Divalent aptamer aiming at glucose small molecules as well as preparation method and application of divalent aptamer
By connecting the complementary paired DNA strands to the glucose aptamer to form a divalent nucleic acid aptamer, the problems of insufficient binding affinity and low specificity of the existing glucose detection methods are solved, and the detection of glucose with high sensitivity and high specificity is achieved.
Patent Information
- Application Number
- CN202411994870.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-31
- Publication Date
- 2025-04-08
AI Technical Summary
The existing glucose detection methods have problems such as insufficient binding affinity, low specificity, slow response speed and limited detection range, which are difficult to meet the practical application needs.
Using complementary paired DNA strands, two single strands connect two identical glucose aptamers to form a dimer structure, and obtain a group of divalent nucleic acid aptamers targeting small glucose molecules.
Through the dual binding mechanism of bivalent aptamers, the binding affinity and selectivity for glucose is significantly enhanced, the sensitivity and specificity of the detection are improved, and background interference is reduced.
Smart Images
Figure CN119776355A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and specifically utilizes a complementary paired DNA chain, wherein two single chains are respectively connected to two identical glucose aptamers, and the two are combined to obtain a dimer structure, and finally a group of divalent nucleic acid aptamers targeting glucose small molecules are obtained. Background Art
[0002] The detection of small molecule glucose has important application value in the fields of biomedicine, food safety and environmental monitoring. Glucose is not only the main source of energy in organisms, but abnormal changes in its level are also closely related to a variety of diseases (such as diabetes, metabolic syndrome, etc.). Therefore, the development of sensitive, rapid and highly specific detection methods to achieve real-time monitoring of glucose has become an important task in scientific research and clinical applications.
[0003] Traditional glucose detection methods mainly include the color reaction of o-toluidine (O-toluidine method), gas chromatography (GC) and liquid chromatography (LC). Although these methods have advantages in sensitivity and accuracy, they often require complex sample pretreatment and take a long time to detect. In addition, these technologies usually rely on expensive equipment and professional operating skills, which limits their application in primary care and home monitoring.
[0004] DNA aptamers are a type of single-stranded DNA molecules that can specifically bind to target molecules. They have the advantages of simple synthesis, low cost, high specificity and strong affinity. They have high tolerance to temperature and chemical environments and are non-immunogenic, making them suitable for use in biomedicine and drug delivery. In addition, DNA aptamers are easy to functionalize and modify, and can be integrated into a variety of detection platforms. They are widely used in biological detection, drug screening, and genetic detection, showing good application prospects.
[0005] At present, some studies have attempted to use aptamers for glucose detection. However, there are still problems such as insufficient binding affinity, low specificity, slow response speed and limited detection range. These challenges make it difficult for existing aptamer sensors to meet various application requirements in practical applications. Bivalent aptamers can significantly enhance the binding affinity and selectivity by binding to two target molecules at the same time. This dual binding mechanism not only improves the binding stability of the aptamer and the target molecule, but also effectively reduces the background signal, thereby improving the sensitivity of detection.
[0006] Therefore, there is a need in the art to develop a new type of bivalent aptamer to achieve high sensitivity and high specificity detection of small molecule glucose. Summary of the invention
[0007] Some monovalent nucleic acid aptamers for glucose small molecules in the prior art, but the affinity of nucleic acid aptamers for small molecules is low, and the low molecular weight of small molecules causes them to be unable to form sufficiently stable complexes with small molecules. In order to improve the affinity of aptamers, the present invention constructs a bivalent aptamer for glucose small molecules. Bivalent aptamers can bind to two target molecules at the same time to form a more stable complex, and at the same time, the effective binding sites of aptamers are increased, thereby improving their affinity for the target. In addition, bivalent aptamers also have the advantages of reducing background interference, strong adaptability, and promoting signal amplification.
[0008] The present invention includes a method for preparing a bivalent nucleic acid aptamer, wherein the bivalent aptamer contains a completely complementary paired nucleic acid chain, including a C1 chain and a C2 chain, and a glucose monovalent aptamer is connected to the 3' end of the C1 chain with 6 dTs to form a C1-Aptamer, and a glucose monovalent aptamer is connected to the 5' end of the C2 chain with 6 dTs to form a C2-Aptamer, and the two are combined at a molar ratio of 1:1 to form a bivalent aptamer with consistent aptamer directions. The sequences of the C1 chain, C2 chain, glucose monovalent aptamer, C1-Aptamer chain and C2-Aptamer are as follows:
[0009] C1 strand: 5'CGT TGT TTG AGT TAG AGT GAT 3'
[0010] C2 strand: 5' ATC ACT CTA ACT CAA ACA ACG 3'
[0011] Glucose monovalent aptamer: 5'CTCTCGGGACGACCGTGTGTGTTGCTCTGTAACAGTGTCCATTGTCGTCCC 3'. Figure 1a (shown)
[0012] C1-Aptamer: 5'CGTTGTTTGAGTTAGAGTGATTTTTTTCTCTCGGGACGACCGTGT GTGTTTGCTCTGTAACAGTGTCCATTGTCGTCCC 3'
[0013] C2-Aptamer: 5'CTCTCGGGACGACCGTGTGTGTTGCTCTGTAACAGTGTCCATTGT CGTCCTTTTTATCACTCTAACTCAAACAACG 3'.
[0014] The schematic diagram of the bivalent aptamer structure targeting glucose small molecules in the present invention is as follows Figure 1b shown.
[0015] A bivalent aptamer targeting a small glucose molecule and a preparation method thereof, wherein the bivalent aptamer is synthesized by a solid phase synthesis method and purified by HPLC to obtain two single-stranded DNA aptamers.
[0016] The bivalent aptamer in the present invention is used to develop a highly sensitive biosensor for real-time detection of blood glucose, and is used for more sensitive and convenient home blood glucose monitoring.
[0017] The bivalent aptamer in the present invention can be applied to cell biology research and combined with fluorescent group modification to provide a safe, non-radioactive and sensitive glucose detection method.
[0018] The bivalent aptamer in the present invention can be applied to targeted therapy as a drug carrier to achieve targeted drug delivery by specifically binding to glucose, thereby enhancing the therapeutic effect and reducing side effects.
[0019] Compared with the prior art, the advantages of the present invention are:
[0020] Compared with traditional monovalent DNA aptamers, the bivalent aptamer formed by connecting two monovalent aptamers with complementary chains has improved its affinity for glucose. Compared with re-modification and optimization of the aptamer, it is more efficient and has a simpler operation process. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Figure 1a Schematic diagram of the monovalent aptamer structure targeting glucose small molecules.
[0022] Figure 1b Schematic diagram of the bivalent aptamer structure targeting glucose small molecules.
[0023] Figure 2 This is the result of nucleic acid electrophoresis of a bivalent aptamer formed by mixing two single-stranded aptamers.
[0024] Figure 3a The results of immobilization of monovalent nucleic acid aptamers on SA probes at an immobilization concentration of 200 nM.
[0025] Figure 3b This is the real-time response curve of the monovalent nucleic acid aptamer interacting with different concentrations of glucose.
[0026] Figure 3c The fitted steady-state curve and affinity constant KD of the interaction between monovalent nucleic acid aptamer and glucose.
[0027] Figure 4a The results of immobilization of bivalent nucleic acid aptamers on SA probes at an immobilization concentration of 200 nM.
[0028] Figure 4b This is the real-time response curve of the bivalent nucleic acid aptamer interacting with different concentrations of glucose.
[0029] Figure 4c The fitted steady-state curve and affinity constant KD of the interaction between the bivalent nucleic acid aptamer and glucose.
[0030] Figure 5a The results of immobilization of monovalent nucleic acid aptamers on SA probes at an immobilization concentration of 100 nM.
[0031] Figure 5b This is the real-time response curve of the bivalent nucleic acid aptamer interacting with different concentrations of glucose.
[0032] Figure 5c The fitted steady-state curve and affinity constant KD of the interaction between the bivalent nucleic acid aptamer and glucose.
[0033] Figure 6a The results of immobilization of monovalent nucleic acid aptamers on SA probes at an immobilization concentration of 1000 nM.
[0034] Figure 6b This is the real-time response curve of the bivalent nucleic acid aptamer interacting with different concentrations of glucose.
[0035] Figure 6c The fitted steady-state curve and affinity constant KD of the interaction between the bivalent nucleic acid aptamer and glucose. DETAILED DESCRIPTION
[0036] The present invention is further described in detail below in conjunction with the examples and drawings, but the embodiments of the present invention are not limited thereto. Unless otherwise specified, the processes are considered to be implemented or understood by those skilled in the art with reference to the prior art. If the manufacturer of the reagents or instruments used is not indicated, it is considered to be a conventional product that can be purchased commercially.
[0037] Example 1: Preparation of bivalent nucleic acid aptamers targeting glucose small molecules.
[0038] The preparation method of the divalent nucleic acid aptamer targeting glucose small molecules in this embodiment comprises the following steps: synthesizing two single chains, C1-Aptamer and C2-Aptamer, respectively by solid phase synthesis, and then purifying them by HPLC.
[0039] Preparation method of C1-Aptamer:
[0040] Solid phase synthesis: Use polystyrene as a solid phase synthesis carrier, and fix the first reactive group amino group on the carrier. Use 5′-O-dimethoxytrityl (DMT) protected nucleotides at a reaction concentration of 0.1M. Connect the first biotin-labeled cytosine deoxyribonucleotide to the reactive group amino group on the carrier through its 3′-hydroxyl group to form a phosphodiester bond. Deprotection reaction, use 20% (v / v) trifluoroacetic acid to react at room temperature for 30 minutes. Activation reaction, use 0.5M hydroxyphenyl methyl phosphate activator, react at room temperature for 30 minutes. Connection reaction, use 0.1M activated nucleotide and 1M connection catalyst diisopropyl aminophosphoryl ester, react at room temperature for 2 hours. Number of cycles, set 77 cycles according to the length of the target DNA. Cutting, add 30% trifluoroacetic acid solution, mix well and react for 1 hour, and use nitrogen to remove trifluoroacetic acid after the reaction. HPLC purification: Use C18 reverse phase column for HPLC separation and purification. Eluent: A: 0.1M triethylamine acetate, B: acetonitrile. Elution procedure: A%: 5%-95%, 0-30 min. After freeze-drying the sample, treat the product with 80% acetic acid aqueous solution at room temperature for 30 min. After freeze-drying, DNA powder is obtained and dissolved in the reaction solution (as shown in Table 1).
[0041] Preparation method of C2-Aptamer:
[0042] Solid phase synthesis: Use polystyrene as a solid phase synthesis carrier, and fix the first reactive group amino group on the carrier. Use 5′-O-dimethoxytrityl (DMT) protected nucleotides at a reaction concentration of 0.1M. Connect the first cytosine deoxyribonucleotide to the reactive group amino group on the carrier through its 3′-hydroxyl group to form a phosphodiester bond. Deprotection reaction, use 20% (v / v) trifluoroacetic acid to react at room temperature for 30 minutes. Activation reaction, use 0.5M hydroxyphenyl methyl phosphate activator, react at room temperature for 30 minutes. Connection reaction, use 0.1M activated nucleotide and 1M connection catalyst diisopropyl aminophosphoryl ester, react at room temperature for 2 hours. Number of cycles, set 77 cycles according to the length of the target DNA. Cutting, add 30% trifluoroacetic acid solution, mix well and react for 1 hour, and use nitrogen to remove trifluoroacetic acid after the reaction. HPLC purification: Use C18 reverse phase column for HPLC separation and purification. Eluent: A: 0.1M triethylamine acetate, B: acetonitrile. Elution procedure: A%: 5%-95%, 0-30 min. After freeze-drying the sample, treat the product with 80% acetic acid aqueous solution at room temperature for 30 min. After freeze-drying, DNA powder is obtained and dissolved in the reaction solution (as shown in Table 1).
[0043] The two single strands were mixed at a molar ratio of 1:1 to obtain a bivalent nucleic acid aptamer. Nucleic acid gel electrophoresis confirmed that the two single strands formed a dimer structure (such as Figure 2 shown).
[0044] The sequences of the two single-stranded C1-Aptamer and C2-Aptamer of the divalent nucleic acid aptamer targeting glucose are respectively:
[0045] C1-Aptamer: 5'CGTTGTTTGAGTTAGAGTGATTTTTTTCTCTCGGGACGACCGTGT GTGTTTGCTCTGTAACAGTGTCCATTGTCGTCCC 3'
[0046] C2-Aptamer: 5'CTCTCGGGACGACCGTGTGTGTTGCTCTGTAACAGTGTCCATTGT CGTCCTTTTTATCACTCTAACTCAAACAACG 3'
[0047] Table 1 DNA aptamer and glucose small molecule reaction buffer
[0048]
[0049]
[0050] Example 2: Affinity detection of monovalent nucleic acid aptamers targeting glucose small molecules
[0051] A monovalent nucleic acid aptamer targeting glucose small molecules was synthesized, and a biotin was modified at the 5' of the DNA sequence so that it could be immobilized on the SA probe.
[0052] The affinity of monovalent nucleic acid aptamers was detected using biolayer interferometry. The specific method is as follows: 200 nM monovalent aptamer solution was prepared, the wetted SA probe was reacted in the biotin-labeled monovalent aptamer solution for 10 min, and the aptamer was fixed to the SA probe (such as Figure 3a The probe was used to perform a fast binding and fast dissociation double subtraction experiment in a glucose solution with a 2-fold concentration gradient of 6 concentrations: 100mM, 50mM, 25mM, 12.5mM, 6.25mM and 3.125mM. The reaction of glucose and monovalent aptamer was recorded in real time (as shown in FIG. Figure 3b The fitted steady-state curve is obtained using the Michaelis-Menten equation The affinity constant of the monovalent aptamer was calculated to be KD = 18.97 mM (e.g. Figure 3c shown).
[0053] The sequence of the monovalent nucleic acid aptamer targeting glucose is:
[0054] 5'CTCTCGGGACGACCGTGTGTGTTGCTCTGTAACAGTGTCC ATTGTCGTCCC
[0055] Example 3: Affinity detection of bivalent nucleic acid aptamers targeting glucose small molecules at an immobilization concentration of 200 nM
[0056] A bivalent nucleic acid aptamer targeting glucose small molecules was synthesized, and a biotin was modified at the 5' of the C1-Aptamer sequence to enable it to be immobilized on the SA probe.
[0057] The affinity of the bivalent nucleic acid aptamer was detected using the bio-layer interferometry technique. The specific method is as follows: a 200 nM bivalent aptamer solution was prepared, the wetted SA probe was reacted in the biotin-labeled bivalent aptamer solution for 10 min, and the aptamer was fixed to the SA probe (such as Figure 4a The probe was used to perform a fast binding and fast dissociation double subtraction experiment in a glucose solution with a 2-fold concentration gradient of 6 concentrations: 100mM, 50mM, 25mM, 12.5mM, 6.25mM and 3.125mM. The reaction of glucose and monovalent aptamer was recorded in real time (as shown in FIG. Figure 4b The fitted steady-state curve is obtained using the Michaelis-Menten equation Calculate the affinity constant of the monovalent aptamer KD = 6mM (as Figure 4c shown).
[0058] Example 4: Affinity detection of bivalent nucleic acid aptamers targeting glucose small molecules at an immobilization concentration of 100 nM
[0059] A bivalent nucleic acid aptamer targeting glucose small molecules was synthesized, and a biotin was modified at the 5' of the C1-Aptamer sequence to enable it to be immobilized on the SA probe.
[0060] The affinity of the bivalent nucleic acid aptamer was detected using the bio-layer interferometry technique. The specific method is as follows: a 100 nM bivalent aptamer solution was prepared, the wetted SA probe was reacted in the biotin-labeled bivalent aptamer solution for 10 min, and the aptamer was fixed to the SA probe (such as Figure 5a The probe was used to perform a fast binding and fast dissociation double subtraction experiment in a glucose solution with a 2-fold concentration gradient of 6 concentrations: 50mM, 25mM, 12.5mM, 6.25mM, 3.125mM and 1.5625mM. The reaction of glucose and monovalent aptamer was recorded in real time (as shown in FIG. Figure 5b The fitted steady-state curve is obtained using the Michaelis-Menten equation Calculate the affinity constant of the monovalent aptamer KD = 7mM (as Figure 5c shown).
[0061] Example 5: Affinity detection of bivalent nucleic acid aptamers targeting glucose small molecules at an immobilization concentration of 1000 nM
[0062] A bivalent nucleic acid aptamer targeting glucose small molecules was synthesized, and a biotin was modified at the 5' of the C1-Aptamer sequence to enable it to be immobilized on the SA probe.
[0063] The affinity of the bivalent nucleic acid aptamer was detected using the bio-layer interferometry technique. The specific method is as follows: a 100 nM bivalent aptamer solution was prepared, the wetted SA probe was reacted in the biotin-labeled bivalent aptamer solution for 10 min, and the aptamer was fixed to the SA probe (such as Figure 6a The probe was used to perform a fast binding and fast dissociation double subtraction experiment in a glucose solution with a 2-fold concentration gradient of 6 concentrations: 25mM, 12.5mM, 6.25mM, 3.125mM, 1.5625mM and 0.78125mM. The reaction of glucose and monovalent aptamer was recorded in real time (as shown in FIG. Figure 6b The fitted steady-state curve is obtained using the Michaelis-Menten equation The affinity constant of the monovalent aptamer was calculated to be KD = 11.5 mM (e.g. Figure 6c shown).
[0064] Table 2 Summary of BLI data of DNA aptamers reacting with glucose
[0065]
Claims
1. A bivalent aptamer for glucose small molecules, characterized in that: The bivalent aptamer contains a completely complementary nucleic acid chain, including the C1 chain and the C2 chain. A glucose monovalent aptamer is connected to the 3' end of the C1 chain with 6 dTs to form a C1-Aptamer, and a glucose monovalent aptamer is connected to the 5' end of the C2 chain with 6 dTs to form a C2-Aptamer. The C1-Aptamer and the C2-Aptamer are combined in a molar ratio of 1:1 to form a bivalent aptamer with consistent aptamer directions.
2. The bivalent aptamer for glucose small molecules according to claim 1, characterized in that: The sequence of the C1 chain is: 5'CGT TGT TTG AGT TAG AGT GAT 3'.
3. The bivalent aptamer for glucose small molecules according to claim 1, characterized in that: The sequence of the C2 chain is: 5'ATC ACT CTA ACT CAA ACA ACG 3'.
4. The bivalent aptamer for glucose small molecules according to claim 1, characterized in that: The sequence of the glucose monovalent aptamer is: 5'CTCTCGGGACGACCGTGTGTGTTGCTCTGTAACAGTGTCC ATTGTCGTCCC 3'.
5. The bivalent aptamer for glucose small molecules according to claim 1, characterized in that: The sequence of C1-Aptamer is: 5'CGTTGTTTGAGTTAGAGTGATTTTTTTCTCTCGGGACGACCGTGT GTGTTGCTCTGTAACAGTGTCCATTGTCGTCCC 3'.
6. The bivalent aptamer for glucose small molecules according to claim 1, characterized in that: The sequence of C2-Aptamer is: 5'CTCTCGGGACGACCGTGTGTGTTGCTCTGTAACAGTGTCCATTGT CGTCCCTTTTTTTATCACTCTAACTCAAACAACG 3'.
7. The method for preparing a bivalent aptamer for glucose small molecules according to any one of claims 1 to 6, characterized in that: The solid phase synthesis method was used for synthesis, and two DNA aptamer single strands were obtained by HPLC purification. The two DNA aptamer single strands were combined at a molar ratio of 1:1 to form a bivalent aptamer with the same aptamer direction.
8. The preparation method according to claim 7, characterized in that: The steps include: Solid phase synthesis: using polystyrene as a solid phase synthesis carrier, fixing the first reactive group amino group on the carrier; using 5′-O-dimethoxytrityl (DMT) protected nucleotides, the reaction concentration is 0.1-0.5M; connecting the first nucleotide to the reactive group amino group on the carrier through its 3′-hydroxyl group to form a phosphodiester bond; Deprotection reaction: use 20-30 v / v% trifluoroacetic acid at room temperature for 15-30 min; Activation reaction: Use 0.1-0.5M hydroxyphenyl methyl phosphate activator and react at room temperature for 10-30 minutes; Ligation reaction: Use 0.1-0.5M activated nucleotide and 0.1-1M ligation catalyst, react at room temperature for 1-2h; Cycle number: Set the cycle number according to the length of the target DNA; Cutting: Add 30% trifluoroacetic acid solution, mix well and react for 1-2 hours. After the reaction, use nitrogen to remove the trifluoroacetic acid; HPLC purification: Use C18 reverse phase column for HPLC separation and purification; Elution agent: A: 0.1M triethylamine acetate, B: acetonitrile, elution procedure: A%: 5%-95%, 0-30min; after freeze-drying the sample, treat the product with 80% acetic acid aqueous solution at room temperature for 30min; dry the product DNA, mix the two single strands at a molar ratio of 1:1, and obtain a bivalent nucleic acid aptamer.
9. The use of the bivalent aptamer for glucose small molecules according to any one of claims 1 to 6, characterized in that: The bivalent aptamer is used to develop a highly sensitive biosensor for real-time detection of blood glucose.
10. The use of the bivalent aptamer for glucose small molecules according to any one of claims 1 to 6, characterized in that: The bivalent aptamer is applied to targeted drug carriers.