNase I for 15 min to remove the remaining DNA template. The Trizol RNA extraction method was then used, and during the RNA extraction process, 3 M NaOAc (pH 5.2) and isopropanol were used to help precipitate the in vitro transcribed RNA, and finally washed with 70% ethanol, then resuspended in RNase-free water and stored at 4°C.

[0083] 3. Circularization of Linear In Vitro Transcription Circularization

[0084] The circular RNA cyclization process is as follows: linear RNA cyclization is achieved by using the T4 DNA ligase system assisted by a DNA splint with complementary sequences at both ends of circ-UTRN. The phosphorylated linear RNA and the DNA splint are mixed together in a 100 μl reaction system at a molar ratio of 1:3, and then incubated at 37°C for 2 hours. The Trizol RNA extraction method is used, and during the RNA extraction process, 3M NaOAc (pH 5.2) and isopropanol are used to help precipitate the in vitro transcribed RNA. Finally, it is washed with 70% ethanol and then resuspended in RNase-free water and stored at -80°C.

[0085] Table 2 Cyclization system

[0086] Reagents and raw materials Final concentration IVT-Circ-UTRN phosphorylated RNA 100μM DNA splint 300μM T4Ligasebuffer10x 10μl T4Ligase 10μl <![CDATA[ddH2O]]> Add to a total volume of 100 μl

[0087] The DNA splint sequences of the complementary sequences at both ends of circ-UTRN are as follows:

[0088] AAGAGATCCAAGGTATACAA (SEQ ID NO: 4).

[0089] 4. Identification of in vitro transcribed circular circ-UTRN

[0090] The in vitro transcribed circular Circ-UTRN prepared above was added to RNA loading buffer and placed in a metal bath at 70°C for 10 min. After that, it was inserted into ice for natural cooling to deform the RNA. Subsequently, the in vitro transcribed circular RNA was identified by RNA agarose electrophoresis (see the results). Figure 2 ), and then the in vitro transcribed circular Circ-UTRN was digested with RNA exonuclease using RNase R at 37°C for 10 min. It was found that the circularized Circ-UTRN could effectively resist RNase R digestion, while the linearized Circ-UTRN was largely degraded (see Figure 3 Finally, the in vitro transcribed circular Circ-UTRN was reverse transcribed, and the reverse splicing site of IVT-Circ-UTRN was successfully detected by Sanger sequencing (see Figure 4 ).

[0091] At the same time, the Circ-UTRN circular RNA nucleic acid sequence synthesized in the present invention is as follows:

[0092] UGGAUCUCUUAGAGUUGAGUACAACAAAUGAAAUUUUCAAACAGC

[0093] ACAAGUUGAACCAAAAUGACCAGCUCCUCAGUGUUCCAGAUGUCAUCA

[0094] ACUGUCUGACAACAACUUAUGAUGGACUUGAGCAAAUGCAUAAGGACC

[0095] UGGGUCAACGUUCCACUCUGUGUUGAUAUGUGUCUCAAUUGGUUGCUCA

[0096] AUGUCUAUGACACGGGUCGAACUGGAAAAAAUAUAGAGUGCAGAGUCUGA

[0097] AGAUUGGAUUAAUGUCUCUCUCCAAAGGUCUCUUGGAAGAAAAAUACA

[0098] GAUAUCUCUUUAAGGAAGGUUGCAGGGCCAACAGAAAUGUGUGACCAGA

[0099] GGCAGCUGGGCCUGUUACUUCAUGAUGCCAUCCAGAUCCCCGGCAGC

[0100] UAGGUGAGUAGCAGCUUUUGGAGGCAGUAAAUAUUGAGCCUAGUGUUC

[0101] GCAGCUGCCUUCCAACAGAAUAACAAUAAACCAGAAAUAAGUGUGAAAG

[0102] AGUAUAAGAUUGGAUGCAUUUGGAACCACAGUCCAUGGGUUUGGCUCC

[0103] CAGUUUUACAUCGAGUGGCAGCAGCGGAGACUGCAAAACAUCAGGCCA

[0104] AAUGCAACAUCUGUAAGAAUGUCCAAUUGUCGGGUUCAGGUAUAGAA

[0105] GCCUUAAGCAUUUUAACUAUGAUGUCUGCCAGAGUUGUUCUUUCGG

[0106] GUCGAAACAGCAAAAGGUCACAAAUUACAUACCCAAUGGUGGAAUAUU

[0107] GUAUACCU (SEQ ID NO:5).

[0108] The above results indicate that in vitro transcribed circular RNA with the same characteristics as endogenous RNA was produced by in vitro transcription RNA synthesis.

[0109] Example 2

[0110] A method for preparing cardiac-targeted nanoliposomes comprises the following steps:

[0111] 1. Preparation of RNA drugs for the treatment of cardiovascular diseases

[0112] Preparation method of LNP-mod-GFP: LNP components ionizable lipid (SM-102), cholesterol (cholesterol), distearoylphosphatidylcholine (DSPC), DMG-PEG2K (DMG-PEG2000) and DSPE-PEG2K-carboxy-NHS (DSPE-PEG2000-carboxy-NHS) are prepared according to the molar ratio of 50:38.5:10:1.2:0.3; mod-GFP RNA (purchased from a commercial company) and LNP raw materials are prepared using a microfluidic LNP preparation instrument at a flow rate of 4ml / min to prepare LNP-GFP. The amount of mod-GFP RNA is compounded according to the ratio of the mass of the circular RNA molecule to the total mass of the nanoliposome delivery carrier component of 5.67:1. Subsequently, a 100kd ultrafiltration tube is used to centrifuge and ultrafilter at 4°C and 1200g to obtain LNP-mod-GFP.

[0113] 2. Cardiac Targeting LNP Modification

[0114] The LNP-mod-GFP prepared above was added with 10 times the molar amount of CMP polypeptide (SEQ ID NO: 6, WLSEAGPVVTVRALRGTGSW) of DSPE-PEG2K-carboxy-NHS, incubated with stirring at 4°C for 24 hours, and then the excess polypeptide was removed by filtration to obtain heart-targeted CMP-LNP-mod-GFP.

[0115] Finally, a high-throughput multi-angle light scattering concentration analyzer was used to determine the RNA content, and the RNA concentration of CMP-LNP-mod-GFP and LNP-mod-GFP was adjusted to 0.25 μg / μl and stored at 4°C for use.

[0116] 3. Study on the cardiac targeting function of cardiac-targeted CMP-LNP-mod-GFP at the cellular level

[0117] The LNP-mod-GFP prepared above and the CMP-LNP-mod-GFP prepared above were added to the wells of H9C2 cells, HepG2 cells, BEAS-2B cells and HEK293T cells, respectively, with the addition amount of 500ng, and 2μL was added to each well. After 24h of cell uptake, a high-content cell imaging analysis system was used to take pictures to observe the cell uptake of CMP-LNP-mod-GFP and the expression of GFP protein. HepG2 cells, BEAS-2B cells and HEK293T cells that uptake CMP-LNP-mod-GFP were used as the control group.

[0118] Results Figure 5 . Figure 5 The results showed that compared with LNP-mod-GFP (denoted as CON-LNP), CMP-LNP-mod-GFP (denoted as CMP-LNP) could be taken up more by H9C2, while the uptake in HepG2 cells, BEAS-2B cells and HEK293T cells was reduced.

[0119] 2. Study on the cardiac targeting function of cardiac-targeted CMP-LNP-mod-GFP at the animal level

[0120] Each mouse was injected with 200 μL of PBS and the same volume of the prepared LNP-mod-GFP and CMP-LNP-mod-GFP by tail vein injection, wherein the injection volume of LNP-mod-GFP and CMP-LNP-mod-GFP was recorded as 50 μg according to the injection volume of mod-GFP RNA. The mouse hearts were taken out for fluorescence imaging after 24 h, 48 h and 96 h, respectively. The flow chart is shown in Figure 6 .

[0121] Compared with LNP-mod-GFP, the results of mouse heart in vivo imaging showed that CMP-LNP-mod-GFP showed a trend of enrichment in mouse hearts starting from 24 hours (see Figure 7 ).

[0122] RNA was extracted from mouse heart and liver tissues, and fluorescence quantitative PCR was used to detect the relative quantitative expression of GFP RNA. The primer sequences of fluorescence quantitative PCR are as follows:

[0123] hsa-C-UTRN-div-F: GTCCAATTGTCGGGTTCAGG (SEQ ID NO: 7);

[0124] hsa-C-UTRN-div-R: CACAGAGTGGAACGTTGACC (SEQ ID NO: 8);

[0125] The reaction conditions of fluorescence quantitative PCR (qPCR) are as follows:

[0126] According to the qPCR reaction described in Table 2, each reagent was added to a 384-well fluorescent quantitative PCR plate, and the PCR reaction was performed, that is, 95°C, 30s to first heat-activate SYBR polymerase, 95°C, 5s to denature, 60°C, 10s to anneal DNA, and after 40 cycles, cooled to 4°C. The qPCR system is shown in Table 3:

[0127] Table 3 qPCR reaction system

[0128] Reagents Final concentration 1× 2xchamQuniversalSYBRqPCRmastermix 2× 2.5μl Primer 10 μM 1μM 0.5μl cDNA template (10ng) 2μl total 5μl

[0129] Compared with unmodified LNP, CMP-LNP can effectively deliver mod-GFP RNA to mouse heart at 24h (see Figure 8 ).

[0130] Laser confocal microscopy was used to detect GFP fluorescent protein in mouse heart slices. At 24h and 48h, the expression of GFP protein in the CMP-LNP-mod-GFP group was higher than that in the LNP-mod-GFP group (see Fig. 9 ).

[0131] The above results indicate that LNPs with surface modification of CMP exhibit good targeting properties at both the cellular and animal levels. Therefore, CM-LNP is a good cardiac-targeted LNP and can be used as a new cardiac-targeted delivery tool.

[0132] Example 3

[0133] A preparation method of RNA drug for treating cardiovascular diseases and its animal efficacy verification

[0134] 1. Preparation of LNP-Circ-UTRN Nanoliposomes

[0135] LNP-Circ-UTRN was prepared as follows: LNP raw materials ionizable lipid (SM-102), cholesterol, distearoylphosphatidylcholine (DSPC), DMG-PEG2K (DMG-PEG2000) and DSPE-PEG2K-carboxy-NHS (DSPE-PEG2000-carboxy-NHS) were used to prepare LNP according to a molar ratio of 50:38.5:10:1.2:0.3; Circ-UTRN and LNP raw materials prepared in Example 1 were used in a microfluidic LNP preparation instrument to prepare LNP-Circ-UTRN at a flow rate of 4 ml / min. The ratio of the mass of the Circ-UTRN to the total mass of the nanoliposome delivery carrier component was 5.67:1. Subsequently, a 100 kd ultrafiltration tube was used for ultrafiltration and centrifugation at 4°C and 1200 g to obtain LNP-Circ-UTRN.

[0136] 2. Cardiac Targeting LNP-Circ-UTRN Modification

[0137] The LNP-Circ-UTRN prepared above was added with 10 times the molar amount of CMP peptide of DSPE-PEG2K-carboxy-NHS, incubated with stirring at 4°C for 24h, and then filtered to remove excess peptide to obtain cardiac-targeted CMP-LNP-Circ-UTRN. Finally, a high-throughput multi-angle light scattering concentration analyzer was used to determine the RNA content, and the CMP-LNP-Circ-UTRN and LNP-Circ-UTRN were adjusted to an RNA concentration of 0.25 μg / μl and stored at 4°C for use (see Fig.10 ).

[0138] 3. Verification of cytotoxicity of CMP-LNP-Circ-UTRN

[0139] PBS and the CMP-LNP-Circ-UTRN prepared above were added to AC16 cells, and the amount of CMP-LNP-Circ-UTRN added was 100ng and 500ng, respectively. After 24h of cell uptake, the cell morphology was observed using an inverted microscope and it was found that CMP-LNP-Circ-UTRN had no effect on the morphology of AC16 cells (see Fig.11 ).

[0140] Subsequently, RNA was extracted from AC16 cells to which the CMP-LNP-Circ-UTRN prepared above was added, and the expression of Circ-UTRN was detected. The CMP-LNP prepared above effectively delivered Circ-UTRN to AC16 cells (see Fig.12 ).

[0141] Finally, LDH was used to detect whether the activity of AC16 cells was affected by the addition of CMP-LNP-Circ-UTRN prepared as described above. The results showed that CMP-LNP-Circ-UTRN did not affect cell activity (see Fig.13 ).

[0142] 4. CMP-LNP-Circ-UTRN protects primary mouse and rat cardiomyocyte hypertrophy induced by PE / ISO

[0143] Primary rat / mouse cardiomyocytes were isolated from newborn rats and mice at 0-3 days old. One day after isolation and culture, the cardiomyocytes were treated with PE / ISO (100 μM) and 500 ng of the CMP-LNP-Circ-UTRN prepared above. After treatment for 48 hours, the cells were fixed and stained with actinin to observe the size of the cardiomyocytes.

[0144] The results showed that CMP-LNP-Circ-UTRN could effectively inhibit pathological myocardial hypertrophy induced by PE / ISO (see Fig.14 and Fig.15 ).

[0145] 5. Delivery of CMP-LNP-Circ-UTRN in Animals

[0146] PBS and the CMP-LNP-Circ-UTRN prepared above were injected into mice by tail vein injection. Each mouse was injected with the same dose of 200 μL, and the amount of CMP-LNP-Circ-UTRN injected was 50 μg based on in vitro transcribed RNA. 24 hours after the injection, RNA was extracted from the mouse heart and liver tissues, and the expression level of Circ-UTRN was detected.

[0147] Compared with the PBS group, CMP-LNP was able to effectively deliver Circ-UTRN to the mouse heart at 24 h (see Fig.16 ).

[0148] The above results indicate that CMP-LNP-Circ-UTRN can improve pathological hypertrophy of cardiomyocytes and successfully deliver in vitro transcribed Circ-UTRN in the mouse heart.

[0149] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A cardiac-targeted nanoliposome delivery carrier, characterized in that: It comprises vesicular nanoliposome particles and a cardiac targeting peptide CMP modified on the surface of the nanoliposome particles; The amino acid sequence of the cardiac targeting peptide CMP is shown in SEQ ID NO:

6.

2. The cardiac-targeted nanoliposome delivery carrier according to claim 1, characterized in that: The components of the nanoliposome particles include ionizable lipids, cholesterol, distearoylphosphatidylcholine, DMG-PEG2K and DSPE-PEG2K-carboxy-NHS in a molar ratio of 50:38.5:10:1.2:0.

3. 。 3. The cardiac-targeted nanoliposome delivery carrier according to claim 2, characterized in that: The molar ratio of the cardiac targeting peptide CMP to DSPE-PEG2K-carboxy-NHS is (10-100):

1.

4. The cardiac-targeted nanoliposome delivery carrier according to claim 1, characterized in that: The cardiac targeting peptide CMP is coupled to the nanoliposome particles through the formation of an amide bond between the amino group and the NHS group in DSPE-PEG2K-carboxy-NHS.

5. A circular RNA drug for treating cardiovascular disease, characterized in that: The invention comprises the nanoliposome delivery carrier according to any one of claims 1 to 4 and a circular RNA molecule for treating cardiovascular diseases encapsulated inside the nanoliposome delivery carrier.

6. The circular RNA drug for treating cardiovascular diseases according to claim 5, characterized in that: The circular RNA molecule includes Circ-UTRN; The nucleotide sequence of the Circ-UTRN is shown in SEQ ID NO:

5.

7. The circular RNA drug for treating cardiovascular diseases according to claim 5, characterized in that: The mass ratio of the circular RNA molecule to the nanoliposome delivery carrier is 5.67:

1.

8. The method for preparing the circular RNA drug according to any one of claims 5 to 7, characterized in that: The following steps are involved: Circular RNA molecules, ionizable lipids, cholesterol, distearoylphosphatidylcholine, DMG-PEG2K and DSPE-PEG2K-carboxy-NHS were mixed by microfluidics technology to obtain nanoliposomes encapsulating circular RNA molecules; The nanoliposomes encapsulating the circular RNA molecules are mixed and stirred with the cardiac targeting peptide CMP to obtain a circular RNA drug.

9. The preparation method according to claim 8, characterized in that: When the microfluidic technology is used for mixing, the flow rate of the material is 4 ml / min; During the mixing and stirring, the system temperature was 4° C.; the mixing and stirring speed was 100 rpm.

10. Use of the nanoliposome delivery carrier according to any one of claims 1 to 4 in the preparation of a drug for preventing and / or treating cardiovascular diseases.

Images