Candida glabrata and application thereof

By screening and identifying Candida glabratus YX2024, the problems of low enzyme activity and poor acid resistance in existing technologies have been solved, enabling the application of high-activity lipase and the intestinal delivery of probiotics, which is applicable to food, textile, chemical and aquaculture fields.

CN119776159BActive Publication Date: 2026-03-03YONGCHANG TIANKANG FEED CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-07
Publication Date
2026-03-03

AI Technical Summary

Technical Problem

Existing technologies lack Candida glabrata with high enzyme activity and resistance to acid, gastric juice, and intestinal fluid, making it difficult to use as a high-quality probiotic or an industrial bacterium that produces lipase.

Method used

A strain of Candida glabratus, Nakaseomyces glabratus YX2024, was screened and identified. It has an enzyme activity of 277.56±0.01 U·mL⁻¹ and can maintain a survival rate of over 85% at pH 3. It is suitable for preparing industrial bacteria and probiotics that produce lipase.

Benefits of technology

This strain exhibits significantly higher lipase activity than other strains and possesses excellent resistance to acid, gastric juice, and intestinal fluid. It can be used as a highly efficient probiotic and lipase-producing industrial bacterium in the food, textile, chemical, and aquaculture industries.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119776159B_ABST
    Figure CN119776159B_ABST
Patent Text Reader

Abstract

The application belongs to the field of biology, discloses a Candida glabrata, the classification name of the Candida glabrata is Nakaseomyces glabratus YX2024, the preservation unit of the Candida glabrata is China Center for Type Culture Collection, the preservation time is December 23, 2024, the preservation number is CCTCC NO: M 20242881, and the preservation address is China.Wuhan.Wuhan University.The enzyme activity of the lipase produced by the bacteria is significantly higher than that of other strains screened in the same batch, and the bacteria have excellent acid resistance, gastric juice resistance and intestinal juice resistance characteristics.Meanwhile, the application also discloses the use based on the Candida glabrata.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biology, specifically relating to a strain of Candida glabrata and its applications. Background Technology

[0002] With the implementation of measures such as "reducing and replacing antibiotics" in animal husbandry, and people's pursuit of high-quality livestock products, the development of green feed additives has become an inevitable trend in healthy farming. Yeast, as a type of probiotic, plays an important role in maintaining intestinal homeostasis, preventing and treating various gastrointestinal diseases, regulating host immune function, preventing the invasion of harmful pathogens, promoting growth and development, and delaying aging.

[0003] Current research focuses primarily on the application of microbial fermented feed, the comparison of yeast with antibiotics in chronic enteritis, and the impact of yeast on gut microbiota. To screen for more nutritious and functional compound fermentation products, suitable strains need to be selected and their culture conditions optimized. Commonly used strains mainly include two categories: bacteria and fungi. The main fungal genera include yeasts (Saccharomyces cerevisiae and Candida albicans).

[0004] Candida glabrata belongs to the Candida species. It is rarely reported as a beneficial bacterium, but it is widely reported to be pathogenic, such as causing vaginal infections.

[0005] Ningxiang pigs, as a national geographical indication agricultural product, are characterized by high reproduction rate, early maturity and easy fattening, loose meat, tolerance to roughage and strong disease resistance. Their intestines contain rich beneficial microbial resources, which can bring high-quality strains to the breeding industry.

[0006] We discovered some Candida glabrata in the intestinal flora of Ningxiang pigs. These Candida glabrata exhibited some unique properties, and based on this, we propose this case. Summary of the Invention

[0007] Based on this, the first objective of the present invention is to provide a strain of Candida glabrata, the lipase produced by this strain having significantly higher enzyme activity than other strains obtained in the same batch of screening, and at the same time, this strain has excellent acid resistance, gastric juice resistance and intestinal juice resistance.

[0008] Furthermore, the present invention also discloses the uses of this Candida glabrata.

[0009] To achieve the above-mentioned objectives, the present invention adopts the following technical solution:

[0010] A strain of *Candida glabratus*, classified as *Nakaseomyces glabratus* YX2024, is deposited at the China Center for Type Culture Collection (CCTCC) on December 23, 2024, with accession number CCTCC NO: M 20242881 and address at Wuhan University, Wuhan, China.

[0011] The 16S RNA sequence (SEQ ID NO.1) of this bacterium is as follows:

[0012] TAGCATTTATTGATTTGTCTGAGCTCGGAGAGACATCTCTGGGGAGGACCAGTGTAGACACTCAGGAGGTTCCTAAAATATTTTCTCTGCTGTGAATGCCATTTCTCCTGCCTGCGCTTAAGTGCGCGGTTGGTGGGTGTTCTGCAGTGGGGGGAGGGAGCCGACAAAGACCTGGGAGTGTGCGTGGATCTCTCTATTCCA AAGGAGGTGTTTTATCACACGACTCGACACTTTCTAATTACTACACACAGTGGAGTTTACTTTACTACTATTCTTTTGTTCGTTGGGGGAACGCTCTCTTTCGGGGGGGGAGTTCTCCCAGTGGATGCAAACACAAACAAATATTTTTTTAAACTAATTCAGTCAACACAAGATTTCTTTTAGTAGAAAACAACTTCAAAACT TTCAACAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACACGTTGTGTTTGGTAGTGAGTGATACTCTCGTTTTTGAG TTAACTTGAAATTGTAGGCCATATCAGTATGTGGGACACGAGCGCAAGCTTCTCTATTAATCTGCTGCTCGTTTGCGCGAGCGGCGGGGGGTTAATACTGTATTAGGTTTTACCAACTCGGTGTTGATCTAGGGAGGGATAAGTGAGTGTTTTGTGCGTGCTGGGCAGACAGACGTCTTTAAGTTGACCTCAAATCAGGTACGGG

[0013] Tests revealed that the lipase produced by this Candida glabrata had an enzyme activity of 277.56 ± 0.01 U·mL. -1 The survival rate in gastric juice was 87.97% ± 0.64, and the survival rate in intestinal juice was also 87.97% ± 0.64; the survival rate could be maintained above 85% at pH 3.

[0014] Lipases are widely used in food, textiles, chemicals, aquaculture and other fields. For details, please refer to "Application and Research Progress of Microbial Lipases", by Wang Xiaofeng et al., Biotechnology Bulletin, No. 4, 2008.

[0015] No existing technologies have reported yielding enzyme activities exceeding 100 U·mL. -1 For related strains, please refer to "Screening and Enzymatic Characteristics Study of Lipase-Producing Strains", by Hu Chaoyang et al., Guangxi Agricultural Bioscience, September 2006, Vol. 25, No. 3. It screened 58 lipase-producing strains, and the live lipase produced by each strain was significantly less than that of Candida glabrata screened in this invention.

[0016] The Candida glabrata of this invention not only produces lipase with high enzyme activity, but it can also adapt to acidic environments and survive well in the gastrointestinal tract, meaning that it can be used as a probiotic and can successfully reach the intestines.

[0017] Meanwhile, the present invention also discloses the use of the above-mentioned Candida glabrata in the preparation of lipase-producing industrial strains, and its use in the preparation of probiotics.

[0018] In the above-described uses, the probiotics are added to feed in the form of a feed additive.

[0019] Finally, the present invention also discloses an industrial bacterium that produces lipase, containing *Candida glabrata* as described above. Additionally, it discloses a *Candida glabrata* probiotic as described above and an animal feed containing *Candida glabrata* as described above.

[0020] The beneficial effects of this invention are as follows:

[0021] The lipase produced by Candida glabrata of the present invention has a significantly higher enzyme activity than other strains obtained in the same batch of screening. At the same time, this bacterium has excellent resistance to acid, gastric juice and intestinal juice. Attached Figure Description

[0022] Figure 1 Electrophoretic imaging of variable region sequences of multiple strains amplified by PCR.

[0023] Figure 2 A hydrolysis diagram of a lipase-producing strain;

[0024] Figure 3 This is the standard curve for lipase.

[0025] Figure 4 This is a diagram showing the antibacterial results of some strains;

[0026] Figure 5 The growth curve of strain #11;

[0027] Figure 6 The growth curves of strain #11 at different temperatures are shown.

[0028] Figure 7 The growth curves of strain #11 at different pH values ​​are shown. Detailed Implementation

[0029] The technical solution of the present invention will be further illustrated below through specific embodiments. Those skilled in the art should understand that the embodiments described are merely illustrative of the present invention and should not be construed as limiting the invention in any way.

[0030] 1. Materials and Equipment

[0031] 1.1 Sample

[0032] Ningxiang pig small intestine contents

[0033] 1.2 Strains

[0034] Escherichia coli K88, Staphylococcus aureus, and Salmonella were provided by Professor Yin Jie from the College of Animal Science and Technology, Hunan Agricultural University.

[0035] 1.3 Culture medium

[0036] Malt extract broth culture medium: 6.0 g / L malt extract, 6.0 g / L glucose, 1.8 g / L maltose, 1.2 g / L yeast extract, autoclaved at 121°C for 15 minutes.

[0037] Potato glucose agar (PDA) medium: 6.0 g / L potato extract, 20.0 g / L glucose, 0.1 g / L chloramphenicol, 20.0 g / L agar, autoclaved at 121°C for 15 minutes.

[0038] Potato glucose water culture medium (PDW): 6.0 g / L potato extract powder, 20.0 g / L glucose, autoclaved at 121°C for 20 min.

[0039] MH agar medium (MHA): 2.0 g / L beef extract powder, 1.5 g / L soluble starch, 17.5 g / L acid-hydrolyzed casein, autoclaved at 121°C for 15 minutes.

[0040] YPDA medium: yeast extract 10.0 g / L, peptone 20.0 g / L, glucose 20.0 g / L, adenine sulfate 0.03 g / L, autoclaved at 116℃ for 30 minutes.

[0041] YPD liquid culture medium: peptone 20.0 g / L, glucose 20.0 g / L, yeast extract 10.0 g / L, autoclaved at 121℃ for 15 minutes.

[0042] Basic culture medium: Add 1.0% skim milk powder to YPD medium, mix well, and autoclave the culture medium separately at 121℃ for 20 minutes to prevent milk powder denaturation.

[0043] Protease fermentation medium: glucose 50 g / L, peptone 10 g / L, KH2PO4 2 g / L, MgSO4·7H2O 0.4 g / L, pH 7.0, autoclaved at 121℃ for 15 minutes.

[0044] Tween-20 medium: 10 g / L peptone, 5 g / L NaCl, 0.1 g / L CaCl2·H2O, 10 g / L Tween-20, 15 g / L agar, 1000 mL distilled water, pH 7.0–7.4, 1 mL 1.6% neutral red solution, autoclaved at 121°C for 15 minutes.

[0045] Lipase fermentation medium: 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose, 1% olive oil (v / v). Glucose and other ingredients were sterilized separately at 115°C for 30 min and then combined and autoclaved at 121°C for 15 min.

[0046] 1.4 Main Instruments and Equipment

[0047] Instrument Name and Manufacturer: Constant Temperature Incubator, Harbin Donglian Electronic Technology Development Co., Ltd.; Clean Bench, Shanghai Lishen Scientific Instruments Co., Ltd.; Tabletop High-Speed ​​Refrigerated Centrifuge, Hunan Michael Experimental Instruments Co., Ltd.; Autoclave, Shanghai Shenan Medical Instrument Factory; INFINITE M PLEX Multifunctional Microplate Reader, Tecan.

[0048] Combined shaking incubator, Harbin Donglian Electronic Technology Development Co., Ltd.; Laboratory pure water system, Veolia Water Technology (Shanghai) Co., Ltd.

[0049] 2. Test Methods

[0050] 2.1 Isolation of strains

[0051] Fresh intestinal contents collected from Ningxiang pigs were added to malt extract broth medium and incubated at 28°C for 48 hours to enrich yeast. After incubation, the yeast enrichment solution was diluted and spread onto YPD solid medium, and incubated upside down at 28°C for 2–3 days to observe for colony growth. Different single colonies were picked up with an inoculation loop and streaked onto YPD solid medium, repeated 2–3 times until purified colonies were obtained, which were then stored at 4°C.

[0052] 2.2 Identification of Yeast

[0053] (1) Morphological identification: Observe the size, shape, degree of elevation, surface characteristics, color, and transparency of the colonies. Select typical colony samples and stain them with methylene blue. Take 0.1% Lüssler alkaline methylene blue staining solution and drop it into the center area of ​​the slide. Use a sterile inoculation loop to gently pick up a small amount of yeast cells and mix them evenly with the staining solution to ensure the uniformity and accuracy of the staining effect. After standing for about 3 minutes, observe the morphology, budding, and arrangement of the yeast cells under a microscope. Select strains with clear and typical morphology in the field of view and photograph them.

[0054] (2) Molecular biological identification: Colony PCR was performed according to the Beyotime yeast colony PCR kit (alkaline lysis method) instructions. Gene amplification was performed using universal primers for ITS rDNA sequence (ITS1 5'-TCCG TAGG TGAA CCTG CGG-3' (SEQ ID NO.2); ITS4 5'-TCCT CC CGC TTAT TGAT ATGC-3' (SEQ ID NO.3)).

[0055] Yeast colony lysis: Prepare PCR reaction tubes, add 10 μl of Yeast Lysis Buffer to each tube, pick the yeast cells into the PCR tube and mix well, then add 10 μl of Neutralization Buffer and mix well.

[0056] Setting up the yeast colony PCR reaction system: Melt the Yeast Colony PCR Mix at room temperature, add 1 μl of the prepared DNA template to the PCR reaction system, and start the PCR reaction.

[0057] The PCR reaction parameters can be set according to the following example steps: STEP1 (initial denaturation): 94℃ for 3 min; STEP2 (denaturation): 94℃ for 30 sec; STEP3 (annealing): 55℃ for 30 sec; STEP4 (extension): 72℃ for 1 min / kb; STEP5 (cycling): Repeat STEP2 (denaturation) for a total of 30 cycles; STEP6 (final extension): 72℃ for 10 min; STEP7 (temporary storage): Permanent storage at 4℃.

[0058] Results detection: After the PCR reaction is completed, take 5-10 μL directly for electrophoresis analysis using 1% agarose gel electrophoresis. No loading buffer is required.

[0059] Yeast was isolated from pig feces using malt extract agar solid medium. Single milky white colonies were picked and streaked on YPD solid medium for purification. Based on colony size and morphological characteristics, 20 suspected yeast strains were finally screened and purified.

[0060] Colony PCR was performed using the universal yeast primers ITS1 5'-TCCG TAGG TGAA CCTG CGG-3'; ITS4 5'-TCCT CC CGC TTAT TGAT ATGC-3' to amplify the variable region sequence of yeast ITS rDNA. Imaging was performed by 1% agarose gel electrophoresis. Figure 1 .

[0061] Figure 1 Electrophoretic imaging of variable region sequences of multiple strains amplified by PCR.

[0062] Preliminary screening identified strains 01, 02, 03, 04, 06, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, and 20 as yeast.

[0063] (3) ITS Sequencing: Genomic DNA was extracted using a fungal genomic DNA extraction kit and amplified by PCR using universal primers (ITS15'-TCCG TAGG TGAA CCTG CGG-3'; ITS4 5'-TCCT CC CGC TTAT TGAT ATGC-3'). The amplified DNA was then detected by gel electrophoresis, and the results were sent to a sequencing company for sequencing. The sequencing results were used to align the ITS rDNA sequence of the tested strain with sequences in the GenBank nucleic acid database to assess the homology between the ITS rDNA sequence and corresponding sequences in known yeasts.

[0064] Yeast genomic DNA was extracted according to the instructions of the fungal genomic DNA extraction kit. The variable region sequence of yeast ITS rDNA was amplified using universal yeast primers, and the result was imaged by 1% agarose gel electrophoresis. ITS rDNA PCR amplification was performed on the eight isolated strains, and the sequencing results are shown in the table below. Eight strains were isolated from pig feces, and the identification results are shown in Table 1 below.

[0065] Table 1. Identification results of the strains

[0066]

[0067]

[0068] 2.3 Lipase Production Experiment

[0069] Initial screening of strains: Select suitable strains for purification, and inoculate the purified bacteria into Tween-20 medium for initial screening. Incubate at 28℃ for 48-72 hours. Observe the growth of colonies and changes in the culture medium. Photograph yeast strains with obvious transparent hydrolysis zones and record the ratio of the hydrolysis zone diameter (D) to the colony diameter (d), D / d. Some lipase-producing strains exhibit visible hydrolysis zones during cultivation. Figure 2 Strains with larger hydrolysis zones were screened for secondary screening.

[0070] Figure 2 A hydrolysis diagram of a lipase-producing strain;

[0071] Secondary screening of strains: Based on the culture temperature of the initial screening, the strains obtained from the initial screening were inoculated into lipase fermentation medium and cultured at 28℃ for 72 h. 2 ml of fermentation broth was taken and centrifuged at 10000 r / min for 10 min, and the supernatant was used as the crude enzyme solution. For lipase activity assay, p-nitrophenol palmitate (p-NPP) was selected as the substrate and appropriately adjusted according to the method of UK Winkler et al. First, 600 μL of substrate solution was added to the sample in a 1.5 mL centrifuge tube, followed by 25 μL of appropriately diluted crude enzyme solution. For the control group, 25 μL of pH 7.0 Tris-HCl buffer was added, and the mixture was incubated at 40℃ for 15 min, followed by the addition of 500 μL of 95% ethanol solution to terminate the reaction. After centrifugation at 10,000 r / min for 3 min, the absorbance was measured at 410 nm. The amount of enzyme required to catalyze the hydrolysis of the substrate p-nitrophenol palmitate (pNPP) to produce 1 μmol of p-nitrophenol (pNP) within 1 min was defined as 1 enzyme activity unit (U).

[0072] Construction of the standard curve: Prepare a 20 mmol / L solution of 2.0 mmol / L isopropanol. First, dissolve 0.1391 g of pNP (i.e., 10 mg / mL) in 50 mL of isopropanol. Then, take 10 mL from this stock solution and accurately dilute to 100 mL to obtain the 2.0 mmol / L working solution. The amounts of various reagents added are as shown in Table 2 to ensure that the reaction volume and conditions are consistent with the enzyme activity measured in the experiment.

[0073] Standard curve visible Figure 3 ;

[0074] Figure 3 This is the standard curve for lipase.

[0075] Table 2. Determination of the standard curve for p-nitrophenol (pNP)

[0076]

[0077]

[0078] Distilled water was used as a blank control in the experiment. Absorbance was measured at a wavelength of 410 nm. A standard curve for p-nitrophenol was plotted based on the measurement data, and the correlation formula between absorbance value and pNP content was calculated as Y = aX + b (Y: pNP concentration, X: absorbance value, a, b: reaction coefficients). The ratio D / d of lipase-producing strains and the results of enzyme activity determination are shown in Table 3.

[0079] Table 3. Ratio (D / d) and enzyme activity of lipase-producing strains.

[0080]

[0081] As can be seen from Table 3, strain No. 11 (i.e., Candida glabrata of the present invention) has the strongest enzyme activity, which far exceeds that of other strains.

[0082] 2.4 Functional determination of the strain

[0083] (1) Antibacterial experiment of the strain: The Oxford cup method was used to evaluate the inhibitory ability of the strain against Escherichia coli (three replicates). MHA medium was prepared, with a medium thickness of about 4 mm in each petri dish. 1.0 × 10 8 Spread the bacterial solution evenly on MHA medium, place it in a sterile Oxford cup, add 200 μL of bacterial solution to each well, and incubate at 37°C for 16-24 hours. Observe whether an inhibition zone appears.

[0084] The strains selected above were subjected to antibacterial experiments, by... Figure 4 It can be seen that strains 02#, 03#, 04#, 05#, 11#, 15#, 17# and 20# have no inhibitory effect on Escherichia coli.

[0085] (2) Determination of growth curve

[0086] A single activated colony (strain #11) was picked and inoculated into YPD liquid medium. The culture was incubated at 35°C with shaking at 180 rpm for 1 day. Then, 2% (V / V) of the inoculum was added to the YPD liquid medium, and the culture was incubated at 30°C with shaking at 180 rpm. Samples were taken every 2 hours, with distilled water as a blank control, and OD values ​​were measured. 560 Each group underwent three parallel experiments. The time axis was plotted as OD. 560 Plot the growth curve of the target strain on the ordinate.

[0087] The growth curve of the strain is visible. Figure 5The bacterium has a lag phase of about 5 hours, during which the cell number does not change significantly. After 5 hours, it enters the logarithmic phase, during which the cells begin to grow rapidly and the cell number increases exponentially. After 14 hours, the cells enter the stationary phase, during which the cell number does not change much. After 24 hours, the cells begin to enter the death phase, and the cell number begins to decline.

[0088] (3) Temperature tolerance of the strain: The activated strain (strain 11) was inoculated into centrifuge tubes containing 1 mL of LYPD liquid medium at an inoculation rate of 2% (V / V) to form three groups of bacterial suspension samples. Each group of bacterial suspensions was placed in a constant temperature water bath at 30℃ (as a control), 60℃, and 80℃ for 10 minutes, respectively. The bacterial suspensions were then removed and incubated in a 30℃ incubator for 24 hours. The absorbance of the strains was then measured at a wavelength of 600 nm, and the survival rate of the strains at different temperatures was calculated.

[0089] refer to Figure 6 When the temperature is below 35℃, the growth rate of this bacterium increases with the increase of temperature; when the temperature reaches 35℃, its growth value reaches its maximum; after the temperature continues to rise, the growth shows a downward trend.

[0090] (4) Acid resistance of the strain: The activated strain (strain 11) was inoculated at a rate of 2% (V / V) into YPD liquid medium with pH values ​​of 2.0, 3.0, 4.0, 5.0 and 6.5, respectively, and incubated at 28°C for 24 hours. The absorbance was measured at a wavelength of 600 nm. The survival rate was recorded with pH 6.5 as the control.

[0091] Survival rate results can be referenced Figure 7 The survival rate of this bacterium is above 85% at pH 3-5, indicating good acid tolerance.

[0092] (6) Simulated gastric and intestinal fluid experiments: Artificial gastric and intestinal fluids were prepared according to the Pharmacopoeia of the People's Republic of China (2020 edition). Activated bacterial strains (strains 02#, 03#, 04#, 05#, 11#, 15#, 17#, and 20#) were inoculated into intestinal fluid, gastric fluid, and physiological saline at a ratio of 2% (V / V). After incubation at 28°C for 4 hours, the absorbance of the bacterial solutions was measured at 600 nm. Each strain was measured four times. The survival rate of the strains in gastric and intestinal fluids was calculated using the absorbance of the physiological saline group as a control.

[0093] The survival rate results can be found in Table 4;

[0094] Table 4 Survival rates resistant to gastric and intestinal fluids

[0095] Strain ID | Survival Rate gastric juice Intestinal fluid 02 43.48%±0.28g 122.155±0.27g 03 83.95%±0.95f 67.715±1.87f 04 79.00%±0.67e 133.46%±1.45f 05 91.69%±0.68e 92.84%±2.10e 11 87.97%±0.64d 128.21%±1.24d 15 74.68%±1.24c 87.38%±1.25c 17 73.08%±0.24b 105.43%±1.23b 20 65.06%±0.30a 87.70%±0.79a

[0096] As shown in Table 4, all eight strains exhibited high survival rates in simulated gastric and intestinal fluid environments. Strains 03, 04, 05, 11, 15, and 17 showed high OD values ​​in simulated gastric fluid. 600 The values ​​were 84.62%, 79.67%, 91.69%, 88.60%, 75.92%, and 72.84%, respectively. In the simulated artificial intestinal fluid environment, the survival rates of all strains except strain 03 were relatively high, and there were significant differences among the strains in gastric and intestinal fluids.

[0097] Summarize:

[0098] The above experiments lead to the following conclusions:

[0099] 1. The Candida glabrata (11# strain) of the present invention has the ability to produce lipase, and the lipase produced by it has extremely high enzyme activity characteristics. This means that the Candida glabrata of the present invention can be used as an industrial strain for producing lipase.

[0100] Lipases with high enzyme activity play a vital role in industrial production. As one of the most important industrial enzyme preparations, lipases catalyze reactions such as lipolysis, transesterification, and ester synthesis, and are widely used in oil processing, food, pharmaceuticals, and daily chemical industries. Lipases from different sources exhibit different catalytic characteristics and activities. The large-scale production of lipases with transesterification or esterification functions used in organic phase synthesis is of great significance for the enzyme-catalyzed synthesis of fine chemicals and chiral compounds.

[0101] 2. The Candida glabrata (11# strain) of the present invention was isolated from the intestines of healthy Ningxiang pigs. It has excellent resistance to acid and gastrointestinal fluid. When it is used as an oral probiotic, it can reach the animal's intestines with a high survival rate and has the potential to be used as a probiotic.

[0102] The embodiments presented herein are merely selected implementations based on combinations of all possible embodiments. The appended claims should not be limited to the embodiments described herein. Some numerical ranges used in the claims include sub-ranges within them, and variations within these ranges should also be covered by the appended claims.

Claims

1. A strain of Candida glabrata, characterized in that, The classification name of the Candida glabrata is Nakaseomyces glabratus YX2024; the deposit unit of the Candida glabrata is China Center for Type Culture Collection; the deposit time is December 23, 2024; the deposit number is CCTCC NO: M 20242881; and the deposit address is Wuhan, China, Wuhan University.

2. Use of the Candida glabrata according to claim 1 for preparing a lipase-producing industrial strain.

3. A lipase producing industrial bacteria, characterized in that, A composition containing the Candida glabrata according to claim 1.