An acyltransferase mutant and its use in the synthesis of n-acetyl-trans-4-hydroxyproline
By performing site-directed mutagenesis on acyltransferases, especially the D10V/D95I mutant, and combining it with suitable reaction conditions, the yield and catalytic efficiency of N-acetyl-trans-4-hydroxyproline were improved, solving the problems of low efficiency and environmental unfriendliness of traditional chemical synthesis methods, and realizing efficient biosynthesis.
Patent Information
- Application Number
- CN202411990790.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-31
- Publication Date
- 2025-11-11
- Estimated Expiration
- 2044-12-31
AI Technical Summary
In the existing technology, the traditional chemical synthesis method of N-acetyl-trans-4-hydroxyproline is complex and inefficient, with high production costs and is not environmentally friendly. Furthermore, the enzyme activity of wild-type acyltransferase is difficult to meet the needs of large-scale production.
By performing site-directed mutagenesis on acyltransferases, particularly modifying the 10th and 95th amino acid residues in the amino acid sequence to form mutants such as D10V/D95I, the catalytic activity and substrate conversion rate of the enzyme can be improved. Combined with suitable reaction conditions such as surfactants and metal ions, the catalytic process can be optimized.
It significantly improved the yield and catalytic efficiency of N-acetyl-trans-4-hydroxyproline, with the mutant D10V/D95I yielding 8.76 g/L, which could reach 12.71 g/L after the addition of surfactants and metal ions, thus solving the efficiency and environmental problems of traditional methods.
Smart Images

Figure CN119776314B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to an acyltransferase mutant and its application in the synthesis of N-acetyl-trans-4-hydroxyproline, belonging to the field of enzyme engineering technology. Background Technology
[0002] N-acetyl-trans-4-hydroxyproline, as an important amino acid derivative, has wide applications in the fields of cosmetics, skincare, and biomedicine. In cosmetics, it is primarily used as an effective ingredient for anti-aging, anti-wrinkle, and moisturizing. In the pharmaceutical field, it is used to treat osteoarthritis and rheumatoid arthritis, relieving pain and limb stiffness, and exhibiting good gastrointestinal safety. However, the traditional synthesis of N-acetyl-trans-4-hydroxyproline mainly relies on the chemical reaction between trans-4-hydroxy-L-proline and an acetylation reagent. This method is not only complex and requires cumbersome separation steps, but it is also inefficient, leading to high production costs. Furthermore, the waste generated during chemical synthesis has an adverse environmental impact, limiting its large-scale industrial production.
[0003] To address the aforementioned issues, enzymatic synthesis methods have gained increasing attention in recent years. Acyltransferases, as important biocatalysts, play a crucial role in the synthesis of N-acetyl-trans-4-hydroxyproline by transferring the acetyl group from the acyl donor to trans-4-hydroxy-L-proline. However, wild-type acyltransferases often exhibit low activity, making it difficult to meet the demands of large-scale production. Therefore, finding acyltransferase mutants with high catalytic activity and suitable catalytic methods are key to improving the efficiency of N-acetyl-trans-4-hydroxyproline synthesis.
[0004] While existing technologies have attempted to modify acyltransferases through genetic engineering, the resulting mutant enzymes exhibit limited activity enhancement and suffer from poor stability and low substrate selectivity. Patent CN117586979A discloses an acyltransferase mutant using trans-4-hydroxy-L-proline as a substrate, catalyzed by a genetically engineered strain expressing this acyltransferase mutant; however, the yield of N-acetyl-trans-4-hydroxyproline remains low.
[0005] Therefore, finding a method for the efficient synthesis of N-acetyl-trans-4-hydroxyproline can reduce production costs and minimize environmental impact, providing a new solution for the industrial production of N-acetyl-trans-4-hydroxyproline. Summary of the Invention
[0006] To further explore the potential of acyltransferase (MsAcT) and improve its enzyme activity, this invention provides an acyltransferase mutant. Compared with the original mutant, the mutant significantly improves the conversion rate of trans-4-hydroxy-L-proline, thereby further increasing the yield of N-acetyl-trans-4-hydroxyproline.
[0007] The first objective of this invention is to provide an acyltransferase mutant with high acetylation activity, wherein the acyltransferase mutant contains mutations at positions 10 and 95, based on the acyltransferase mutant with the corresponding amino acid sequence as shown in SEQ ID NO.1.
[0008] SEQ ID NO.1:
[0009] MAKRILCFGDCLTWGWVPVEDGAPTERFAPDVRWTGVLAQQLGADFEVIEEGLSARTTNIDDPTDPRLNGASYLPSCLATHLPLDLVIIMLGTNDTKAYFRRTPLDIALGMSVLVTQVLTSAGGVGTTYPAPKVLVVSPPPLAPMPHPWFQLIFEGGEQKTTELARVYSALASFMKVPFFDAGSVISTDGVDGIHFTEANNRDLGVALAEQVRSLL
[0010] In one embodiment of the present invention, the nucleotide sequence encoding the acyltransferase mutant with the amino acid sequence shown in SEQ ID NO.1 is shown in SEQ ID NO.2.
[0011] SEQ ID NO.2:
[0012] ATGGCCAAACGCATCTTATGTTTCGGAGACtgcCTGACTTGGGGATGGGTTCCCGTGGAAGACGGTGCTCCTACTGAACGCTTTGCGCCAGATGTACGCTGGACCGGCGTATTAGCTCAGCAGTTAGGCGCTGACTTTGAAGTCATTGAGGAAGGTTTGTCT GCCCGTACGACAAACATCGATGATCCCACCGACCCGCGTTTGAATGGAGCGAGCTATCTTCCCTCGTGCCTGGCAACTCACTTACCGCTGGATCTTGTTATTATCATGTTGGGCACAAACGACACCAAGGCGTATTTCCGCCGCACACCCCTTGATATTGCA CTTGGGATGTCGGTGCTTGTCACACAGGTCTTGACATCCGCGGGGGGAGTAGGCACGACATATCCCGCACCGAAAGTATTAGTCGTCTCGCCTCCTCCCTTGGCACCCATGCCTCACCCCTGGTTTCAACTGATTTTTGAGGGCGGAGAACAAAAGACAACG GAACTTGCCCGTGTGTATTCAGCGCTGGCTTCGTTTATGAAAGTCCCGTTCTTTGATGCCGGTAGCGTGATCAGTACAGACGGCGTAGATGGTATCCACTTTACGGAGGCCAATAACCGTGATCTGGGGGTGGCACTGGCGGAGCAAGTTCGCTCACTTTTA
[0013] In the amino acid sequence SEQ ID NO.1, the 10th and 95th amino acid sites are hydrophilic amino acid residues.
[0014] In one embodiment of the present invention, the acyltransferase mutant contains mutations at positions 10 and 95, and at position 62 or 64, based on the acyltransferase mutant with the corresponding amino acid sequence as shown in SEQ ID NO. 1.
[0015] In one embodiment of the present invention, the acyltransferase mutant is obtained by mutating aspartic acid at position 10 of the acyltransferase mutant with amino acid sequence as shown in SEQ ID NO.1 to valine, and simultaneously mutating aspartic acid at position 95 of the acyltransferase mutant with amino acid sequence as shown in SEQ ID NO.1 to isoleucine, and is named: D10V / D95I.
[0016] In one embodiment of the present invention, the aspartic acid at position 62 of the acyltransferase mutant with the amino acid sequence as shown in SEQ ID NO.1 is mutated to lysine, the aspartic acid at position 10 of the acyltransferase mutant with the amino acid sequence as shown in SEQ ID NO.1 is mutated to valine, and the aspartic acid at position 95 of the acyltransferase mutant with the amino acid sequence as shown in SEQ ID NO.1 is mutated to isoleucine, and the resulting mutant is named: D62K / D10V / D95I.
[0017] In one embodiment of the present invention, the aspartic acid at position 62 of the acyltransferase mutant with the amino acid sequence as shown in SEQ ID NO.1 is mutated to arginine, the aspartic acid at position 10 of the acyltransferase mutant with the amino acid sequence as shown in SEQ ID NO.1 is mutated to valine, and the aspartic acid at position 95 of the acyltransferase mutant with the amino acid sequence as shown in SEQ ID NO.1 is mutated to isoleucine, and the resulting mutant is named: D62R / D10V / D95I.
[0018] In one embodiment of the present invention, the threonine at position 64 of the acyltransferase mutant with the amino acid sequence as shown in SEQ ID NO.1 is mutated to asparagine, the aspartic acid at position 10 of the acyltransferase mutant with the amino acid sequence as shown in SEQ ID NO.1 is mutated to valine, and the aspartic acid at position 95 of the acyltransferase mutant with the amino acid sequence as shown in SEQ ID NO.1 is mutated to isoleucine, and the resulting mutant is named: T64N / D10V / D95I.
[0019] In one embodiment of the present invention, the amino acid sequence of the D62K / D10V / D95I mutant is shown in SEQ ID NO.3, and the nucleotide sequence is shown in SEQ ID NO.4.
[0020] The present invention also provides a gene encoding the above-mentioned mutant or a recombinant vector carrying the gene.
[0021] The present invention also provides recombinant cells expressing the above-mentioned mutants or carrying the above-mentioned genes or the recombinant vectors.
[0022] In one embodiment of the present invention, the recombinant cells are expressed using bacteria or fungi as expression hosts.
[0023] In one embodiment of the present invention, the host of the recombinant cells is Escherichia coli C43(DE3).
[0024] The present invention also provides a recombinase catalyst containing the above-mentioned acyltransferase mutant sequence, wherein the catalyst is any one of the following forms:
[0025] (1) Culture the recombinant expression transformant, isolate the transformant cells expressing the recombinase containing the acyltransferase mutant sequence, and obtain the recombinase catalyst;
[0026] (2) Culture the recombinant expression transformant, isolate the transformant cells expressing the recombinase containing the acyltransferase mutant sequence, break the transformant cells expressing the recombinant enzyme to obtain the cell lysate, and obtain the recombinant enzyme catalyst;
[0027] (3) Cultivate recombinant expression transformants, isolate transformant cells expressing recombinant enzyme containing the acyltransferase mutant sequence, break the transformant cells expressing recombinant enzyme to obtain cell lysate, freeze-dry the cell lysate to obtain lyophilized enzyme powder, and obtain the recombinant enzyme catalyst.
[0028] The present invention also provides a method for increasing acyltransferase activity (AT:H); wherein AT:H is the ratio of acyltransferase activity to hydrolytic activity;
[0029] The method involves mutating aspartic acid at position 10 of the acyltransferase mutant with the amino acid sequence shown in SEQ ID NO.1 to valine, and simultaneously mutating aspartic acid at position 95 of the acyltransferase mutant with the amino acid sequence shown in SEQ ID NO.1 to isoleucine.
[0030] Alternatively, the aspartic acid at position 62 of the acyltransferase mutant with the amino acid sequence shown in SEQ ID NO.1 may be mutated to lysine, the aspartic acid at position 10 of the acyltransferase mutant with the amino acid sequence shown in SEQ ID NO.1 may be mutated to valine, and the aspartic acid at position 95 of the acyltransferase mutant with the amino acid sequence shown in SEQ ID NO.1 may be mutated to isoleucine.
[0031] Alternatively, the aspartic acid at position 62 of the acyltransferase mutant with the amino acid sequence shown in SEQ ID NO.1 may be mutated to arginine, the aspartic acid at position 10 of the acyltransferase mutant with the amino acid sequence shown in SEQ ID NO.1 may be mutated to valine, and the aspartic acid at position 95 of the acyltransferase mutant with the amino acid sequence shown in SEQ ID NO.1 may be mutated to isoleucine.
[0032] Alternatively, the threonine at position 64 of the acyltransferase mutant with the amino acid sequence shown in SEQ ID NO.1 may be mutated to asparagine, the aspartic acid at position 10 of the acyltransferase mutant with the amino acid sequence shown in SEQ ID NO.1 may be mutated to valine, and the aspartic acid at position 95 of the acyltransferase mutant with the amino acid sequence shown in SEQ ID NO.1 may be mutated to isoleucine.
[0033] The present invention also provides the application of the above-mentioned acyltransferase mutant, the above-mentioned recombinant cell, or the above-mentioned recombinase catalyst in the catalytic preparation of N-acetyl-trans-4-hydroxyproline from the substrate trans-4-hydroxy-L-proline.
[0034] In one embodiment of the present invention, the application involves adding the acyltransferase mutant, the recombinant cell, or the recombinase catalyst to a reaction system containing trans-4-hydroxy-L-proline and an acyl donor to prepare N-acetyl-trans-4-hydroxyproline.
[0035] In one embodiment of the present invention, the acyl donor is vinyl acetate.
[0036] In one embodiment of the present invention, the reaction system further contains a phosphate buffer solution.
[0037] In one embodiment of the present invention, the reaction system further contains surfactants and / or metal ions.
[0038] In one embodiment of the present invention, the surfactant is PEG 4000, Triton-X 100, Tween80, AEO-9 or DMSO;
[0039] Preferably, the surfactant is AEO-9.
[0040] In one embodiment of the present invention, the metal ion is Na. + Mn 2+ K + NH + Al 3+ Ca 2+ Cu 2+ Fe 2 + or Mg 2+ ;
[0041] Preferably, the metal ion is Mn. 2+ .
[0042] In one embodiment of the present invention, the application involves adding the acyltransferase mutant, the recombinant cell, or the recombinase catalyst to a reaction system containing trans-4-hydroxy-L-proline, an acyl donor, a surfactant, and metal ions to prepare N-acetyl-trans-4-hydroxyproline.
[0043] In one embodiment of the present invention, the final concentration of trans-4-hydroxy-L-proline in the system is 100~350 mM, the final concentration of the acyl donor in the system is 1~20% v / v, the final concentration of the surfactant in the system is 0.4~0.8 g / L, and the final concentration of the metal ion in the system is 0.4~1.0 mM.
[0044] In one embodiment of the invention, the application is to administer a solution containing 250 mM trans-4-hydroxy-L-proline, 10% (v / v) vinyl acetate, 0.4 g / L AEO-9, and 0.8 mM Mn. 2+ MsAcT mutant was added to a 100 mM phosphate buffer (pH 7.0) system to a final concentration of 0.4 mg / mL and reacted at 45 °C for 12 h.
[0045] The present invention also provides a method for preparing N-acetyl-trans-4-hydroxyproline from the substrate trans-4-hydroxy-L-proline. The method involves adding the acyltransferase mutant, the recombinant cell, or the recombinase catalyst to a reaction system containing trans-4-hydroxy-L-proline and an acyl donor to prepare N-acetyl-trans-4-hydroxyproline.
[0046] In one embodiment of the present invention, the acyl donor is vinyl acetate.
[0047] In one embodiment of the present invention, the reaction system further contains a phosphate buffer solution.
[0048] In one embodiment of the present invention, the reaction system further contains surfactants and / or metal ions.
[0049] In one embodiment of the present invention, the surfactant is PEG 4000, Triton-X 100, Tween80, AEO-9 or DMSO;
[0050] Preferably, the surfactant is AEO-9.
[0051] In one embodiment of the present invention, the metal ion is Na. + Mn 2+ K + NH+ Al 3+ Ca 2+ Cu 2+ Fe 2 + or Mg 2+ ;
[0052] Preferably, the metal ion is Mn. 2+ .
[0053] In one embodiment of the present invention, the method involves adding the acyltransferase mutant, the recombinant cell, or the recombinase catalyst to a reaction system containing trans-4-hydroxy-L-proline, an acyl donor, a surfactant, and metal ions to prepare N-acetyl-trans-4-hydroxyproline.
[0054] In one embodiment of the present invention, the final concentration of trans-4-hydroxy-L-proline in the system is 100~350 mM, the final concentration of the acyl donor in the system is 1~20% v / v, the final concentration of the surfactant in the system is 0.4~0.8 g / L, and the final concentration of the metal ion in the system is 0.4~1.0 mM.
[0055] In one embodiment of the present invention, the method comprises administering a solution containing 250 mM trans-4-hydroxy-L-proline, 10% (v / v) vinyl acetate, 0.4 g / L AEO-9, and 0.8 mM Mn. 2+ MsAcT mutant was added to a 100 mM phosphate buffer (pH 7.0) system to a final concentration of 0.4 mg / mL and reacted at 45 °C for 12 h.
[0056] The present invention also provides a method for increasing the yield or conversion rate of N-acetyl-trans-4-hydroxyproline, wherein the method comprises adding the acyltransferase mutant, the recombinant cell, or the recombinase catalyst to a reaction system containing trans-4-hydroxy-L-proline and an acyl donor to prepare N-acetyl-trans-4-hydroxyproline.
[0057] In one embodiment of the present invention, the acyl donor is vinyl acetate.
[0058] In one embodiment of the present invention, the reaction system further contains a phosphate buffer solution.
[0059] In one embodiment of the present invention, the reaction system further contains surfactants and / or metal ions.
[0060] In one embodiment of the present invention, the surfactant is PEG 4000, Triton-X 100, Tween80, AEO-9 or DMSO;
[0061] Preferably, the surfactant is AEO-9.
[0062] In one embodiment of the present invention, the metal ion is Na. + Mn 2+ K + NH + Al 3+ Ca 2+ Cu 2+ Fe 2 + or Mg 2+ ;
[0063] Preferably, the metal ion is Mn. 2+ .
[0064] In one embodiment of the present invention, the method involves adding the acyltransferase mutant, the recombinant cell, or the recombinase catalyst to a reaction system containing trans-4-hydroxy-L-proline, an acyl donor, a surfactant, and metal ions to prepare N-acetyl-trans-4-hydroxyproline.
[0065] In one embodiment of the present invention, the final concentration of trans-4-hydroxy-L-proline in the system is 100~350 mM, the final concentration of the acyl donor in the system is 1~20% v / v, the final concentration of the surfactant in the system is 0.4~0.8 g / L, and the final concentration of the metal ion in the system is 0.4~1.0 mM.
[0066] In one embodiment of the present invention, the method comprises administering a solution containing 250 mM trans-4-hydroxy-L-proline, 10% (v / v) vinyl acetate, 0.4 g / L AEO-9, and 0.8 mM Mn. 2+ MsAcT mutant was added to a 100 mM phosphate buffer (pH 7.0) system to a final concentration of 0.4 mg / mL and reacted at 45 °C for 12 h.
[0067] The present invention also provides the application of the above-mentioned mutants, genes, recombinant vectors, recombinant cells, recombinase catalysts, or methods in the fields of biomaterials, pharmaceuticals, or cosmetics.
[0068] Beneficial effects:
[0069] This invention, based on structural information and simulation calculations, employs PCR for site-directed saturation mutagenesis to ultimately obtain a MsAcT mutant with high acyltransferase activity. The acyltransferase mutant obtained in this invention exhibits higher acyltransferase activity and catalytic efficiency compared to the original enzyme before mutation, thus improving production efficiency. Among them, the mutant D62K / D10V / D95I shows the best performance, with an enzyme activity (AT:H) as high as 4.5; when catalyzing the substrate alone, its N-acetyl-trans-4-hydroxyproline yield reaches 8.76 g / L, an increase of 93.4% compared to the unmutated form; after adding surfactants and metal ions, its catalytic synthesis of N-acetyl-trans-4-hydroxyproline yield reaches as high as 12.71 g / L.
[0070] Therefore, the acyltransferase mutant of the present invention is of great significance in the efficient biosynthesis of N-acetyl-trans-4-hydroxyproline and has broad application prospects in the fields of biomaterials, medicine or cosmetics. Attached Figure Description
[0071] Figure 1 Image of agarose gel electrophoresis;
[0072] Figure 2 This is an SDS-PAGE image. Detailed Implementation
[0073] The technical solutions described below will be clearly and completely described with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the materials and reagents used in the embodiments can be obtained commercially.
[0074] Culture media and buffer solutions involved in the examples:
[0075] LB solid medium (1 L): 10 g tryptone, 5 g yeast extract, 10 g NaCl, 17 g agar powder.
[0076] LB liquid medium: 10 g tryptone, 5 g yeast extract, 10 g NaCl, dissolved in deionized water and brought to a final volume of 1000 mL.
[0077] Binding Buffer: Dissolve 17.54 g of NaCl and 6.00 g of NaH2PO4 in deionized water and bring the volume to 1000 mL. Adjust the pH to 8 with NaOH solution.
[0078] Elution buffers for different concentrations of imidazole: NaCl 29.22 g, Tris 2.42 g, imidazole 0.68 / 27.23 g (2 / 400 mM) were dissolved in deionized water and brought to a final volume of 1000 mL. The pH was then adjusted to 8 with hydrochloric acid.
[0079] Trans-4-hydroxy-L-proline, p-nitrophenyl acetate, AEO-9, and all reagents, consumables, and competent cells used were purchased from Sangon Biotech (Shanghai) Co., Ltd.
[0080] Example 1: Construction of a hydrophobic acyltransferase mutant
[0081] 1. Site-directed mutation strategy
[0082] Hydrophilic amino acid residues (non-catalytic triplet) in the active pocket of the acyltransferase MsAcT (S11C) (amino acid sequence SEQ ID NO.1) were selected for simulated saturation mutation at positions 10 and 95 (Asp). Mutating one or both sites yielded hydrophobic mutants. The binding energy after the virtual mutation was calculated, and mutants were ranked according to their binding energy, with the highest-ranking mutants selected. Three mutation modes were ultimately determined: D10V / D95I, D10V / D95W, and D10L / D95I (Table 1).
[0083] Table 1. Screening based on mutation binding energy
[0084]
[0085] 2. Construction of mutant recombinant plasmids
[0086] (1) The gene encoding the acyltransferase mutant MsAcT(S11C) with the amino acid sequence shown in SEQ ID NO.1 was chemically synthesized (the nucleotide sequence of the gene is shown in SEQ ID NO.2), wherein MsAcT(S11C) is obtained by mutating the serine at position 11 of the amino acid sequence of the wild-type acyltransferase MsAcT to cysteine.
[0087] (2) Construction of recombinant vector: Using the primers in Table 2, the acyltransferase MsAcT(S11C) sequence was ligated into the pET-22b(+) vector as the template for the target gene using the commercial plasmid pET22b as the backbone. Linearization amplification was performed using PCR technology. After linearization amplification, the target gene MsAcT(S11C) was ligated into the pET22b vector by incubating with One Step Seamless Cloning Mix homologous recombinase at 50 °C for 30 min, thus obtaining the recombinant vector pET-22b(+)-MsAcT(S11C).
[0088] Table 2 Primer Sequences
[0089]
[0090] (3) Using the nucleotide sequence of the recombinant plasmid pET-22b(+)-MsAcT(S11C) as a template, primers containing mutation sites were designed. The aspartic acid at position 10 of the acyltransferase mutant MsAcT(S11C) with the amino acid sequence shown in SEQ ID NO.1 was mutated to valine, and the aspartic acid at position 95 of the acyltransferase mutant MsAcT(S11C) with the amino acid sequence shown in SEQ ID NO.1 was mutated to isoleucine to obtain the MsAcT(S11C / D10V / D95I) mutant (or called the D10V / D95I mutant). The aspartic acid at position 10 of the acyltransferase mutant MsAcT(S11C) with the amino acid sequence shown in SEQ ID NO.1 was mutated to valine, and the aspartic acid at position 95 of the acyltransferase mutant MsAcT(S11C) with the amino acid sequence shown in SEQ ID NO.1 was mutated to isoleucine ... The aspartic acid at position 95 of the acyltransferase mutant MsAcT(S11C) shown in SEQ ID NO.1 was mutated to tryptophan to obtain the MsAcT(S11C / D10V / D95W) mutant (or D10V / D95W mutant). The aspartic acid at position 10 of the acyltransferase mutant MsAcT(S11C) shown in SEQ ID NO.1 was mutated to leucine, and the aspartic acid at position 95 of the acyltransferase mutant MsAcT(S11C) shown in SEQ ID NO.1 was mutated to isoleucine to obtain the MsAcT(S11C / D10L / D95I) mutant (or D10L / D95I mutant). The primer sequences are shown in Table 3.
[0091] Site-directed mutagenesis was performed using PCR to obtain recombinant plasmids pET-22b(+)-MsAcT(S11C / D10V / D95I), pET-22b(+)-MsAcT(S11C / D10V / D95W), and pET-22b(+)-MsAcT(S11C / D10L / D95I).
[0092] The PCR reaction system is shown in Table 4. The PCR reaction conditions are: 98 ℃ for 30 s; 98 ℃ for 10 s, 58 ℃ for 5 s, 72 ℃ for 3 min, for a total of 30 cycles; 72 ℃ for 2 min; and stored at 4 ℃.
[0093] Detection of PCR products using 1% agarose gel electrophoresis ( Figure 1The PCR product was transformed into E. coli JM109 competent cells. Positive transformants were selected, plasmids were extracted, and sequencing was performed to verify the results. Finally, three mutants were successfully constructed: E. coli-JM09-MsAcT (S11C / D10V / D95I), E. coli-JM09-MsAcT (S11C / D10V / D95W), and E. coli-JM09-MsAcT (S11C / D10L / D95I).
[0094] Table 3 Primers
[0095]
[0096] Table 4 PCR reaction system
[0097]
[0098] Example 2: Expression Analysis and Purification of Acyltransferase Mutant Proteins
[0099] 1. Acyltransferase mutant protein induced expression
[0100] The recombinant plasmids pET-22b(+)-MsAcT(S11C), pET-22b(+)-MsAcT(S11C / D10V / D95I), pET-22b(+)-MsAcT(S11C / D10V / D95W), and pET-22b(+)-MsAcT(S11C / D10L / D95I) obtained in Example 1 were transformed into E. coli C43(DE3) competent cells that highly express hydrophobic proteins using the heat shock method. This yielded recombinant E. coli containing the MsAcT(S11C) recombinant plasmid or its mutant plasmid, namely E. coli-DE3-MsAcT(S11C), E. coli-DE3-MsAcT(S11C / D10V / D95I), and E. coli-DE3-MsAcT(S11C / D10V / D95I), respectively. MsAcT (S11C / D10V / D95W), E.coli-DE3- MsAcT (S11C / D10L / D95I).
[0101] The three successfully constructed recombinant Escherichia coli strains were inoculated into 4 mL of LB liquid medium containing ampicillin (100 μg / mL) for activation and cultured at 37 ℃ and 200 rpm for 12 h. Then, they were inoculated into 50 mL of LB liquid medium at a 1% (v / v) inoculation rate and cultured at 37 ℃ and 220 rpm for 3-4 h until OD (Organic Demand). 600=0.6-0.8; Add 250 μM IPTG (isopropyl-β-D-thiogalactopyranoside), and induce at 16 ℃, 220 rpm for 16 h. Centrifuge the fermentation broth at 4 ℃, 5000 rpm for 5 min to collect the cells; resuspend the cells in 20 mL Binding Buffer (50 mM NaH2PO4, 300 mM NaCl, pH 8.0); disrupt the cells using an ultrasonic cell disruptor for 20 min under ice-water bath conditions (45% power, 2 s sonication, 2 s interval); centrifuge at 4 ℃, 10000 rpm for 40 min, and use the supernatant as crude enzyme. Take 15 μL of crude enzyme into a 1.5 mL centrifuge tube, mix with 5 μL of 5×SDS PAGE loading buffer, incubate at 100 ℃ for 10 min, and immediately perform SDS-PAGE analysis. The results are shown in the figure. Figure 2 As shown.
[0102] 2. Protein purification
[0103] The crude enzyme obtained in step 1 was filtered through a 0.22 μm filter and loaded onto a pre-equilibrated nickel column. First, non-specifically binding proteins were eluted with 10 column volumes of elution buffer (2 mM imidazole). Then, the target protein was eluted with 3 column volumes of elution buffer (400 mM imidazole). The purified protein solution was incubated at 4 °C and dialyzed overnight in 100 mM phosphate buffer (pH 7.0) to remove imidazole, yielding the purified enzyme solution, which was then stored at 4 °C. Finally, the protein concentration was determined using the Bradford method, and the protein purity was detected by 10% SDS-PAGE gel electrophoresis.
[0104] Four types of purified enzyme solutions were finally obtained: one containing MsAcT (S11C), one containing MsAcT (S11C / D10V / D95I), one containing MsAcT (S11C / D10V / D95W), and one containing MsAcT (S11C / D10L / D95I).
[0105] Example 3: Acyltransferase activity (AT:H) determination of acyltransferase mutants
[0106] The hydrolase and acyltransferase activities of the MsAcT mutant were determined using the p-nitrophenyl acyltransferase (pNP-AcT) method. Hydrolase activity was assessed by monitoring the release of p-nitrophenol from p-nitrophenyl ester at 405 nm. Upon addition of methanol, acyltransferase activity was determined by increasing the release of p-nitrophenol (pNP). The acetylation activity of the mutant was reflected by the ratio of acyltransferase activity (AT) to hydrolase activity (H) (AT:H).
[0107] The experiment was conducted at 25 °C, with a reaction scale of 1 mL.
[0108] Hydrolytic enzyme activity test group: p-nitrophenyl acetate (final concentration 1 mM), benzyl alcohol (final concentration 10 mM), purified enzyme solution containing MsAcT(S11C) or MsAcT(S11C / D10V / D95I) or MsAcT(S11C / D10V / D95W) or MsAcT(S11C / D10L / D95I) (final concentration 0.1 mg / L) obtained in Example 2, 200 mM potassium phosphate buffer (pH 7.5) and DMSO with a final concentration of 0.1% (v / v) were added to each well in sequence.
[0109] Acyltransferase activity experimental group: Based on the hydrolytic enzyme activity experimental group, benzyl alcohol with a final concentration of 10 mM was added;
[0110] Control group: Add p-nitrophenyl acetate (final concentration 1 mM), benzyl alcohol (final concentration 10 mM), 200 mM potassium phosphate buffer (pH 7.5), and DMSO to each well in sequence.
[0111] After reacting for 15 min in the above three groups, 200 μL was added to each well of a 96-well plate, and the absorbance A of each well in the three groups was measured using a microplate reader at a wavelength of 405 nm. 405 Calculate the amount of pNP generated by p-nitrophenol. The formula for calculating acyltransferase activity (AT:H) is as follows:
[0112] AT:H = (n2-n0) / (n1-n0)
[0113] Where n0, n1, and n2 represent the amount of pNP generated (i.e., absorbance A) in the Control group, the hydrolase activity experimental group, and the acyltransferase activity experimental group, respectively. 405 ).
[0114] The results of the acyltransferase activity assay for the acyltransferase mutant are shown in Table 5. Compared with MsAcT(S11C), the AT:H of the mutant D10V / D95I was significantly increased, and it was further applied (Table 5).
[0115] Table 5. Acyltransferase activity (AT:H) determination of acyltransferase mutants
[0116]
[0117] Example 4: Acyltransferase mutant catalyzes the synthesis of N-acetyl-trans-4-hydroxyproline
[0118] The reaction volume is 1 mL.
[0119] Experimental group: Add trans-4-hydroxy-L-proline to 100 mM phosphate buffer (pH 7.0) at a final concentration of 250 mM, 10% (v / v) vinyl acetate, and then add the purified enzyme solution containing MsAcT(S11C) or MsAcT(S11C / D10V / D95I) or MsAcT(S11C / D10V / D95W) or MsAcT(S11C / D10L / D95I) obtained in Example 2 at a final concentration of 0.4 mg / mL.
[0120] Control group: Add trans-4-hydroxy-L-proline to a final concentration of 250 mM and 10% (v / v) vinyl acetate to 100 mM phosphate buffer (pH 7.0).
[0121] After reacting the above solution at 45 °C for 12 h, a sample was taken, and 4 times the volume of methanol was added to the sample and mixed well. The mixture was allowed to stand at -20 °C for 4 h, then centrifuged at 4 °C and 12000 rpm for 5 min. The supernatant was collected for detection by high performance liquid chromatography.
[0122] The HPLC detection conditions for N-acetyl-trans-4-hydroxyproline were as follows: An Agilent HPLC system was used, with liquid phase separation performed through a Diamond C-18 column (4.6 × 250 mm). The flow rate was 0.8 mL / min, mobile phase A was 2% methanol aqueous solution, and mobile phase B was 2% methanol and 0.1% phosphoric acid aqueous solution. The column temperature was 25 °C, and the detection wavelength was 205 nm. A single sample was run for 20 min.
[0123] The results of N-acetyl-trans-4-hydroxyproline production determination of acyltransferase mutants are shown in Table 6. Compared with the original enzyme MsAcT (S11C), the N-acetyl-trans-4-hydroxyproline production of mutant D10V / D95I was significantly increased to 6.27 g / L.
[0124] Table 6. Determination of N-acetyl-trans-4-hydroxyproline yield in acyltransferase mutants.
[0125]
[0126] Example 5: Construction, expression, purification, and AT:H determination of combinatorial mutants
[0127] 1. Construction strategy of combined mutants
[0128] Based on the results of Examples 1-4 above, the mutant D10V / D95I significantly improved AT:H, and the combination of multiple beneficial single-point mutations could produce a cumulative or synergistic effect on catalytic activity. Previous studies found that mutations at positions 62 and 64 significantly increased the activity of the acyltransferase MsAcT (S11C). Therefore, three further combined mutants were constructed: mutants T64N / D10V / D95I, D62R / D10V / D95I, and D62K / D10V / D95I, specifically:
[0129] The aspartic acid at position 62 of the acyltransferase mutant MsAcT(S11C) with the amino acid sequence shown in SEQ ID NO.1 is mutated to lysine, the aspartic acid at position 10 of the acyltransferase mutant MsAcT(S11C) with the amino acid sequence shown in SEQ ID NO.1 is mutated to valine, and the aspartic acid at position 95 of the acyltransferase mutant MsAcT(S11C) with the amino acid sequence shown in SEQ ID NO.1 is mutated to isoleucine, resulting in the MsAcT(S11C / D62K / D10V / D95I) mutant (or D62K / D10V / D95I mutant).
[0130] The aspartic acid at position 62 of the acyltransferase mutant MsAcT(S11C) with the amino acid sequence shown in SEQ ID NO.1 is mutated to arginine, the aspartic acid at position 10 of the acyltransferase mutant MsAcT(S11C) with the amino acid sequence shown in SEQ ID NO.1 is mutated to valine, and the aspartic acid at position 95 of the acyltransferase mutant MsAcT(S11C) with the amino acid sequence shown in SEQ ID NO.1 is mutated to isoleucine, resulting in the MsAcT(S11C / D62R / D10V / D95I) mutant (or D62R / D10V / D95I mutant).
[0131] The threonine at position 64 of the acyltransferase mutant MsAcT(S11C) with the amino acid sequence as shown in SEQ ID NO.1 was mutated to asparagine. At the same time, the aspartic acid at position 10 of the acyltransferase mutant MsAcT(S11C) with the amino acid sequence as shown in SEQ ID NO.1 was mutated to valine. At the same time, the aspartic acid at position 95 of the acyltransferase mutant MsAcT(S11C) with the amino acid sequence as shown in SEQ ID NO.1 was mutated to isoleucine, resulting in the MsAcT(S11C / T64N / D10V / D95I) mutant (or T64N / D10V / D95I mutant).
[0132] 2. Construction, expression, and purification of combinatorial mutants
[0133] Using the recombinant plasmid pET-22b(+)-MsAcT(S11C / D10V / D95I) obtained in Example 1 as a template, the above mutants were amplified and constructed using the primer sequences shown in Table 7.
[0134] The PCR products were detected by 1% agarose gel electrophoresis. The successfully sequenced recombinant plasmids pET-22b(+)-T64N / D10V / D95I, pET-22b(+)-D62R / D10V / D95I, and pET-22b(+)-D62K / D10V / D95I were transformed into E. coli C43(DE3) chemocompetent cells. The specific implementation methods for inducing expression and protein purification were the same as in Example 2.
[0135] SDS-PAGE electrophoresis was used to detect protein expression. All mutant combinations were able to achieve soluble expression, and the proteins were successfully purified by nickel column affinity chromatography.
[0136] Three purified enzyme solutions were finally obtained: one containing MsAcT (S11C / D62K / D10V / D95I), one containing MsAcT (S11C / D62R / D10V / D95I), and one containing MsAcT (S11C / T64N / D10V / D95I).
[0137] Table 7 Primers
[0138]
[0139] 3. AT:H determination of combined mutants
[0140] Using pNP-AcT as a substrate, the acyltransferase activity of different combinations of mutant enzyme solutions obtained in step 2 above was determined, with the specific implementation method being the same as in Example 3.
[0141] The results are shown in Table 8. Compared with MsAcT(S11C), the enzyme activity of all mutants was improved. Among them, the three-point combination mutant D62K / D10V / D95I had the highest acyltransferase activity, which was about 2.4 times higher than that of MsAcT(S11C).
[0142] Table 8. Acyltransferase activity (AT:H) determination of acyltransferase mutants
[0143]
[0144] Example 6: Synthesis of N-acetyl-trans-4-hydroxyproline catalyzed by combinatorial mutants
[0145] The yield of N-acetyl-trans-4-hydroxyproline catalyzed by the combined mutant was determined using purified enzyme solutions containing MsAcT(S11C / D62K / D10V / D95I), MsAcT(S11C / D62R / D10V / D95I), and MsAcT(S11C / T64N / D10V / D95I) obtained in step 2 of Example 5. The determination method was the same as in Example 4.
[0146] The conversion rate of N-acetyl-trans-4-hydroxyproline is calculated as follows:
[0147] N-acetyl-trans-4-hydroxyproline conversion rate = (Actual molar amount of N-acetyl-trans-4-hydroxyproline in the system) / (Consumed amount of trans-4-hydroxy-L-proline in the system) * 100%
[0148] The results of synthesizing N-acetyl-trans-4-hydroxyproline using trans-4-hydroxy-L-proline and vinyl acetate as substrates are shown in Table 9. Among them, D62K / D10V / D95I had the highest yield of 13.62 g / L, which was 148% higher than that of D62K / D10V.
[0149] Table 9. Determination of N-acetyl-trans-4-hydroxyproline yield in acyltransferase mutants.
[0150]
[0151] Example 7: Synthesis of N-acetyl-trans-4-hydroxyproline by adding different surfactants
[0152] The effects of surfactant type and concentration on the synthesis of N-acetyl-trans-4-hydroxyproline were investigated.
[0153] 1. The reaction scale is 1 mL. Add trans-4-hydroxy-L-proline to a final concentration of 250 mM and 10% (v / v) vinyl acetate to 100 mM phosphate buffer (pH 7.0), then add the purified enzyme solution containing MsAcT (S11C / D62K / D10V / D95I) obtained in step 2 of Example 5 to a final concentration of 0.4 mg / mL, and then add PEG4000, Tween 80, Triton-X 100, AEO-9 or DMSO to a final concentration of 1 g / L.
[0154] After reacting the above solution at 45 °C for 12 h, a sample was taken, and 4 times the volume of methanol was added to the sample and mixed well. The mixture was allowed to stand at -20 °C for 4 h, and then centrifuged at 4 °C and 12000 rpm for 5 min. The supernatant was collected and used for high performance liquid chromatography to detect the yield of synthesized N-acetyl-trans-4-hydroxyproline.
[0155] The HPLC detection conditions for N-acetyl-trans-4-hydroxyproline were as follows: An Agilent HPLC system was used, with liquid phase separation performed through a Diamond C-18 column (4.6 × 250 mm). The flow rate was 0.8 mL / min, mobile phase A was 2% methanol aqueous solution, and mobile phase B was 2% methanol and 0.1% phosphoric acid aqueous solution. The column temperature was 25 °C, and the detection wavelength was 205 nm. A single sample was run for 20 min.
[0156] The conversion rate of N-acetyl-trans-4-hydroxyproline is calculated as follows:
[0157] N-acetyl-trans-4-hydroxyproline conversion rate = (Actual molar amount of N-acetyl-trans-4-hydroxyproline in the system) / (Consumed amount of trans-4-hydroxy-L-proline in the system) * 100%
[0158] The results showed that the addition of AEO-9 had the most significant effect on the synthesis of N-acetyl-trans-4-hydroxyproline (Table 10).
[0159] Table 10. Yield determination of N-acetyl-trans-4-hydroxyproline synthesized with different surfactants
[0160]
[0161] 2. The reaction scale is 1 mL. Add trans-4-hydroxy-L-proline to a final concentration of 250 mM and 10% (v / v) vinyl acetate to 100 mM phosphate buffer (pH 7.0), then add the purified enzyme solution containing MsAcT (S11C / D62K / D10V / D95I) obtained in step 2 of Example 5 to a final concentration of 0.4 mg / mL, and then add AEO-9 to a final concentration of 0 g / L, 0.1 g / L, 0.2 g / L, 0.4 g / L, 0.6 g / L, 0.8 g / L or 1 g / L.
[0162] The methods for detecting the yield and conversion rate of synthesized N-acetyl-trans-4-hydroxyproline are the same as those in step 1 above.
[0163] Table 11 shows that the addition of 0.8 g / L AEO-9 had the most significant effect on the synthesis of N-acetyl-trans-4-hydroxyproline, with a yield of 17.2 g / L and a conversion rate of 86.2%.
[0164] Table 11. Determination of the yield of N-acetyl-trans-4-hydroxyproline synthesized with different AEO-9 addition amounts
[0165]
[0166] Example 8: Synthesis of N-acetyl-trans-4-hydroxyproline by adding different metal ions
[0167] The effects of metal ions and their concentrations on the synthesis of N-acetyl-trans-4-hydroxyproline were investigated.
[0168] 1. The reaction scale is 1 mL. Add trans-4-hydroxy-L-proline to a final concentration of 250 mM and 10% (v / v) vinyl acetate to 100 mM phosphate buffer (pH 7.0), then add the purified enzyme solution containing MsAcT (S11C / D62K / D10V / D95I) obtained in step 2 of Example 5 to a final concentration of 0.4 mg / mL. Then add Na... + Mn 2+ K + NH + Al 3+ Ca 2+ Cu 2+ Fe 2+ Mg 2+ The chloride salt was used to make the final concentration of metal ions in the system 1 mM.
[0169] The method for detecting the yield and conversion rate of synthesized N-acetyl-trans-4-hydroxyproline is the same as step 1 in Example 7 above.
[0170] Table 12 shows the results: Mn 2+ The addition had the most significant effect on the synthesis of N-acetyl-trans-4-hydroxyproline.
[0171] Table 12. Yield determination of N-acetyl-trans-4-hydroxyproline synthesized with different metal ions
[0172]
[0173] 2. The reaction scale is 1 mL. Add trans-4-hydroxy-L-proline to a final concentration of 250 mM and 10% (v / v) vinyl acetate to 100 mM phosphate buffer (pH 7.0), then add the purified enzyme solution containing MsAcT (S11C / D62K / D10V / D95I) obtained in step 2 of Example 5 to a final concentration of 0.4 mg / mL. Finally, add Mn to final concentrations of 0 mM, 0.1 mM, 0.2 mM, 0.4 mM, 0.6 mM, 0.8 mM, and 1 mM. 2+ .
[0174] The method for detecting the yield and conversion rate of synthesized N-acetyl-trans-4-hydroxyproline is the same as step 1 in Example 7 above.
[0175] The results showed that: 1 mM Mn 2+ The addition had the most significant effect on the synthesis of N-acetyl-trans-4-hydroxyproline, with a yield of 12.31 g / L and a conversion rate of 86% (Table 13).
[0176] Table 13 Different Mn 2+ Determination of the yield of N-acetyl-trans-4-hydroxyproline by adding amount
[0177]
[0178] Example 9: AEO-9 and Mn 2+ Compound addition of synthetic N-acetyl-trans-4-hydroxyproline
[0179] Mn was measured at final concentrations of 0, 0.1, 0.2, 0.4, 0.6, 0.8, and 1.0 g / LAEO-9 and at final concentrations of 0, 0.2, 0.4, 0.6, 0.8, 1.0, and 1.2 mM, respectively. 2+ The effect of complex pairing on the synthesis of N-acetyl-trans-4-hydroxyproline.
[0180] The reaction scale was 1 mL. Trans-4-hydroxy-L-proline to a final concentration of 250 mM and 10% (v / v) vinyl acetate were added to 100 mM phosphate buffer (pH 7.0). Then, purified enzyme solution containing MsAcT (S11C / D62K / D10V / D95I) obtained in step 2 of Example 5 was added to a final concentration of 0.4 mg / mL. Different concentrations of AEO-9 and different concentrations of Mn were then added. 2+ Chloride salts, AEO-9 and Mn 2+ The addition strategy is shown in Table 13.
[0181] The method for detecting the yield and conversion rate of synthesized N-acetyl-trans-4-hydroxyproline is the same as step 1 in Example 7 above.
[0182] The results are shown in Table 14. 0.4 g / L AEO-9 and 0.8 mM Mn 2+ The addition of [a specific ingredient] had the most significant impact on the synthesis of N-acetyl-trans-4-hydroxyproline, with a yield of 14.27 g / L, which was higher than that achieved by adding AEO-9 and Mn alone. 2+ The conversion rates were increased by 114% and 116% respectively; the conversion rate of trans-4-hydroxy-L-proline reached 91%, which was higher than that of adding AEO-9 and Mn alone. 2+ They increased by 102% and 106% respectively.
[0183] Table 14 AEO-9 and Mn 2+ Complex to form N-acetyl-trans-4-hydroxyproline
[0184]
[0185] Note: Results are presented as “N-acetyl-trans-4-hydroxyproline yield / conversion”.
[0186] The sequence involved in this invention is shown below:
[0187] SEQ ID NO.1:
[0188] MAKRILCFGDCLTWGWVPVEDGAPTERFAPDVRWTGVLAQQLGADFEVIEEGLSARTTNIDDPTDPRLNGASYLPSCLATHLPLDLVIIMLGTNDTKAYFRRTPLDIALGMSVLVTQVLTSAGGVGTTYPAPKVLVVSPPPLAPMPHPWFQLIFEGGEQKTTELARVYSALASFMKVPFFDAGSVISTDGVDGIHFTEANNRDLGVALAEQVRSLL
[0189] SEQ ID NO.2:
[0190] ATGGCCAAACGCATCTTATGTTTCGGAGACtgcCTGACTTGGGGATGGGTTCCCGTGGAAGACGGTGCTCCTACTGAACGCTTTGCGCCAGATGTACGCTGGACCGGCGTATTAGCTCAGCAGTTAGGCGCTGACTTTGAAGTCATTGAGGAAGGTTTGTCT GCCCGTACGACAAACATCGATTCCCCACCGACCCGGTTTGAATGGAGCGAGCTATCTTCCCTCGTGCCTGGCAACTCACTTACCGCTGGATCTTGTTTATTATCATGTTGGGCACAAACGACACCAAGGCGTATTTCCGCCGCCACACCCCTTGATATTGCA CTTGGGATGTCGGTGCTTGTCACACAGGTCTTGACATCCGCGGGGGGAGTAGGCACGACATATCCCGCACCGAAAGTATTAGTCGTTCCGCCTCCTCCCTTGGACCCATGCCTCACCCCTGGTTTCAACTGATTTTTGAGGGCGGAGAAACAAAAGACAACGGAACTTGCCCGTGTGATTCAGCCTGGCTTCGTTATGAAAGTCCCGTTCTTTGATGCCGGTAGCGTGATCAGTACAGACGGCGTAGATGGTATCACTTTACGGAGGCCAATAACCGTGATCTGGGGTGGCACTGGGGCAAGTTCGCTCACTTT
[0191] SEQ ID NO.3:
[0192] MAKRILCFGVCLTWGWVPVEDGAPTERFAPDVRWTGVLAQQLGADFEVIEEGLSARTTNIDKPTDPRLNGASYLPSCLATHLPLDLVIIMLGTNITKAYFRRTPLDIALGMSVLVTQVLTSAGGVGTTYPAPKVLVVSPPPLAPMHPWFQLIFEGGEQKTTELARVYSALASFMKVPFFDAGSVISTDGVDGIHFTEANNRDLGVALAEQVRSLL
[0193] SEQ ID NO.4:
[0194] ATGGCCAAACGCATCTTATGTTTCGGAGtttgcCTGACTTGGGGATGGGTTCCCGTGGAAGACGGTGCTCCTACTGAACGCTTTGCGCCAGATGTACGCTGGACCGGCGTATTAGCTCAGCAGTTAGGCGCTGACTTTGAAGTCATTGAGGAAGGTTTGTCT GCCCGTACGACAAACATCGATaaaaCCCACCGACCCGCGTTTGAATGGAGCGAGCTATCTTCCCTCGTGCCTGGCAACTCACTTACCGCTGGATCTTGTTATTATCATGTTGGGCACAAACatTACCAAGGCGTATTTCCGCCGCACACCCCTTGATATTGCA CTTGGGATGTCGGTGCTTGTCACACAGGTCTTGACATCCGCGGGGGGAGTAGGCACGACATATCCCGCACCGAAAGTATTAGTCGTCTCGCCTCCTCCCTTGGCACCCATGCCTCACCCCTGGTTTCAACTGATTTTTGAGGGCGGAGAACAAAAGACAACG GAACTTGCCCGTGTGTATTCAGCGCTGGCTTCGTTTATGAAAGTCCCGTTCTTTGATGCCGGTAGCGTGATCAGTACAGACGGCGTAGATGGTATCCACTTTACGGAGGCCAATAACCGTGATCTGGGGGTGGCACTGGCGGAGCAAGTTCGCTCACTTTTA
[0195] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.
Claims
1. An acyltransferase mutant, characterized in that, The acyltransferase mutant is obtained by mutating aspartic acid at position 10 of the acyltransferase mutant with amino acid sequence as shown in SEQ ID NO.1 to valine, and simultaneously mutating aspartic acid at position 95 of the acyltransferase mutant with amino acid sequence as shown in SEQ ID NO.1 to isoleucine. Alternatively, the aspartic acid at position 62 of the acyltransferase mutant with the amino acid sequence shown in SEQ ID NO.1 may be mutated to lysine, while the aspartic acid at position 10 of the acyltransferase mutant with the amino acid sequence shown in SEQ ID NO.1 may be mutated to valine, and the aspartic acid at position 95 of the acyltransferase mutant with the amino acid sequence shown in SEQ ID NO.1 may be mutated to isoleucine. Alternatively, the aspartic acid at position 62 of the acyltransferase mutant with the amino acid sequence shown in SEQ ID NO.1 may be mutated to arginine, while the aspartic acid at position 10 of the acyltransferase mutant with the amino acid sequence shown in SEQ ID NO.1 may be mutated to valine, and the aspartic acid at position 95 of the acyltransferase mutant with the amino acid sequence shown in SEQ ID NO.1 may be mutated to isoleucine. Alternatively, the threonine at position 64 of the acyltransferase mutant with the amino acid sequence shown in SEQ ID NO.1 may be mutated to asparagine, while the aspartic acid at position 10 of the acyltransferase mutant with the amino acid sequence shown in SEQ ID NO.1 may be mutated to valine, and the aspartic acid at position 95 of the acyltransferase mutant with the amino acid sequence shown in SEQ ID NO.1 may be mutated to isoleucine.
2. A gene encoding the acyltransferase mutant of claim 1 or a recombinant vector carrying the gene.
3. A recombinant cell expressing the acyltransferase mutant of claim 1 or carrying the gene of claim 2 or the recombinant vector.
4. A recombinant enzyme catalyst containing the acyltransferase mutant sequence of claim 1, characterized in that, The catalyst is any of the following forms: (1) Culture the recombinant expression transformant, isolate the transformant cells expressing the recombinant enzyme containing the acyltransferase mutant sequence of claim 1, and obtain the recombinant enzyme catalyst; (2) Cultivate recombinant expression transformants, isolate transformant cells expressing recombinant enzyme containing the acyltransferase mutant sequence of claim 1, break the transformant cells expressing recombinant enzyme, obtain cell lysate, and obtain the recombinant enzyme catalyst; (3) Cultivate recombinant expression transformants, isolate transformant cells expressing recombinant enzyme containing the acyltransferase mutant sequence of claim 1, break the transformant cells expressing recombinant enzyme to obtain cell lysate, freeze-dry the cell lysate to obtain lyophilized enzyme powder, and obtain the recombinant enzyme catalyst.
5. A method for increasing the acyltransferase AT:H, characterized in that, The method involves mutating aspartic acid at position 10 of the acyltransferase mutant with the amino acid sequence shown in SEQ ID NO.1 to valine, and simultaneously mutating aspartic acid at position 95 of the acyltransferase mutant with the amino acid sequence shown in SEQ ID NO.1 to isoleucine. Alternatively, the aspartic acid at position 62 of the acyltransferase mutant with the amino acid sequence shown in SEQ ID NO.1 may be mutated to lysine, the aspartic acid at position 10 of the acyltransferase mutant with the amino acid sequence shown in SEQ ID NO.1 may be mutated to valine, and the aspartic acid at position 95 of the acyltransferase mutant with the amino acid sequence shown in SEQ ID NO.1 may be mutated to isoleucine. Alternatively, the aspartic acid at position 62 of the acyltransferase mutant with the amino acid sequence shown in SEQ ID NO.1 may be mutated to arginine, the aspartic acid at position 10 of the acyltransferase mutant with the amino acid sequence shown in SEQ ID NO.1 may be mutated to valine, and the aspartic acid at position 95 of the acyltransferase mutant with the amino acid sequence shown in SEQ ID NO.1 may be mutated to isoleucine. Alternatively, the threonine at position 64 of the acyltransferase mutant with the amino acid sequence shown in SEQ ID NO.1 may be mutated to asparagine, the aspartic acid at position 10 of the acyltransferase mutant with the amino acid sequence shown in SEQ ID NO.1 may be mutated to valine, and the aspartic acid at position 95 of the acyltransferase mutant with the amino acid sequence shown in SEQ ID NO.1 may be mutated to isoleucine. Wherein, AT:H is the ratio of acyltransferase activity to hydrolytic activity.
6. The use of the acyltransferase mutant of claim 1, the recombinant cell of claim 3, or the recombinase catalyst of claim 4 in the preparation of N-acetyl-trans-4-hydroxyproline from the substrate trans-4-hydroxy-L-proline.
7. The application according to claim 6, characterized in that, The application involves adding the acyltransferase mutant, the recombinant cell, or the recombinase catalyst to a reaction system containing trans-4-hydroxy-L-proline and an acyl donor to prepare N-acetyl-trans-4-hydroxyproline. The acyl donor is vinyl acetate; the reaction system also contains phosphate buffer; and the reaction system also contains surfactant and / or metal ions.
8. The application according to claim 7, characterized in that, The surfactant is PEG 4000, Triton-X100, Tween 80, AEO-9 or DMSO.
9. The application according to claim 8, characterized in that, The surfactant is AEO-9.
10. The application according to claim 7, characterized in that, The metal ion is Na. + Mn 2+ K + NH + Al 3+ Ca 2 + Cu 2+ Fe 2+ or Mg 2+ .
11. The application according to claim 10, characterized in that, The metal ion is Mn. 2+ .
12. The application according to any one of claims 6 to 11, characterized in that, The application involves adding the acyltransferase mutant, the recombinant cell, or the recombinase catalyst to a compound containing trans-4-hydroxy-L-proline, vinyl acetate, AEO-9, and Mn. 2+ The reaction was carried out in the reaction system to prepare N-acetyl-trans-4-hydroxyproline.
13. The application according to claim 12, characterized in that, The final concentration of trans-4-hydroxy-L-proline in the system is 100~350 mM, the final concentration of vinyl acetate in the system is 1~20% v / v, the final concentration of AEO-9 in the system is 0.4~0.8 g / L, and the final concentration of Mn is... 2+ The final concentration in the system is 0.4~1.0 mM.
14. A method for increasing the yield or conversion rate of N-acetyl-trans-4-hydroxyproline, characterized in that, The method involves adding the acyltransferase mutant of claim 1, the recombinant cell of claim 3, or the recombinase catalyst of claim 4 to a reaction system containing trans-4-hydroxy-L-proline and an acyl donor to prepare N-acetyl-trans-4-hydroxyproline.
Citation Information
Patent Citations
Mycobacterium smegmatis acyltransferase mutant capable of being efficiently coupled with glucose oxidase as well as preparation method and application of mycobacterium smegmatis acyltransferase mutant
CN115806952A
Acyltransferase mutant with improved enzyme activity
CN117586979A