Uvsy protein mutants and uses thereof

Abstract

The present disclosure provides a UvsY protein mutant having a mutation at one or more of the amino acids corresponding to position 29, 73, 74, 81, 99, 119, 126, 128, 132 of SEQ ID NO: 4, relative to a wild-type UvsY protein. The UvsY protein mutant of the present disclosure significantly improves its yield, solubility, stability and / or its activity in recombinase polymerase isothermal amplification (RPA) technology, compared to the wild-type UvsY protein.

Description

TECHNICAL FIELD

[0001] The present disclosure belongs to the field of genetic engineering, and particularly relates to UvsY protein mutants and applications thereof. BACKGROUND

[0002] Recombinase Polymerase Amplification (RPA) has become an important nucleic acid amplification technology since it was developed by TwistDx in 2006. Compared with the traditional Polymerase Chain Reaction (PCR) technology, RPA has significant advantages. First, RPA does not require a high-temperature denaturation step and can be performed at a constant temperature of 37-42°C, which makes it easier to operate and avoids the thermal cycling steps in PCR, significantly improving the reaction speed. The RPA amplification process is usually completed within 20-30 minutes, and is comparable to PCR in terms of sensitivity and specificity. Therefore, RPA technology has been widely used in nucleic acid detection, on-site diagnosis and other fields.

[0003] The core of RPA technology is the synergistic effect of recombinase and DNA polymerase, which can effectively amplify DNA templates at room temperature. Coenzyme UvsY is a key recombinase in RPA reaction, which participates in the formation and stabilization of presynaptic filaments and lays the foundation for the function of UvsX recombinase. However, in practical applications, the use of T4 UvsY protein still faces many challenges, which affects its application effect in RPA.

[0004] First, the expression yield of T4 UvsY protein is generally low. Due to its own nature and expression conditions in the recombinant system, the expression efficiency of T4 UvsY protein in common host systems such as Escherichia coli is low, and it is mostly expressed in inclusion bodies, which results in a protein yield that cannot meet the efficient experimental demand. Low yield not only limits its wide application, but also increases the cost of protein purification and subsequent use.

[0005] Second, T4 UvsY protein has poor solubility. Low solubility makes the protein easily form aggregates or precipitate during purification, which seriously affects the recovery and functional activity of the protein, especially during the freeze-drying preparation process, the poor stability and solubility of the protein further exacerbate these problems. Therefore, the poor freeze-drying preparation effect caused by low solubility not only increases the difficulty of the preparation process, but also affects the long-term preservation and transportation of the protein.

[0006] In addition, the stability of the T4 UvsY protein needs to be improved. During storage and transportation, the protein is prone to degradation or inactivation, reducing its activity in RPA reactions. Although the T4 UvsY protein can effectively participate in RPA amplification under standard conditions, its insufficient stability makes it difficult to maintain its long-term functionality in actual operation, especially under high temperature or long-term storage conditions, the activity will rapidly decrease.

[0007] Therefore, although RPA technology shows superior performance in nucleic acid amplification, due to the insufficient yield, solubility, stability and activity of T4 UvsY protein, its effect and stability in large-scale application are limited. In view of these problems, it is urgent to optimize T4 UvsY protein through protein engineering means to improve its performance in RPA and promote its more extensive application. SUMMARY

[0008] The present disclosure significantly improves the yield, solubility, stability or activity of the T4 UvsY protein in the recombinase polymerase isothermal amplification technology (RPA) by mutating and optimizing the T4 UvsY protein, thereby overcoming the deficiencies in the prior art and promoting the widespread use of the protein in practical applications.

[0009] One aspect of the present disclosure provides a UvsY protein mutant, which has a mutation at one or more of the amino acids corresponding to positions 29, 73, 74, 81, 99, 119, 126, 128, 132 of SEQ ID NO: 4, relative to the wild-type UvsY protein.

[0010] In some embodiments, the UvsY protein mutant comprises one or more of the mutations V29P, F73P, S74F, S81K, S81R, S99K, S119F, S119R, S119W, H126W, Q128I, A132K.

[0011] In some embodiments, the UvsY protein mutant comprises F73P+V29P mutations. In some embodiments, the UvsY protein mutant comprises F73P+A132K mutations. In some embodiments, the UvsY protein mutant comprises F73P+S119F mutations. In some embodiments, the UvsY protein mutant comprises V29P+A132K mutations. In some embodiments, the UvsY protein mutant comprises V29P+S119F mutations. In some embodiments, the UvsY protein mutant comprises A132K+S119F mutations.

[0012] In some embodiments, the wild-type UvsY protein has the amino acid sequence set forth in SEQ ID NO: 4, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identity compared to SEQ ID NO: 4, or an amino acid sequence of the amino acid sequence set forth in SEQ ID NO: 4 with one or more amino acid additions, deletions, substitutions, or modifications.

[0013] In some embodiments, the UvsY protein mutant has the amino acid sequence set forth in one or more of SEQ ID NOs: 5-9, 11, 26-31, and 46-51.

[0014] In some embodiments, the UvsY protein mutant has improved protein solubility, and / or improved protein yield, and / or improved thermal stability, and / or improved enzyme activity compared to the wild-type UvsY protein.

[0015] In some embodiments, the enzyme activity is RPA enzyme activity.

[0016] The present disclosure obtains 13 mutation sites for UvsY protein: V29P, S99K, Q128I, A132K, F73P, S74F, S81K, S81R, S119F, S119R, S119W, F122R, H126W. It is found through testing that the key sites for thermal stability of UvsY protein include F73, S81, S119, H126, and Q128; the key sites for solubility include V29, F73, S74, F119, and H126; the key sites for yield include V29, F73, S74, S119, H126, and Q128; and the key sites for RPA activity include V29, F73, S81, S99, S119, H126, and A132.

[0017] In particular, mutation of F73P site can greatly improve the solubility of UvsY (more than 10 times), the protein yield is more than 7 times higher than the wild type, and the thermal stability is 1.29°C higher than the wild type. The present disclosure also finds that the combination mutant with F73P mutation also has greatly improved protein yield and protein solubility. For example, the protein yield of the combination mutant F73P+V29P can reach 129 mg / (L of fermentation broth), which is greatly improved compared to the wild type (9.86 mg / (L of fermentation broth)), the protein concentration can reach 50 pg / pL, which is greatly improved compared to the wild type (3-6 pg / pL), and the RPA activity is 37% higher than the wild type.

[0018] Another aspect of the present disclosure provides a nucleic acid molecule encoding the UvsY protein mutant of the present disclosure.

[0019] Yet another aspect of the present disclosure provides a recombinant expression vector comprising the nucleic acid molecule of the present disclosure.

[0020] In some embodiments, the recombinant expression vector can be selected from viral or bacterial vectors, such as, but not limited to, African swine fever virus vector, lentivirus vector, avipox virus vector, canine distemper virus vector, herpes virus vector, varicella virus vector, adenovirus vector, adeno-associated virus vector, and the like.

[0021] In some embodiments, the recombinant expression vector includes, but is not limited to, pET-28a, pET-22b plasmid, and the like.

[0022] Yet another aspect of the present disclosure provides a host cell comprising the UvsY protein mutant of the present disclosure, the nucleic acid molecule, or the recombinant expression vector.

[0023] In some embodiments, the host cell is a prokaryotic cell or a eukaryotic cell.

[0024] In some embodiments, the prokaryotic cell can be selected from Escherichia coli or Bacillus subtilis, such as Escherichia coli BL21, T7E, C41, Arctic, and the like. In some specific embodiments, the host cell is Escherichia coli BL21(DE3) strain.

[0025] In some embodiments, the eukaryotic cell can be selected from yeast cell, insect cell, plant cell, animal cell, and the like, such as yeast cell, CHO cell, 293 cell, Vero cell, or NSO cell, and the like.

[0026] Yet another aspect of the present disclosure provides a composition comprising (i) the UvsY protein mutant of the present disclosure, and (ii) one or more agents selected from the group consisting of buffer, primer, probe, dye, detection agent, target nucleic acid, and cell lysis agent.

[0027] In some embodiments, the composition is provided in the form of a kit.

[0028] Yet another aspect of the present disclosure provides a method of preparing the UvsY protein mutant of the present disclosure, wherein the method comprises the steps of: (1) culturing the host cell of the present disclosure; and (2) isolating the UvsY protein mutant from the host cell or from the growth medium or supernatant.

[0029] Yet another aspect of the present disclosure provides use of the UvsY protein mutant, the nucleic acid molecule, the recombinant expression vector, the host cell or the composition of the present disclosure in enzyme preparation, gene repair, target gene detection, DNA recombination or vaccine preparation.

[0030] In some embodiments, the UvsY protein mutant is used in a recombinase polymerase amplification reaction.

[0031] Yet another aspect of the present disclosure provides a method for producing a DNA molecule, comprising a step of using the UvsY protein mutant of the present disclosure.

[0032] In some embodiments, the UvsY protein mutant is incubated with a template DNA and primers.

[0033] In some embodiments, the method is implemented by a recombinase polymerase amplification reaction.

[0034] The present disclosure significantly improves the yield, solubility, stability and activity of the UvsY protein in recombinase polymerase isothermal amplification technology (RPA) by mutating and optimizing the UvsY protein, promoting the widespread use of the UvsY protein in practical applications. This is embodied in the following aspects:

[0035] (1) The amino acid sequence of the UvsY protein is optimized by genetic engineering, which improves its yield in conventional expression systems and improves the efficiency of protein production, thereby meeting the demand for large-scale production.

[0036] (2) The solubility of the UvsY protein is enhanced by mutation and structure optimization, which avoids the formation of aggregates or precipitates during expression and purification, ensures the high stability of the protein in solution, and improves the freeze-drying preparation effect.

[0037] (3) The thermal stability of the UvsY protein is improved by modifying its structure. BRIEF DESCRIPTION OF DRAWINGS

[0038] Figure 1 The protein concentration results of the mutants obtained by virtual saturation mutation of the present disclosure are shown.

[0039] Figure 2 The yield results of the mutants obtained by virtual saturation mutation of the present disclosure are shown.

[0040] Figure 3 The protein concentration results of the mutants obtained by consensus mutation of the present disclosure are shown.

[0041] Figure 4 The yield results of the mutants obtained by consensus mutation of the present disclosure are shown.

[0042] Figure 5 Thermal stability results for virtual saturation and consensus mutation resulting mutants of the present disclosure are shown.

[0043] Figure 6 RPA activity results for virtual saturation and consensus mutation resulting mutants of the present disclosure are shown.

[0044] Figure 7 RPA relative activity results for virtual saturation and consensus mutation resulting mutants are shown.

[0045] Figure 8 Protein concentration results for combination mutation resulting mutants are shown.

[0046] Figure 9 Yield results for combination mutation resulting mutants are shown.

[0047] Figure 10 RPA activity results for combination mutation resulting mutants are shown.

[0048] Figure 11 RPA relative activity results for combination mutation resulting mutants are shown. DETAILED DESCRIPTION

[0049] In order to make the objectives, technical solutions and advantages of the present disclosure clearer, the present disclosure is further described in detail below with reference to the drawings and embodiments. The specific embodiments described herein are only used to explain the present disclosure and do not constitute any limitation on the present disclosure. In addition, in the following description, the description of well-known structures and technologies is omitted to avoid unnecessary confusion of the concept of the present disclosure. Such structures and technologies are also described in many publications.

[0050] Definitions

[0051] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. The following definitions are applied to the descriptions of this specification and the claims that follow, and, as appropriate, to the phrases and terms used herein. Also, the use of "a" or "an" to describe the singular is only used for readability and does not constitute a limitation of the number of entities to which such term refers, for example, a compound, a cell, and the like.

[0052] The expressions "a" and "an" as used herein include plural references unless the context clearly dictates otherwise. For example, reference to "a cell" includes a plurality of such cells, equivalents thereof known to those skilled in the art, and the like.

[0053] The term "about" as used herein means a range of ±20% of the numerical value that follows. In some embodiments, the term "about" means a range of ±10% of the numerical value that follows. In some embodiments, the term "about" means a range of ±5% of the numerical value that follows.

[0054] The term "T4 UvsY protein" as used herein is an important protein in T4 bacteriophage involved in DNA repair and recombination processes.

[0055] The term "RPA (Recombinase Polymerase Amplification)" as used herein is a molecular biology technique for DNA amplification that uses specific recombinase, polymerase and accessory proteins for efficient DNA amplification at room temperature.

[0056] The term "substitution" as used herein in reference to an amino acid means that at least one amino acid residue in an amino acid sequence is replaced with another, different "replacement" amino acid residue. The term "insertion" as used herein in reference to an amino acid means the incorporation of at least one additional amino acid into an amino acid sequence. While an insertion typically consists of the insertion of one or two amino acid residues, larger "peptide insertions" can be made, e.g., of about 3 to 5 or even up to about 10, 15 or 20 amino acid residues. As disclosed above, the inserted residues can be naturally-occurring or non-naturally-occurring. The term "deletion" as used herein in reference to an amino acid means the removal of at least one amino acid residue from an amino acid sequence.

[0057] A mutant of the disclosure, or a fragment thereof, can comprise conservative amino acid substitutions at one or more amino acid residues, e.g., at essential or non-essential amino acid residues. A "conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, in the present context, an essential or non-essential amino acid residue in a mutant is preferably replaced with another amino acid residue from the same side chain family.

[0058] "Percent sequence identity" or "percent identity" between two polynucleotide or polypeptide sequences refers to the number of identical matching positions in the comparison window, after aligning the two sequences for optimal comparison purposes (i.e., taking into account any necessary additions or deletions (gaps)) to maximize the number of identical matches. A match position is any position wherein the same nucleotide or amino acid is present in both the target and reference sequences. Gaps are not counted as nucleotides or amino acids, so a gap present in the target sequence is not counted. Likewise, a gap present in the reference sequence is not counted, as it is not counted as a nucleotide or amino acid from the reference sequence.

[0059] The percent sequence identity can be calculated by determining the number of positions at which the same amino acid residue or nucleic acid base occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to yield the percent sequence identity. Comparison of sequences and determination of percent sequence identity between two sequences can be accomplished using software that is readily available online and for download. Suitable software programs are available from various sources for alignment of protein and nucleotide sequences. One suitable program for determining percent sequence identity is bl2seq, which is part of the BLAST suite of programs available from the National Center for Biotechnology Information's BLAST website (blast.ncbi.nlm.nih.gov). Bl2seq uses either the BLASTN or BLASTP algorithm for comparison between two sequences. BLASTN is used for comparison of nucleic acid sequences, while BLASTP is used for comparison of amino acid sequences. Other suitable programs are, for example, Needle, Stretcher, Water, or Matcher, which are part of the EMBOSS suite of bioinformatics programs, and are also available from the European Bioinformatics Institute (EBI) at www.ebi.ac.uk / Tools / psa.

[0060] Examples are provided below to assist in understanding the present disclosure. It is understood, however, that these examples are intended to be illustrative only and are not intended to limit the disclosure in any way. The true scope of the disclosure is set forth in the appended claims. It is understood that any modifications and changes can be made to the examples without departing from the spirit of the disclosure.

[0061] Examples

[0062] Example 1: Recombinant Plasmid Construction

[0063] 1. Synthesis of genes of interest

[0064] The gene sequence encoding UvsY (SEQ ID NO: 4) was synthesized by Suzhou Jinyuzhi Biotechnology Co., Ltd., and inserted into the Nde I and Xho I sites of the pET-28a(+) plasmid, successfully constructing the pET-UvsY recombinant plasmid.

[0065] (1) Extraction of pET-UvsY recombinant plasmid

[0066] A T1 single colony carrying the pET-UvsY plasmid was picked from the plate and transferred to 5 mL of LB liquid medium containing 0.1 mM kanamycin (Table 1) and cultured at 37°C and 220 rpm for 12 hours. Then, the cells were collected by centrifugation for plasmid extraction, and the extraction process was performed according to the instructions of the plasmid extraction kit (purchased from Beijing Zhenbenjin Biotechnology).

[0067] (2) Construction of E. coli BL21

[0068] In the clean bench, 10 μL of pET-UvsX recombinant plasmid and 50 μL of E. coli BL21 competent cells were mixed evenly. The plasmid was transformed into the E. coli BL21 competent cells, incubated on ice for 30 minutes. Then, heat shock treatment was performed: the reaction tube was placed in a 42°C water bath for 45 seconds, quickly transferred to ice, and cooled for 2 minutes. Then, 500 μL of LB liquid medium was added to the system, and cultured at 37°C and 220 rpm for 1 hour.

[0069] The 450 μL supernatant was removed by centrifugation (8000 x g, 1 minute), the bacterial cells were resuspended and plated on plate medium containing kanamycin, and cultured at 37°C for 12 hours. A single colony strain was picked and cultured in liquid LB medium for 12 hours for strain preservation.

[0070] Table 1 Preparation of LB medium

[0071] Components LB liquid medium / g / L LB plate medium / g / L Proteose peptone 10 10 Yeast extract 5 5 Sodium chloride 10 10 Agar powder - 15

[0072] Example 2: Heterologous expression and purification of recombinant protein

[0073] (1) Transformation and expression of pET-UvsY recombinant plasmid

[0074] The pET-UvsY recombinant plasmid constructed in Example 1 was introduced into E. coli BL21(DE3) competent cells, and protein expression was performed in the BL21(DE3) strain.

[0075] 10 μL of competent cells were inoculated into 5 mL of LB liquid medium containing 0.1 mM kanamycin and cultured at 37°C and 220 rpm for 12 hours.

[0076] The next day, 1 mL of the culture was transferred to a new 80 mL LB medium containing 0.1 mM kanamycin, and the culture was continued. When the bacterial solution concentration (OD600) reached 0.8, IPTG was added to a final concentration of 0.05 mM, and the temperature was adjusted to 16°C. The culture was continued at 160 rpm for 20 hours.

[0077] (2) Cell harvesting and lysis

[0078] After the culture ended, the culture was centrifuged at 8000 x g and 4°C for 5 minutes, and the supernatant was discarded, leaving the bacterial pellet.

[0079] The cells were suspended with 10 mL of the lysis solution (Table 3) and stored on ice. Subsequently, the cells were crushed three times using an ultrahigh-pressure cell crusher. The crushed solution was transferred to a 10000 x g centrifuge at 4°C for 60 minutes, and the precipitate was discarded, and the supernatant was collected.

[0080] (3) Protein purification

[0081] After the supernatant was filtered through a 0.45 μm microporous filter, the protein was purified using a Ni-NTA metal affinity chromatography column.

[0082] First, the Ni-NTA column was equilibrated with one column volume of Buffer I (Table 2) for 2 minutes. Then, the supernatant was added to the Ni-NTA column, and 10 mL was added along the wall, allowing the nickel medium to bind to the supernatant for 2 minutes, repeated three times, and the nickel column bound to the protein, turning gray.

[0083] Subsequently, five column volumes of wash buffer (Table 4) were added along the wall to wash away the impurities; the elution buffer (Table 5) was added to compete with the nickel column by using high-concentration imidazole, and the target protein was collected after elution. After the protein was eluted, the nickel medium turned blue again. The protein was checked for washing and elution using Coomassie Brilliant Blue solution.

[0084] Finally, the Ni-NTA column was washed with one column volume of the final elution buffer (Table 6), and then stored after water washing.

[0085] (3) Protein concentration and storage

[0086] All purification operations were performed at 4°C. The eluted protein was dialyzed using a storage buffer (Table 7), and concentrated to less than 1 mL, and the volume of the harvested protein was recorded.

[0087] (4) Protein quality detection and concentration determination

[0088] The purified protein was analyzed by 15% SDS-PAGE to confirm its purity and molecular weight. The protein concentration was quantified using the Solarbio BCA Protein Assay Kit.

[0089] In the above steps, the formulation of the buffer used is shown in Tables 2 to 7.

[0090] Table 2 Formulation of Buffer-I

[0091] Components Concentration Phosphate buffer pH 7.2 50mM Sodium chloride 500mM

[0092] Table 3 Formulation of Bacterial Lysis Buffer

[0093] Components Concentration Buffer-I – PMSF 100mM

[0094] Table 4 Formulation of Wash Buffer

[0095] Components Concentration Phosphate buffer pH 7.2 50mM Sodium chloride 500mM Imidazole 60mM

[0096] Table 5 Formulation of Elution Buffer

[0097] Components Concentration Phosphate buffer pH 7.2 50mM Sodium chloride 500mM Imidazole 500mM

[0098] Table 6 Formulation of Final Elution Buffer

[0099] Components Concentration Phosphate buffer pH 7.2 50mM Sodium chloride 500mM Imidazole 1000mM

[0100] Table 7 Formulation of Enzyme Storage Buffer

[0101] Components Concentration Sodium chloride 300mM Tris-HCl (pH 8) 20mM DTT 1mM EDTA 0.1mM

[0102] Example 3: RPA Reaction Conditions

[0103] (1) Plasmid Construction

[0104] The plasmid required for the RPA detection system for detecting HPV-16 was synthesized by GenScript Corporation and cloned into the pET-22b vector. The relevant primer sequences and amplified nucleotide sequences are shown in Table 8.

[0105] (2) RPA Reaction System and Conditions

[0106] The reaction volume was 50 μL, and the buffer components used are listed in Table 9, and the reaction conditions are shown in Table 10. The reaction was performed at 41°C for 30 minutes. The mixed reaction solution was placed in a 1.5 mL EP tube in a water bath.

[0107] (3) Nucleic Acid Extraction and Electrophoretic Analysis

[0108] After the reaction was completed, an equal volume of DNA extraction phenol was added for nucleic acid extraction. After centrifugation at 12000 x g for 7 minutes, the supernatant was collected. The extraction product was separated on a 2.0% (w / v) agarose gel and stained with 1 x Safe Green dye. Each experiment was repeated in triplicate.

[0109] Table 8 Amplified Sequences and Primers Used in the Experiment

[0110]

[0111] Table 9 Preparation of 2×RPA buffer solution

[0112] Components Concentration Tris-HCl (pH 8) 60mM CH3COOK 80mM DTT 4mM Creatine phosphate 40mM PEG35K 15％ ATP 5mM dNTPs 0.9mM

[0113] Table 10 Preparation of reagents for RPA amplification reaction

[0114] Components Volume / μL 2x RPA buffer 25 Bsu DNA polymerase (1.5 μg / μL, SEQ ID NO: 52) 1 T4 UvsX recombinase (3 μg / μL, SEQ ID NO: 53) 2 T4 UvsY wild type or mutant (1 μg / μL) 1 T4 gene 32 single-stranded binding protein (4 μg / μL, SEQ ID NO: 54) 2.5 Creatine kinase (CK) (2 μg / μL, purchased from Yikang Bio) 2.5 Forward primer HPV-F (10 μM) 1.5 Reverse primer HPV-R (10 μM) 1.5 Amplification template (HPV-16, SEQ ID NO: 1) 1 Mg 2+ (280 mM) 2.5 Distilled water Supplemented to 50 μL

[0115] In Table 10, the amino acid sequence of Bsu is as follows:

[0116]

[0117] The amino acid sequence of the T4 UvsX recombinase is as follows:

[0118]

[0119]

[0120] The amino acid sequence of the T4 gene 32 single-chain binding protein is as follows:

[0121]

[0122] Example 4: Virtual Saturation Mutation

[0123] (1) Structural prediction and mutation design

[0124] AlphaFold 3 was used to predict the protein-DNA binding structure. Based on the predicted structure, FoldX software was used to analyze the structure located near the DNA binding pocket (…). Virtual saturation mutations were performed on amino acids within the specified range. The mutation energy of each mutant was then calculated. Based on the calculation results, potential mutation sites were screened: S81K, S81R, S119F, S119R, S119W, F122R, and H126W. The amino acid sequences of each mutant are shown in Table 11 below.

[0125] Table 11

[0126]

[0127] (2) The construction of recombinant plasmids for expressing mutants was carried out using PCR technology.

[0128] The pET-UvsY recombinant plasmid was amplified to obtain a recombinant plasmid for expressing the UvsY mutant protein. The PCR system is shown in Table 12, and the primer sequences used are shown in Table 13.

[0129] Table 12 PCR System

[0130]

[0131]

[0132] PCR amplification program: Pre-denaturation: 98℃ for 3 minutes; Denaturation: 98℃ for 15 seconds; Annealing: 62℃ for 15 seconds; Extension: 72℃ for 3 minutes; 30 cycles; Final extension: 72℃ for 5 minutes.

[0133] Table 13 Primers used in the experiment

[0134] Name Sequence information (5'-3') SEQ ID NO: S81K_F TTACGAGAAAAAAGAAATGAAGACAGTTCTATC 12 S81K_R CTTCATTTCTTTTTTCTCGTAACGATCCAT 13 S81R_F TTACGAGAAACGTGAAATGAAGACAGTTCTATC 14 S81R_R CTTCATTTCACGTTTCTCGTAACGATCCAT 15 S119F_F TGCTATTAAATTTCGTGGATTTGCTATTAAG 16 S119F_R AAATCCACGAAATTTAATAGCATCAAGAGCTC 17 S119R_F TGCTATTAAACGTCGTGGATTTGCTATTAAG 18 S119R_R AAATCCACGACGTTTAATAGCATCAAGAGCTC 19 S119W_F TGCTATTAAATGGCGTGGATTTGCTATTAAG 20 S119W_R AAATCCACGCCATTTAATAGCATCAAGAGCTC 21 F122R_F ATCACGTGGACGTGCTATTAAGCATATTCAAGAC 22 F122R_R CTTAATAGCACGTCCACGTGATTTAATAGC 23 H126W_F TGCTATTAAGTGGATTCAAGACATGCGAGC 24 H126W_R GTCTTGAATCCACTTAATAGCAAATCCACG 25

[0135] (3) Mutant properties

[0136] The purified UvsY protein mutant was obtained according to the method in Example 2, and the protein concentration was quantitatively detected using a Solarbio BCA protein assay kit; the protein yield was calculated using the following formula:

[0137] Protein yield (mg / (L fermentation broth)) = (harvest volume * protein concentration) / fermentation broth volume

[0138] Protein thermal stability was reflected by differential scanning calorimetry (DSC) determination of the protein melting temperature (Tm): the assay system contained 4 μg of protein and 1×SYPRO orange protein dye, and the final volume was adjusted to 25 μL using storage buffer (Table 7). DSC was performed using an ABI QuantStudio™ 5 quantitative real-time PCR system. The instrument's melting curve filter was configured with an excitation wavelength of 470 nm and an emission wavelength of 586 nm. The sample was subjected to a temperature gradient from 25 °C to 99 °C at a controlled rate of 0.05 °C / s. The Tm value was determined by the peak value of the melting curve.

[0139] The results of the obtained mutant protein concentrations are as follows: Figure 1 As shown, the results indicate that the S119F, S119R, and H126W mutants have better protein solubility than their wild-type UvsY protein.

[0140] The results of the obtained mutant yield are as follows Figure 2 As shown, the results indicate that the yields of the S81K, S119F, S119R, S119W, and H126W mutants were significantly increased compared to the wild-type UvsY protein.

[0141] The results of the obtained mutant thermal stability are as follows Figure 5 As shown, the results indicate that mutants H126W, S119W, S119R, S119F, and S81K have better thermal stability than the wild type.

[0142] Example 5: Consensus mutation

[0143] (1) Mutation design

[0144] The strategy of consensus mutation was used to mutate non-conservative amino acids into conservative amino acids. The frequency of amino acid in homologous protein sequence determines its conservative degree, and the amino acids with frequency greater than 50% were selected as conservative sites after mutation, thus six mutation sites of V29P, S99K, Q128I, A132K, F73P and S74F were determined. The amino acid sequences of each mutant are shown in Table 14.

[0145] Table 14

[0146]

[0147]

[0148] (2) Construction of recombinant plasmid for expressing mutant

[0149] The PCR amplification system and conditions were the same as in Example 4, and the primer sequences used are shown in Table 15.

[0150] Table 15 Primers used in the experiment

[0151] Name Sequence information (5'-3') SEQ ID NO: V29P-YF CAGCTAATAATccgATGTTATATAGTAAATGGCTTAATAAGCATTC 32 V29P-YR CATcggATTATTAGCTGCTTCATACTGTAATTTAGTCG 33 F73P-YF GAAcctAGTATGGATCGTTACGAGAAATCAGA 34 F73P-YR CGATCCATACTaggTTCATCACCATCTCCTCGTCCC 35 S74F-YF TtttATGGATCGTTACGAGAAATCAGAAATGA 36 S74F-YR CGTAACGATCCATaaaAAATTCATCACCATCTCCTCGTCC 37 S99K-YF GGTTGATACCaagTTGCAGTATTGGGGGATTTTATT 38 S99K-YR GCAActtGGTATCAACCTTTAAAACATCCTTATCC 39 Q128I-YF ATTatcGACATGCGAGCATTTGAGGCTGGAAA 40 Q128I-YR GCTCGCATGTCgatAATATGCTTAATAGCAAATCCACGTG 41 A132K-YF GCGAaaaTTTGAGGCTGGAAAATGAGATCCGG 42 A132K-YR CAGCCTCAAAtttTCGCATGTCTTGAATATGCTTAATAG 43

[0152] (3) Performance of mutant

[0153] The purified UvsY protein mutants were obtained according to the method of Example 2, and the protein concentration, protein yield and protein thermal stability were detected according to the method of Example 4.

[0154] The results of the obtained mutant protein concentration are shown in Table 16, and the results show that the mutants V29P, F73P and S74F have significantly improved protein solubility than the wild type, and the mutants Q128I and A132K have protein solubility basically comparable to the wild type. Figure 3 The results of the obtained mutant yield are shown in Table 17, and the results show that compared with the wild type UvsY protein, the yield of F73P mutant is greatly improved, and the yields of V29P, S74F, Q128I and A132K mutants are significantly increased.

[0155] Figure 4 The results of the obtained mutant thermal stability are shown in Table 18, and the results show that the mutants Q128I and F73P have better thermal stability than the wild type, and the mutants S74F, V29P and A132K have thermal stability comparable to the wild type.

[0156] The results of the obtained mutant thermal stability are shown in Table 18, and the results show that the mutants Q128I and F73P have better thermal stability than the wild type, and the mutants S74F, V29P and A132K have thermal stability comparable to the wild type. Figure 5 The results of the obtained mutant thermal stability are shown in Table 18, and the results show that the mutants Q128I and F73P have better thermal stability than the wild type, and the mutants S74F, V29P and A132K have thermal stability comparable to the wild type.

[0157] Among them, the protein solubility of mutant F73P is more than 10 times higher than that of wild type UvsY, the protein yield is 7.77 times higher than that of wild type UvsY, the protein thermal stability is 1.29℃ higher than that of wild type UvsY, and the protein RPA relative activity is 90% higher than that of wild type UvsY.

[0158] Example 6: RPA reaction

[0159] According to the RPA reaction conditions of Example 3, the mutants obtained in Example 4 and Example 5 were used for RPA reaction. After the reaction, the RPA reaction amplification bands of each mutant were separated and detected by agarose gel method. The gray value of each band was analyzed by image J software, and the gray value of the band of wild type UvsY participating in the reaction was defined as the reference, and the RPA relative activity of the mutant protein was defined.

[0160] The results of RPA reaction amplification bands of wild type UvsY and each mutant are shown in Figure 6 The results of RPA relative activity are shown in Figure 7 The results show that mutants V29P, F73P, S99K, A132K, S81R and S119F have significantly improved RPA relative activity than wild type.

[0161] Example 7: Combination mutation

[0162] (1) Mutation design

[0163] Based on the performance of the mutants obtained by virtual saturation mutation and consensus mutation, further selection was made on mutation sites F73P, V29P, A132K, S119F for experiment. Double point mutation sites were designed: F73P+V29P, F73P+A132K, F73P+S119F, V29P+A132K, V29P+S119F, A132K+S119F. The amino acid sequences of each mutant are shown in Table 16.

[0164] Table 16

[0165]

[0166] (2) Construction of recombinant plasmid for expressing mutant

[0167] The PCR amplification system and conditions are the same as in Example 4, and the primer sequences are shown in Tables 13 and 15.

[0168] (3) Performance of mutant

[0169] The purified UvsY protein mutants were obtained according to the method of Example 2, and the protein concentration, protein yield and protein thermal stability were detected, and the RPA activity and RPA relative activity of each mutant were detected according to the method of Example 6.

[0170] Figure 8 The results show that the mutants F73P+V29P, F73P+A132K, F73P+S119F and A132K+S119F have significantly improved protein solubility than the wild type, and the mutants V29P+A132K and V29P+S119F have substantially equivalent protein solubility to the wild type.

[0171] Figure 9 The results show that the mutants F73P+V29P, F73P+A132K and F73P+S119F have significantly improved protein yield than the wild type, and the mutants V29P+A132K, V29P+S119F and A132K+S119F also have improved protein yield compared with the wild type.

[0172] Figure 10 The results of Example 7 and Example 8 show that the mutant F73P+V29P has significantly improved RPA relative activity than the wild type, and the mutants F73P+A132K, F73P+S119F, V29P+A132K and V29P+S119F have substantially equivalent RPA relative activity to the wild type. Figure 11

[0173] Among them, the protein yield of the combined mutation F73P+V29P can reach 129 mg / (L of fermentation broth), which is greatly improved compared with the wild type (9.86 mg / (L of fermentation broth)); the protein concentration can reach 50 μg / μL, which is greatly improved compared with the wild type (3-6 μg / μL); the RPA activity is improved by 37% compared with the wild type.

[0174] The technical solutions of the present disclosure are not limited to the above specific embodiments, and any technical variations made according to the technical solutions of the present disclosure fall within the protection scope of the present disclosure.​

Claims

1. A UvsY protein mutant, characterized in that, The amino acid sequences of the UvsY protein mutants are shown in any one of SEQ ID NO: 5-8, 11, 26-31 and 44-48.

2. The UvsY protein mutant according to claim 1, characterized in that, Compared to wild-type UvsY protein, the UvsY protein mutant has increased protein solubility, and / or increased protein yield, and / or increased thermal stability, and / or increased enzyme activity.

3. The UvsY protein mutant according to claim 2, characterized in that, The enzyme activity is RPA enzyme activity.

4. A nucleic acid molecule encoding the UvsY protein mutant as described in any one of claims 1-3.

5. A recombinant expression vector containing the nucleic acid molecule of claim 4.

6. A host cell, characterized in that, The host cell contains the UvsY protein mutant of any one of claims 1-3, the nucleic acid molecule of claim 4, or the recombinant expression vector of claim 5.

7. A composition comprising (i) the UvsY protein mutant of any one of claims 1-3, and (ii) one or more reagents selected from the group consisting of buffers, primers, probes, dyes, target nucleic acids, and cell lysis agents.

8. The composition according to claim 7, characterized in that, The composition is in the form of a kit.

9. A method for preparing the UvsY protein mutant according to any one of claims 1-3, wherein, The method includes the following steps: (1) Culturing the host cells as described in claim 6; and (2) Isolate the UvsY protein mutant from the host cell or from the growth medium or supernatant.

10. The use of the UvsY protein mutant of any one of claims 1-3, the nucleic acid molecule of claim 4, the recombinant expression vector of claim 5, the host cell of claim 6, or the composition of claim 7 or 8 in enzyme preparation production or target gene detection for non-diagnostic purposes.

11. The application according to claim 10, characterized in that, The UvsY protein mutant was used for recombinase polymerase amplification reaction.

Images