Fluoro 5-hydroxytryptophan biosensor and detection reagent

Abstract

The invention relates to the technical field of biology, in particular to a fluoro-5-hydroxytryptophan biosensor and a detection reagent. The invention provides an aptamer, a plasmid vector and a strain of fluoro 5-hydroxytryptophan RNA (Ribonucleic Acid), and provides a detection reagent of fluoro 5-hydroxytryptophan and application of the detection reagent. The scheme is of great significance to screening of fluoro-5-hydroxytryptophan, efficient mining of new enzymes or directed evolution of known enzymes.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to a fluorinated 5-hydroxytryptophan biosensor and a detection reagent. Background Art

[0002] 5-Hydroxytryptophan (5-HTP) is the precursor of serotonin and melatonin in animals. They play an important role in regulating emotions and behaviors, as well as physiological functions such as sleep, pain, and body temperature, and have been successfully used to treat depression, insomnia, and migraine. The introduction of fluorine atoms into 5-HTP can enhance the efficacy of the drug, such as 4F-5HTP, 6F-5HTP, 7F-5HTP, etc. At present, the synthesis of fluorinated 5HTP uses tryptophan hydroxylase (TPH145) to catalyze the hydroxylation reaction of fluorinated L-tryptophan, in which Fe 2+ With tetrahydrobiopterin (BH4) as a cofactor and O2 as a cosubstrate, the yield of 4F-5HTP in a shake flask amplification reaction can reach about 1.2 g / L. However, in order to further improve the activity of hydroxylase, it is necessary to construct a high-throughput screening method that specifically recognizes 4F-5HTP.

[0003] Currently, high-throughput screening of amino acid substances mostly uses biosensors. Robert T. Batey et al. reported a biosensor that specifically recognizes 5HTP, but its detection performance was poor when detecting fluorinated 5HTP. Summary of the invention

[0004] In view of this, the technical problem to be solved by the present invention is to provide a 4F-5HTP biosensor and a detection reagent.

[0005] The aptamer of fluorinated 5-hydroxytryptophan RNA provided by the present invention comprises, from the 5' end to the 3' end, tRNA scaffold 1, DFHBI-1T aptamer 1, connection module 1, fluorinated 5-hydroxytryptophan aptamer, connection module 2, DFHBI-1T aptamer 2, and tRNA scaffold 2;

[0006] in:

[0007] tRNA scaffold 1 has the nucleic acid sequence shown in SEQ ID NO: 1;

[0008] tRNA scaffold 2 has the nucleic acid sequence shown in SEQ ID NO: 2;

[0009] The aptamer 1 of DFHBI-1T has the nucleic acid sequence shown in SEQ ID NO: 3;

[0010] The aptamer 2 of DFHBI-1T has the nucleic acid sequence shown in SEQ ID NO:4;

[0011] The aptamer for fluorinated 5-hydroxytryptophan has the nucleic acid sequence shown in SEQ ID NO: 5;

[0012] Linking module 1 and linking module 2 are independently selected from TA, TAT, TATA or TATAT.

[0013] The aptamer provided by the present invention can be DNA or RNA, which is not limited by the present invention. In the sequence table of the present invention, it is characterized as a DNA form, and correspondingly, its RNA form is that the T in the DNA sequence is converted to U. The present invention links the DNA sequence of the aptamer into a recombinant plasmid, and then transcribes it into RNA in the host.

[0014] The present invention screened and optimized the connection modules in the aptamer, and the results showed that among the four connection blocks, TATA or TATAT was used to connect the aptamer of fluoro-5-hydroxytryptophan and the aptamer of DFHBI-1T to obtain a stronger fluorescence reaction, which was significantly different from the fluorescence intensity generated by other connection modules, thereby making the detection more sensitive and accurate. Among them, TATA had a better effect.

[0015] In the present invention, the fluorinated 5-hydroxytryptophan is a fluorine-substituted 5-hydroxytryptophan, including 4-fluoro-5-hydroxytryptophan, 6-fluoro-5-hydroxytryptophan, 7-fluoro-5-hydroxytryptophan, and 4,6-difluoro-5-hydroxytryptophan. For different 5-hydroxytryptophans, the aptamer used is the same, and the aptamer can distinguish between fluorinated 5-hydroxytryptophan and tryptophan. In a specific embodiment, the nucleic acid sequence of the aptamer is shown in SEQ ID NO:8 or SEQ ID NO:9.

[0016] The present invention also provides a recombinant plasmid, which comprises the adaptor as described above.

[0017] In the embodiment of the present invention, the backbone vector of the recombinant plasmid is pETDuet-1.

[0018] Furthermore, the present invention also provides a sensing bacterium, which includes the recombinant plasmid 1 as described above.

[0019] In a specific embodiment, the host of the sensing bacteria described in the present invention is Escherichia coli.

[0020] Furthermore, the present invention also provides a reagent, which includes the sensing bacteria as described above, the fluorescent dye DFHBI-1T, magnesium ions and a reaction buffer.

[0021] In the present invention, the reaction buffer in the reagent is PBS buffer or M9 buffer, the concentration of the magnesium ions is 1 to 10 mM, and the concentration of the fluorescent dye DFHBI-1T is 1 to 10 mM.

[0022] In some embodiments, the concentration of the magnesium ions is 5 mM, and the concentration of the fluorescent dye DFHBI-1T is 5 mM.

[0023] Experiments show that the detection time of unbroken sensing bacteria for quantitative detection is 1 to 4 hours. The optimal fusion time of the broken sensing bacteria cells and the production bacteria is 0 to 12 hours, preferably 0.5 hours. Preferably, in the reagent of the present invention, the sensing bacteria are broken.

[0024] Furthermore, the preparation method of the reagent as described above comprises: transforming the recombinant plasmid as described above into Escherichia coli, mixing with the fluorescent dye DFHBI-1T, magnesium ions and buffer after culturing, and then breaking the bacteria. In the present invention, the culturing step comprises nutritional culturing and induction culturing, and the time of the induction culturing is 2 to 6 hours.

[0025] Furthermore, the present invention also provides the use of the above-mentioned reagent in preparing a kit having at least one of the following functions (a1) to (a4):

[0026] (a1) Detection of the content of fluorinated 5-hydroxytryptophan;

[0027] (a2) Detection of tryptophan hydroxylase activity;

[0028] (a3) Performance screening of tryptophan hydroxylase;

[0029] (a4) Directed evolution screening of tryptophan hydroxylase.

[0030] Furthermore, the present invention provides a kit for detecting the content of fluorinated 5-hydroxytryptophan, which comprises: the reagents as described above.

[0031] Accordingly, the present invention also provides a method for detecting the content of fluorinated 5-hydroxytryptophan, which comprises detecting a sample to be tested using the kit as described above, and determining the content of fluorinated 5-hydroxytryptophan according to the fluorescence intensity.

[0032] In the method for detecting the content of fluorinated 5-hydroxytryptophan, the determination of the content of 4F-5HTP in the sample to be tested includes: constructing a standard curve equation of fluorescence value and fluorinated 5-hydroxytryptophan content, and then substituting the fluorescence value measured by the test sample into the standard curve equation, thereby calculating the content of 4F-5HTP in the sample to be tested.

[0033] In the method, the detection wavelength is in the range of 480-620nm for emission light Ex and 400-520nm for excitation light Ex. The optimal wavelength for fluorescence detection is obtained by full wavelength scanning, which is 472nm for excitation light Ex and 520nm for emission light Em. This wavelength meets the wavelength detection range of common green fluorescent protein and is easy to detect.

[0034] The experiment showed that the detection time of unbroken sensing bacteria for quantitative detection was 1 to 4 hours, while the optimal fusion time of sensing bacteria cells (broken and unbroken) and production bacteria was 0 to 12 hours.

[0035] As a feasibility case, the detection method of fluorinated 5-hydroxytryptophan content includes the following steps: the total detection volume in the fluorescent ELISA plate is 100μL, which includes 89μL of the supernatant after ultrasonic disruption of 4F-5HTP-sensing bacteria (containing 5mM MgSO4); 10μL of the supernatant of the sample to be detected; 1μL of the fluorescent dye DFHBI-1T dissolved in DMSO, with a final concentration of 50μM. The excitation light parameter of the Thermo Fisher ELISA reader is set to Ex: 472nm; the emission light parameter is set to Em: 520nm, the gain parameter is set to 50, and the fluorescence detection is performed at 3h.

[0036] In the present invention, the standard curve equation is obtained as follows: a series of known concentrations of 4F-5HTP standard solutions are used for detection, and the fluorescence values ​​corresponding to the standard solutions of each concentration are measured, thereby obtaining the standard curve equation between the concentration and the fluorescence value of 4F-5HTP.

[0037] Furthermore, the present invention provides a tryptophan hydroxylase activity detection, performance screening or directed evolution screening kit, which includes the above-mentioned reagents and a fluorinated 5-hydroxytryptophan production bacterium;

[0038] The tnaA gene in the fluorinated 5-hydroxytryptophan producing bacteria is knocked out, and the bacteria are transformed with recombinant plasmid 2 and recombinant plasmid 3;

[0039] The recombinant plasmid 2 includes a nucleic acid fragment encoding the tryptophan hydroxylase to be tested;

[0040] The recombinant plasmid 3 includes nucleic acid fragments encoding mtrA, PTPS, SPR, PCD and DHPR.

[0041] Accordingly, the present invention also provides a method for activity detection, performance screening or directed evolution screening of tryptophan hydroxylase and / or tryptophan decarboxylase, which comprises: connecting a nucleic acid fragment encoding the tryptophan hydroxylase and / or tryptophan decarboxylase to be tested into a recombinant plasmid 2, and then transforming the nucleic acid fragment together with the recombinant plasmid 3 into a host in which the tnaA gene is knocked out to obtain a production bacterium,

[0042] The production bacteria are mixed with the reagents as described above, the content of fluorinated 5-hydroxytryptophan is determined according to the fluorescence intensity, and then the activity or performance of tryptophan hydroxylase and / or tryptophan decarboxylase is determined according to the content of fluorinated 5-hydroxytryptophan.

[0043] For the method of detecting enzyme activity or screening highly active enzymes, the enzyme is an enzyme that can catalyze the generation of 4F-5HTP or consume 4F-5HTP; if the enzyme to be tested is an enzyme that can catalyze the generation of 4F-5HTP, the enzyme to be tested is used to carry out a catalytic reaction of 4F-5HTP synthesis, and the method is used to detect the content of 4F-5HTP in the reaction system, and if the content of generated 4F-5HTP is higher, the activity of the enzyme to be tested is higher; if the enzyme to be tested is an enzyme that consumes 4F-5HTP, the enzyme to be tested is used to carry out a catalytic reaction of 4F-5HTP consumption, and the method is used to detect the content of 4F-5HTP in the reaction system, and if the content of generated 4F-5HTP is lower, the activity of the enzyme to be tested is higher.

[0044] A method for directed evolution screening of enzymes; the enzyme is an enzyme that can catalyze the generation of 4F-5HTP or consume 4F-5HTP; when the method is applied to directed evolution screening of enzymes, the natural enzyme is artificially modified, and the activity of the modified enzyme is detected using the method to screen out modified enzymes with high enzyme activity; when the method is applied to detection of 4F-5HTP analogs as the system background, such as 4F-tryptophan, tryptamine, indole, etc., the background fluorescence value absorption is very low and unstable, and will not affect the application in actual screening; when the method is applied to detection of whole bacterial cells as the system background, the background fluorescence value absorption is very low and unstable, and will not affect the application in actual screening.

[0045] The present invention provides an aptamer, a plasmid vector and a strain of fluorinated 5-hydroxytryptophan RNA, and provides a detection reagent for fluorinated 5-hydroxytryptophan and its application. The present invention has at least one of the following beneficial effects: (1) It provides a high-throughput method for the detection of fluorinated 5-hydroxytryptophan, and has a wide range of substrates; (2) It is easy to operate, sensitive to reaction, accurate in detection, has low requirements for equipment, and has strong versatility, and can quickly detect the content of fluorinated 5-hydroxytryptophan in aqueous and non-aqueous systems; (3) It can be coupled with an enzyme that catalyzes the generation of fluorinated 5-hydroxytryptophan to establish a high-throughput screening method for enzyme activity. (4) Experiments have proved that the screening performance of the biosensor has the potential to be further developed into a droplet microfluidic screening system. The present invention is of great significance for the screening of fluorinated 5-hydroxytryptophan, the efficient mining of new enzymes or the directed evolution of known enzymes. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1Schematic diagram of recombinant plasmids and strain construction, including A. TPH145 expression plasmid; B. BH4 cofactor recycling plasmid construction; C. 4F-5HTP biosensor plasmid construction; D. TPH145 and biosensor aptamer co-expression plasmid schematic diagram;

[0047] Figure 2 Figure 4 shows the schematic diagram of the 4F-5HTP biosensor and the optimization of the connector, where A. black represents the tRNA scaffold, green represents the "Broccoli" aptamer connected to DFHBI-1T, blue and red represent the connection module, blue represents the scaffold aptamer connected to the detected compound, B. Comparison of the fluorescence intensity corresponding to the four connection modules, CM2, CM3, CM4 and CM5, at different 4F-5HTP concentrations;

[0048] Figure 3 Shows the best wavelength detection of the standard system 4F-5HTP;

[0049] Figure 4 The standard system product 4F-5HTP and substrate 4F-Trp fluorescence difference detection is shown;

[0050] Figure 5 Shows the linear curve range and sensitivity of 4F-5HTP;

[0051] Figure 6 Show substrate specificity and fluorescence background noise detection;

[0052] Figure 7 The optimal induction time of the induction bacteria was determined by fluorescence measurement;

[0053] Figure 8 Shows the fluorescence determination of 4F-5HTP community strain;

[0054] Fig. 9 The optimal fusion time between producer bacteria and inductive bacteria was determined;

[0055] Fig.10 It shows that the background fluorescence noise interferes with the determination in the real system;

[0056] Fig.11 Shows the fluorescence values ​​of 4F-5HTP at different concentrations and the goodness of fit determination of liquid phase detection;

[0057] Fig.12 The droplet fluorescence signal is measured;

[0058] Fig.13 Figure 2 shows the high throughput screening flow chart;

[0059] Fig.14 Schematic diagram showing different connection modules of the "Broccoli" biosensor. DETAILED DESCRIPTION

[0060] The present invention provides 4F-5HTP biosensors and detection reagents, and those skilled in the art can refer to the content of this article and appropriately improve the process parameters. It is particularly important to point out that all similar replacements and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications of this article without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0061] The test materials used in the present invention are all common commercial products and can be purchased in the market.

[0062] The present invention will be further described below in conjunction with embodiments:

[0063] Example 1. Construction of recombinant plasmids and strains required for the experiment.

[0064] Robert T. Batey et al. reported a non-coding functional RNA fragment of about 300 bp encoded by Escherichia coli transcription, whose secondary structure consists of four parts, namely, scaffolded aptamer, communication module, fluorescent aptamer (Broccoli) and tRNA scaffold. The RNA can specifically bind to the free 5HTP in the environment, so that its own conformation changes to generate a "Broccoli" aptamer small ring, which can specifically recognize the fluorescent dye DFHBI-1T, thereby emitting strong green fluorescence. However, when detecting 5HTP substituted with fluorine atoms, the specificity and sensitivity are reduced, so the communication module (Communication Module) is optimized here. The detailed 5HTP production plasmid and strain, biosensor plasmid and strain construction are as follows.

[0065] 1. The human tryptophan hydroxylase gene TPH145 was constructed on the plasmid pRSFDuet-1 to obtain the recombinant plasmid pRSF-TPH145, which was further transformed into the Escherichia coli BL21 (DE3) strain with ΔtnaA knocked out to obtain the recombinant strain TPH145strain, such as Figure 1 A. In addition, the five pathway enzymes of the BH4 cofactor cycle, mtrA, PTPS, SPR, PCD, and DHPR, were constructed on the pACYCDuet-1 plasmid to obtain the recombinant plasmid pACYC-BH4, which was further transformed into the ΔtnaA knockout Escherichia coli BL21 (DE3) strain to obtain the recombinant bacterial BH4 strain, such as Figure 1B. The two plasmids with different resistances were co-transfected into the ΔtnaA knocked-out E. coli BL21 (DE3) strain to construct a double-plasmid recombinant production strain, namely, 4F-5HTP production strain.

[0066] 2. The functional non-coding RNA fragment of the 4F-5HTP biosensor was connected to the pETDuet-1 plasmid to obtain the recombinant plasmid pET-4F-5HTP aptamer, and then transformed into the Escherichia coli BL21 (DE3) strain to construct the recombinant plasmid sensing strain, namely the 4F-5HTP induction strain, as shown in Figure 1 C. A total of four connection modules were optimized in the non-coding RNA fragments, namely CM2:UA; CM3:UAU; CM4:UAUA; CM5:UAUAU. It was found that CM4 had better specificity and fluorescence intensity in 4F-5HTP detection, such as Figure 2 A and 2B, Tables 1 and 2.

[0067] 3. A functional RNA fragment of 4F-5HTP biosensor was cloned and inserted into the plasmid pRSF-TPH145 to obtain the recombinant plasmid pRSF-TPH145_4F-5HTP aptamer, and the plasmid was transferred into the BH4 strain to obtain the 4F-5HTP community strain, i.e., the "production-sensing integrated strain". Figure 1 D.

[0068] 4. The primers, plasmids and strains used in the experiment are shown in Tables 3 and 4. The ΔtnaA knockout E. coli BL21 (DE3) strain was a gift from other laboratories.

[0069] Table 1. Base sequences of different connection modules of “Broccoli” biosensor

[0070]

[0071] Note: If Fig.14 As shown, in the sequence of the “Broccoli” biosensor, gray represents the tRNA scaffold, yellow represents the “Broccoli” aptamer connected to DFHBI-1T, blue represents the connection module, and red represents the scaffold aptamer connected to the detected compound.

[0072] tRNA scaffold 1: GCCCGGATAGCTCAGTCGGTAGAGCAG

[0073] tRNA Scaffold 2: CGGGTCCAGGGTTCAAGTCCCTGTTCGGGCGCCA

[0074] Adaptor 1 of DFHBI-1T: CGGAGACGGTCGGGTC

[0075] Adaptamer 2 of DFHBI-1T: TCGAGTAGAGTGTGGGCTCCG

[0076] Aptamer for fluorinated 5-hydroxytryptophan: GATGATCGCGTGGATATGGCACGCATTGAATTGTTGGACACCGTAAATGTCCTAACA

[0077] Table 2. Comparison of relative fluorescence intensity of CMs of different lengths in biosensors

[0078] Aptamers <![CDATA[Analyte a > <![CDATA[CM-2 b ]]> CM-3 CM-4 CM-5 5GR-II 4F-5HTP 34±10 55±14 87±20 79±16

[0079] a: The concentration of the detected substance is 2 mM.

[0080] b: % brightness was calculated as (total fluorescent sensor + analyte) / (total fluorescent Broccoli + analyte); errors are expressed as standard error of the mean of three independent experiments.

[0081] Table 3. Primers used in the experimental construction of recombinant plasmids

[0082]

[0083]

[0084] Table 4. Recombinant plasmids and strains constructed in the experiment

[0085]

[0086] Example 2. Standard system 4F-5HTP optimal wavelength detection.

[0087] 1. Take out the frozen induction bacteria from the -80℃ refrigerator, streak them on the resistant (100μg / mL Amp) LB plate, and culture them in a 37℃ constant temperature incubator for 24h. Pick a single colony and put it in 5mL LB (100μg / mLAmp), and culture it overnight at 37℃ and 220rpm. The OD600 of the overnight cultured bacteria is about 1.6. Take 1mL of the overnight cultured induction bacteria and place it in 100mL LB (100μg / mLAmp) at a ratio of 1:100. After culturing for about 2h20min at 37℃ and 220rpm, it can reach the logarithmic growth phase, and its OD600 is about 0.52 (in the range of OD600: 0.4~0.6). At this time, add IPTG with a final concentration of 1mM, culture at 37℃ and 220rpm, and take out the bacteria after about 4h of induction (Note: The induction bacteria must be prepared before use).

[0088] 2. Take out 100mL of bacteria into multiple 50mL test tubes, centrifuge at 4℃, 4000rpm for 5min, and wash the bacteria once in 20mL 1×M9 salt (final concentration 5mM MgSO4). After washing, use the above M9 salt to concentrate the concentration of the sensing bacteria 5 times (for example: 100mL total volume, finally concentrated to 20mL), and the final resuspended bacteria are used as sensing bacteria for standby.

[0089] 3. Scanning with optimal excitation light Ex: The total detection volume in the fluorescent ELISA plate is 100μL. Take 89μL of the resuspended bacterial solution of the induction bacteria (containing 5mM MgSO4), 1μL of the fluorescent dye DFHBI-1T (dissolved in DMSO, final concentration 50μM), 10μL of PBS buffer (pH7.4, 50mM), which is a negative control; 10μL of PBS buffer (pH7.4, 50mM) containing 10mM 4F-5HTP is a positive control. The excitation light parameters of the Thermo Fisher ELISA reader are set to fixed emission light Em: 550nm, scanning excitation light Ex: 400~520nm, gain parameter set to 50, and fluorescence detection is performed at 3h.

[0090] 4. Scanning with optimal excitation light Em: The total detection volume in the fluorescent ELISA plate is 100μL. Take 89μL of the resuspended bacterial solution of the induction bacteria (containing 5mM MgSO4), 1μL of the fluorescent dye DFHBI-1T (dissolved in DMSO, final concentration 50μM), 10μL of PBS buffer (pH7.4, 50mM), which is a negative control; 10μL of PBS buffer containing 4F-5HTP (pH7.4, 50mM), which is a positive control. The excitation light parameters of the Thermo Fisher ELISA reader are set to fixed excitation light Ex: 450nm, scanning emission light Em: 480~620nm, gain parameter set to 50, and fluorescence detection is performed at 3h.

[0091] The above method can use a more convenient kit, such as 100 volumes of PBS buffer supernatant after ultrasonic disruption of 4F-5HTP sensing bacterial RNA aptamer, 5mM MgSO4, and 1 volume of fluorescent dye DFHBI-1T (dissolved in DMSO, final concentration 5mM). The three are mixed as a fluorinated 5-hydroxytryptophan detection kit and stored in a -20°C refrigerator for use. When in use, take 1 volume (10μL) of the test solution and 9 volumes (90μL) of the dissolved kit, mix them in a 96-well fluorescent enzyme plate, and perform fluorescence detection at 3h. The excitation light parameter of the Thermo Fisher microplate reader is set to Ex: 472nm; the emission light parameter is set to Em: 520nm, and the gain parameter is set to 50.

[0092] The results are as follows Figure 3The results show that the optimal wavelength for fluorescence detection is obtained through full wavelength scanning, which is excitation light Ex: 472nm and emission light Em: 520nm. This wavelength meets the wavelength detection range of the common green fluorescent protein and is easy to detect.

[0093] Example 3. Standard system product 4F-5HTP and substrate 4F-Trp fluorescence difference detection.

[0094] The preparation of the inductive bacteria refers to steps 1 to 2 of Example 2.

[0095] 1. The total detection volume in the fluorescence ELISA plate is 100μL, 89μL of the resuspended bacterial solution of the sensing bacteria (containing 5mM MgSO4), 1μL of the fluorescent dye DFHBI-1T (dissolved in DMSO, final concentration 50μM), 10μL of PBS buffer (pH7.4, 50mM), this is the negative control; 10μL of PBS buffer (pH7.4, 50mM) containing 10mM Trp, this is experimental group 1; 10μL of PBS buffer (pH7.4, 50mM) containing 10mM 4F-5HTP, this is experimental group 2. The excitation light Ex of the Thermo Fisher microplate reader is 472nm, the emission light Em is 520nm, and the gain parameter is set to 50. Fluorescence detection is performed at 9 different time points: 0h, 0.33h, 0.66h, 1h, 1.5h, 2h, 3h, 4h, 6h, etc.

[0096] The above method can use a more convenient kit, such as 100 volumes of PBS buffer supernatant after ultrasonic disruption of 4F-5HTP sensing bacterial RNA aptamer, 5mM MgSO4, and 1 volume of fluorescent dye DFHBI-1T (dissolved in DMSO, final concentration 5mM). The three are mixed as a fluorinated 5-hydroxytryptophan detection kit and stored in a -20°C refrigerator for use. When in use, take 1 volume (10μL) of the test solution and 9 volumes (90μL) of the dissolved kit, mix them in a 96-well fluorescent enzyme plate, and perform fluorescence detection at 3h. The excitation light parameter of the Thermo Fisher microplate reader is set to Ex: 472nm; the emission light parameter is set to Em: 520nm, and the gain parameter is set to 50.

[0097] The results are as follows Figure 4The results show that when there is only 4F-5HTP or fluorescent dye DFHBI-1T in the sensing bacteria, it cannot produce strong fluorescence at a specific wavelength (Ex: 472nm, Em: 520nm), and only relatively small and stable background fluorescence noise will be produced, which will not affect the specific detection; when the two are combined in the sensing bacteria, they can emit strong fluorescence, and a more obvious fluorescence difference can be achieved in 1 hour under the standard system, which can prove that the 4F-5HTP detection method is feasible.

[0098] Example 4.4F-5HTP linear curve range and sensitivity.

[0099] The preparation of the inductive bacteria refers to steps 1 to 2 of Example 2.

[0100] 1. The total detection volume in the fluorescent ELISA plate is 100μL. Take 89μL of the resuspended bacterial solution of the induction bacteria (containing 5mM MgSO4), 1μL of the fluorescent dye DFHBI-1T (dissolved in DMSO, final concentration 50μM), 10μL of PBS buffer (pH7.4, 50mM) containing different concentrations of 4F-5HTP, set 8 different concentrations of 4F-5HTP, and the final concentrations are 0mM, 0.1mM, 0.5mM, 1mM, 2mM, 5mM, 10mM, and 20mM. The excitation light Ex of the Thermo Fisher ELISA instrument is 472nm, the emission light Em is 520nm, the gain parameter is set to 50, and the fluorescence detection is performed at 3h.

[0101] The above method can use a more convenient kit, such as 100 volumes of PBS buffer supernatant after ultrasonic disruption of 4F-5HTP sensing bacterial RNA aptamer, 5mM MgSO4, and 1 volume of fluorescent dye DFHBI-1T (dissolved in DMSO, final concentration 5mM). The three are mixed as a fluorinated 5-hydroxytryptophan detection kit and stored in a -20°C refrigerator for use. When in use, take 1 volume (10μL) of the test solution and 9 volumes (90μL) of the dissolved kit, mix them in a 96-well fluorescent enzyme plate, and perform fluorescence detection at 3h. The excitation light parameter of the Thermo Fisher microplate reader is set to Ex: 472nm; the emission light parameter is set to Em: 520nm, and the gain parameter is set to 50.

[0102] The results are as follows Figure 5 The results showed that under the standard system, the detection range of 4F-5HTP can reach 0-20mM, the linear range can reach 0-2mM, and the sensitivity can reach μM level.

[0103] Example 5. Substrate specificity and fluorescence background noise detection.

[0104] The preparation of the inductive bacteria refers to steps 1 to 2 of Example 2.

[0105] 1. The total detection volume in the fluorescent ELISA plate is 100μL. Take 89μL of the resuspended bacterial solution of the sensing bacteria (containing 5mM MgSO4), 1μL of the fluorescent dye DFHBI-1T (dissolved in DMSO, final concentration 50μM), 10μL of PBS buffer (pH7.4, 50mM) containing different compounds, and set up 5 groups of different compound controls: 1. Negative control (without any compound); 2. 10mM indole; 3. 10mM Trp; 4. 10mM tryptamine; 5. 10mM 5-hydroxytryptamine; 6. 10mM 4HTP; 7. 10mM 6HTP; 8. 10mM 5HTP; 9. 10mM 4F-5HTP; 10. 10mM 6F-5HTP. The excitation light Ex of the Thermo Fisher microplate reader was 472 nm, the emission light Em was 520 nm, the gain parameter was set to 50, and fluorescence detection was performed at 3 h.

[0106] The above method can use a more convenient kit, such as 100 volumes of PBS buffer supernatant after ultrasonic disruption of 4F-5HTP sensing bacterial RNA aptamer, 5mM MgSO4, and 1 volume of fluorescent dye DFHBI-1T (dissolved in DMSO, final concentration 5mM). The three are mixed as a fluorinated 5-hydroxytryptophan detection kit and stored in a -20°C refrigerator for use. When in use, take 1 volume (10μL) of the test solution and 9 volumes (90μL) of the dissolved kit, mix them in a 96-well fluorescent enzyme plate, and perform fluorescence detection at 3h. The excitation light parameter of the Thermo Fisher microplate reader is set to Ex: 472nm; the emission light parameter is set to Em: 520nm, and the gain parameter is set to 50.

[0107] The results are as follows Figure 6 As shown. The results show that the background fluorescence values ​​of 4F-5HTP analogs, such as tryptophan, tryptamine, indole, etc., are basically the same as those of the blank control, indicating that the detection reaction is very specific. In summary, the high-throughput screening based on Broccoli / DFHBI / 4F-5HTP biosensor is feasible and effective under the principle and standard system, and has the potential to be further developed into a well plate and microfluidic screening system.

[0108] Example 6. Fluorescence determination of the optimal induction time of sensing bacteria.

[0109] 1. Take out the frozen induction bacteria from the -80℃ refrigerator, streak them on the resistant (100μg / mL Amp) LB plate, and culture them in a 37℃ constant temperature incubator for 24h. Pick a single colony in 5mL LB (100μg / mL Amp), and culture it overnight at 37℃ 220rpm. The OD600 of the overnight culture is about 1.6. Take 1mL of the overnight cultured induction bacteria and place it in 100mL LB (100μg / mLAmp) at a ratio of 1:100. After about 2h20min of culture at 37℃ and 220rpm, it can reach the logarithmic growth phase, and its OD600 is about 0.52 (in the range of OD600: 0.4~0.6). At this time, add IPTG with a final concentration of 1mM, culture at 37°C and 220rpm, set different induction times, namely 1h, 2h, 4h, 8h, 16h, and 24h, and take out the bacteria at different times above (Note: the induction bacteria must be prepared before use).

[0110] 2. Take out 100mL of bacteria into multiple 50mL test tubes, centrifuge at 4℃, 4000rpm for 5min, and wash the bacteria once in 20mL 1×M9 salt (final concentration 5mM MgSO4). After washing, use the above M9 salt to concentrate the concentration of the sensing bacteria 5 times (for example: 100mL total volume, finally concentrated to 20mL), and the final resuspended bacteria are used as sensing bacteria for standby.

[0111] 3. The total detection volume in the fluorescence ELISA plate is 100μL. Take 89μL of the resuspended bacterial solution of the induction bacteria (containing 5mM MgSO4), 1μL of the fluorescent dye DFHBI-1T (dissolved in DMSO, final concentration 50μM), 10μL of PBS buffer (pH7.4, 50mM), which is a negative control; 10μL of PBS buffer (pH7.4, 50mM) containing 10mM 4F-5HTP is a positive control. The excitation light Ex of the Thermo Fisher microplate reader is 472nm, the emission light Em is 520nm, the gain parameter is set to 50, and the fluorescence detection is performed at 3h.

[0112] The above method can use a more convenient kit, such as 100 volumes of PBS buffer supernatant after ultrasonic disruption of 4F-5HTP sensing bacterial RNA aptamer, 5mM MgSO4, and 1 volume of fluorescent dye DFHBI-1T (dissolved in DMSO, final concentration 5mM). The three are mixed as a fluorinated 5-hydroxytryptophan detection kit and stored in a -20°C refrigerator for use. When in use, take 1 volume (10μL) of the test solution and 9 volumes (90μL) of the dissolved kit, mix them in a 96-well fluorescent enzyme plate, and perform fluorescence detection at 3h. The excitation light parameter of the Thermo Fisher microplate reader is set to Ex: 472nm; the emission light parameter is set to Em: 520nm, and the gain parameter is set to 50.

[0113] The results are as follows Figure 7 As shown. The results show that the effect of fluorescence detection of sensing bacteria at different induction times will be very different, so the induction time of sensing bacteria needs to be optimized. By measuring the fluorescence response signal of sensing bacteria at different induction times, the optimal induction time of sensing bacteria is 4h. After 4h, the activity of the induced expression of functional RNA sequence will gradually decrease with the increase of induction time, and basically lose its function at 24h of induction.

[0114] Example 7.4F-5HTP community strain bacterial fluorescence determination.

[0115] The plasmid construction of 4F-5HTP community strain ("production-sensing integrated bacteria") is shown in Example 1.

[0116] 1. Take out the frozen 4F-5HTP community strain from the -80℃ refrigerator, streak it on the resistant (5μg / mL Cm, 50μg / mL Kan) LB plate, and culture it in a constant temperature incubator at 37℃ for 24h. Pick a single colony in 5mL LB (5μg / mL Cm, 50μg / mL Kan), and culture it overnight at 37℃ and 220rpm. The OD600 of the overnight cultured bacteria is about 1.6. Take 1mL of the overnight cultured inductive bacteria and place it in 100mL TB (5μg / mL Cm, 50μg / mL Kan and 50μg / mL FeSO4) at a ratio of 1:100. After about 2h20min of culture at 37℃ and 220rpm, it can reach the logarithmic growth phase, and its OD600 is about 0.52 (in the range of OD600: 0.4-0.6). At this time, IPTG with a final concentration of 1 mM and substrate 4F-Trp with a final concentration of 10 mM were added, and cultured at 37°C and 220 rpm. The reaction solution was taken out at 24 hours.

[0117] 2. Take out 20 mL of the above-mentioned integrated bacterial cells and put them into a 50 mL test tube. Centrifuge at 4°C and 4000 rpm for 15 min. Take out the supernatant and add MgSO4 with a final concentration of 5 mM.

[0118] 3. Take 99 μL of the above-mentioned bacterial supernatant (containing 5 mM MgSO4), 1 μL of fluorescent dye DFHBI-1T (dissolved in DMSO, final concentration 50 μM), and the total detection volume in the fluorescent ELISA plate is 100 μL. The excitation light Ex: 472 nm, the emission light Em: 520 nm, the gain parameter is set to 50, and the fluorescence detection is performed at 3 h.

[0119] 4. Set up different groups of controls as follows.

[0120] Negative control: 89 μL of integrated bacteria (dissolved in TB, without substrate 10 mM 4F-Trp) + 10 μL TB + 1 μL DFHBI-1T;

[0121] Positive control 1: 89 μL of integrated bacteria (dissolved in TB, without substrate 10 mM 4F-Trp) + 10 μL TB (added with final concentration of 1 mM 4F-5HTP) + 1 μL DFHBI-1T;

[0122] Positive control 2: 89 μL of integrated bacteria (dissolved in TB, without substrate 10 mM 4F-Trp) + 10 μL TB (added with final concentration of 2 mM 4F-5HTP) + 1 μL DFHBI-1T;

[0123] Experimental group 1: 89 μL of integrated bacteria (dissolved in TB, added with substrate 10 mM 4F-Trp, real reaction system reaction solution) + 10 μL TB + 1 μL DFHBI-1T;

[0124] Experimental group 2: 99 μL of integrated bacteria (dissolved in TB, added with substrate 10 mM 4FTrp real reaction system reaction solution) + 1 μL DFHBI-1T.

[0125] The results are as follows Figure 8 As shown. The results showed that we constructed a "production-sensing integrated bacteria", that is, a 4F-5HTP biosensor functional RNA fragment was added to the 4F-5HTP production strain, intending to achieve the production and sensing of 4F-5HTP in the same strain. However, since the functional RNA sequence gradually loses its activity in the later stage of induction (about 4 hours later), the functional RNA sequence has lost its activity when the actual culture system is sampled and tested at 24 hours. The experimental results also show that at 24 hours, no obvious difference in fluorescence signals was detected between the integrated bacteria and the negative control (strain that does not produce 4F-5HTP), so direct screening using the constructed "production-sensing integrated bacteria" is not feasible.

[0126] Example 8. Determination of the optimal fusion time of production bacteria and sensing bacteria.

[0127] The preparation of the inductive bacteria refers to steps 1 to 2 of Example 2.

[0128] 1. The total detection volume in the fluorescence ELISA plate is 100μL. Take 89μL of the resuspended bacterial solution of the induction bacteria (containing 5mM MgSO4), 1μL of the fluorescent dye DFHBI-1T (dissolved in DMSO, final concentration 50μM), 10μL of PBS buffer (pH7.4, 50mM), which is a negative control; 10μL of PBS buffer (pH7.4, 50mM) containing 10mM 4F-5HTP is a positive control. The excitation light Ex of the Thermo Fisher ELISA instrument is 472nm, the emission light Em is 520nm, and the gain parameter is set to 50. Fluorescence detection is performed at five different time points: 0.5h, 2h, 5h, 10h, and 24h.

[0129] 2. The total detection volume in the fluorescence ELISA plate is 100μL. Take 89μL of the supernatant after ultrasonic disruption of the induction bacteria (containing 5mM MgSO4), 1μL of the fluorescent dye DFHBI-1T (dissolved in DMSO, final concentration 50μM), 10μL of PBS buffer (pH7.4, 50mM), this is the negative control; 10μL of PBS buffer (pH7.4, 50mM) containing 10mM 4F-5HTP is the positive control. The excitation light Ex of the Thermo Fisher ELISA instrument is 472nm, the emission light Em is 520nm, and the gain parameter is set to 50. Fluorescence detection is performed at five different time points: 0.5h, 2h, 5h, 10h, and 24h.

[0130] The results are as follows Fig. 9As shown. The results show that in order to make the detected object 4F-5HTP combine with functional RNA and fluorescent dye DFHBI-1T to produce fluorescence, it is necessary to add the production bacteria of 4F-5HTP and the sensing bacteria containing functional RNA, as well as the fluorescent dye to the same system for reaction. We first tested the method of directly adding the sensing bacteria to the fermentation broth of the production bacteria for reaction. The results showed that when the production bacteria and the sensing bacteria reacted together for 10 hours, the fluorescence value reached the maximum value. Although the reaction time varies according to different actual reaction systems, the overall trend is that the fluorescence value rises rapidly, then tends to be stable and slightly decreases. However, due to the long reaction time, the detection time is increased, which is not conducive to the screening of the real system. Next, we tested the method of ultrasonically breaking the sensing bacteria to release the functional RNA into the supernatant after the sensing bacteria are broken, and then the supernatant is reacted with the fermentation broth of the production bacteria. The results showed that the maximum fluorescence difference can be detected at 0.5h, which greatly shortens the detection time. At the same time, it also avoids the error introduced by the different states of the sensing bacteria and optimizes the detection system.

[0131] Example 9. Background fluorescence noise interference measurement in a real system.

[0132] The preparation of the inductive bacteria refers to steps 1 to 2 of Example 2.

[0133] 1. The total detection volume in the fluorescence ELISA plate is 100μL. Take 89μL of the sensing bacteria (containing 5mM MgSO4), 1μL of the fluorescent dye DFHBI-1T (dissolved in DMSO, final concentration 50μM), set up negative control: 10μL PBS buffer (pH7.4, 50mM); positive control: 10μL PBS buffer (pH7.4, 50mM) containing 10mM 4F-5HTP; 3 experimental groups: 10μL LB, 10μL bacteria, 10μL TB. The excitation light Ex of the Thermo Fisher ELISA reader is 472nm, the emission light Em is 520nm, the gain parameter is set to 50, and the fluorescence detection is performed at 3h.

[0134] The above method can use a more convenient kit, such as 100 volumes of PBS buffer supernatant after ultrasonic disruption of 4F-5HTP sensing bacterial RNA aptamer, 5mM MgSO4, and 1 volume of fluorescent dye DFHBI-1T (dissolved in DMSO, final concentration 5mM). The three are mixed as a fluorinated 5-hydroxytryptophan detection kit and stored in a -20°C refrigerator for use. When in use, take 1 volume (10μL) of the test solution and 9 volumes (90μL) of the dissolved kit, mix them in a 96-well fluorescent enzyme plate, and perform fluorescence detection at 3h. The excitation light parameter of the Thermo Fisher microplate reader is set to Ex: 472nm; the emission light parameter is set to Em: 520nm, and the gain parameter is set to 50.

[0135] The results are as follows Fig.10 As shown in the figure, we further tested the effects of culture medium and reaction buffer on the fluorescence signal in the reaction system. The results showed that bacteria, PBS, LB, TB, etc. would cause background fluorescence noise interference to the screening system to varying degrees. TB had more nutrients than LB, so the interference was greater, but the overall interference was weak and relatively stable, and would not interfere with the screening in the real system.

[0136] Example 10. Determination of the goodness of fit between the fluorescence values ​​of 4F-5HTP at different concentrations and liquid phase detection.

[0137] The preparation of the inductive bacteria refers to steps 1 to 2 of Example 2.

[0138] 1. The total detection volume in the fluorescence ELISA plate is 100 μL. Take 89 μL of the sensing bacteria (containing 5 mM MgSO4), 1 μL of the fluorescent dye DFHBI-1T (dissolved in DMSO, final concentration 50 μM), and 10 μL of the supernatant of 10 real system reaction solutions containing different concentrations of 4F-5HTP. The excitation light Ex: 472 nm, the emission light Em: 520 nm, the gain parameter is set to 50, and the fluorescence detection is performed at 3 hours.

[0139] 2. The concentrations of the supernatants of the above 10 real system reaction solutions containing different concentrations of 4F-5HTP were determined by liquid chromatography, and linear fitting curves of fluorescence and peak area were drawn.

[0140] The above method can use a more convenient kit, such as 100 volumes of PBS buffer supernatant after ultrasonic disruption of 4F-5HTP sensing bacterial RNA aptamer, 5mM MgSO4, and 1 volume of fluorescent dye DFHBI-1T (dissolved in DMSO, final concentration 5mM). The three are mixed as a fluorinated 5-hydroxytryptophan detection kit and stored in a -20°C refrigerator for use. When in use, take 1 volume (10μL) of the test solution and 9 volumes (90μL) of the dissolved kit, mix them in a 96-well fluorescent enzyme plate, and perform fluorescence detection at 3h. The excitation light parameter of the Thermo Fisher microplate reader is set to Ex: 472nm; the emission light parameter is set to Em: 520nm, and the gain parameter is set to 50.

[0141] The results are as follows Fig.11 The results show that the fitting degree between the fluorescence value and the liquid phase detection value in the actual system can reach above 0.9, which meets the actual screening requirements.

[0142] Example 11. Determination of droplet fluorescence signal.

[0143] The preparation of the inductive bacteria refers to steps 1 to 2 of Example 2.

[0144] The total volume of droplet embedding is composed of sensing bacteria (containing 5mM MgSO4), which is divided into two types: non-ultrasonicated bacteria and ultrasonically broken bacteria; and the other part is the fluorescent dye DFHBI-1T (dissolved in DMSO, final concentration 50μM). The following 5 groups of different controls are set up, negative control 1 (1.5mM 4F-5HTP is added to the empty culture medium, and the left and right are bright field and fluorescent field, respectively), positive control 2 (1.5mM 4F-5HTP is added to the sensing bacteria, and the left and right are bright field and fluorescent field, respectively), positive control 3 (5mM 4F-5HTP is added to the sensing bacteria, and the left and right are bright field and fluorescent field, respectively), and positive control 4 (1.5mM 4F-5HTP is added to the supernatant of ultrasonically broken sensing bacteria). The above samples were observed and detected by microscope at the excitation light Ex: 472nm and the emission light Em: 520nm at 1h after droplet fusion.

[0145] The results are as follows Fig.12As shown. The results show that based on the research results of the well plate, we further developed a droplet microfluidic detection and screening method based on the 4F-5HTP biosensor. We tested two methods, one of which was to embed and grow droplets containing 4F-5HTP (replaced by production bacteria in actual screening) and droplets containing sensing bacteria separately, and then fuse them for detection. The other method was to ultrasonically break the sensing bacteria, take out only the supernatant containing functional RNA, and then add it to the droplets containing 4F-5HTP (replaced by production bacteria in actual screening) through droplet fusion for detection. The results show that by taking the supernatant containing 4F-5HTP biosensor functional RNA after ultrasonic sensing bacteria, a strong fluorescence signal can be observed within 1 hour of droplet fusion, which not only overcomes the problem of pore blockage caused by excessive bacterial concentration in droplet fusion, but also shortens the fluorescence reaction time, solves the problem of low fluorescence signal due to conventional culture of sensing bacteria, and confirms the feasibility of establishing droplet microfluidic screening technology based on 4F-5HTP biosensor.

[0146] The above are only preferred embodiments of the present invention. It should be pointed out that, for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. The aptamer of fluorinated 5-hydroxytryptophan RNA, from the 5' end to the 3' end, is tRNA scaffold 1, aptamer 1 of DFHBI-1T, connection module 1, aptamer of fluorinated 5-hydroxytryptophan, connection module 2, aptamer 2 of DFHBI-1T, tRNA scaffold 2; in: tRNA scaffold 1 has the nucleic acid sequence shown in SEQ ID NO: 1; tRNA scaffold 2 has the nucleic acid sequence shown in SEQ ID NO: 2; The aptamer 1 of DFHBI-1T has the nucleic acid sequence shown in SEQ ID NO: 3; The aptamer 2 of DFHBI-1T has the nucleic acid sequence shown in SEQ ID NO:4; The aptamer for fluorinated 5-hydroxytryptophan has the nucleic acid sequence shown in SEQ ID NO: 5; Linking module 1 and linking module 2 are independently selected from TA, TAT, TATA or TATAT.

2. The aptamer according to claim 1, characterized in that Its nucleic acid sequence is shown in SEQ ID NO:8 or SEQ ID NO:

9.

3. A recombinant plasmid comprising the aptamer according to claim 1 or 2.

4. The recombinant plasmid according to claim 3, characterized in that Its backbone vector is pETDuet-1.

5. An inductive bacterium comprising the recombinant plasmid 1 according to claim 3 or 4.

6. The inductive bacteria according to claim 5, characterized in that: Its host is Escherichia coli.

7. A reagent comprising the sensing bacteria according to claim 5 or 6, a fluorescent dye DFHBI-1T, magnesium ions and a reaction buffer.

8. The reagent according to claim 7, characterized in that The reaction buffer is PBS buffer or M9 buffer, the concentration of the magnesium ions is 1 to 10 mM, and the concentration of the fluorescent dye DFHBI-1T is 1 to 10 mM.

9. The reagent according to claim 7 or 8, characterized in that The inductive bacteria are broken.

10. A method for preparing the reagent according to any one of claims 7 to 9, comprising: The recombinant plasmid according to claim 3 or 4 is transformed into Escherichia coli, and after culturing, the bacteria are mixed with the fluorescent dye DFHBI-1T, magnesium ions and a buffer solution and then the bacteria are broken.

11. Use of the reagent according to any one of claims 7 to 10 in preparing a kit having at least one of the following functions (a1) to (a4): (a1) Detection of the content of fluorinated 5-hydroxytryptophan; (a2) Detection of tryptophan hydroxylase activity; (a3) Performance screening of tryptophan hydroxylase; (a4) Directed evolution screening of tryptophan hydroxylase.

12. A kit for detecting the content of fluorinated 5-hydroxytryptophan, comprising: The reagent according to any one of claims 7 to 10.

13. A method for detecting the content of fluorinated 5-hydroxytryptophan, comprising detecting a sample with the kit according to claim 12, and determining the content of fluorinated 5-hydroxytryptophan according to the fluorescence intensity.

14. A kit for detecting the activity, screening the performance or directed evolution of tryptophan hydroxylase, comprising the reagent according to any one of claims 7 to 10 and a fluorinated 5-hydroxytryptophan producing bacterium; The tnaA gene in the fluorinated 5-hydroxytryptophan producing bacteria is knocked out, and the bacteria are transformed with recombinant plasmid 2 and recombinant plasmid 3; The recombinant plasmid 2 includes a nucleic acid fragment encoding the tryptophan hydroxylase to be tested; The recombinant plasmid 3 includes nucleic acid fragments encoding mtrA, PTPS, SPR, PCD and DHPR.

15. A method for activity detection, performance screening or directed evolution screening of tryptophan hydroxylase and / or tryptophan decarboxylase, comprising: The nucleic acid fragment encoding the tryptophan hydroxylase and / or tryptophan decarboxylase to be tested is connected to the recombinant plasmid 2, and then transformed together with the recombinant plasmid 3 into a host in which the tnaA gene is knocked out to obtain a production bacterium. The production bacteria is mixed with the reagent according to any one of claims 7 to 10, the content of fluorinated 5-hydroxytryptophan is determined according to the fluorescence intensity, and then the activity or performance of tryptophan hydroxylase and / or tryptophan decarboxylase is determined according to the content of fluorinated 5-hydroxytryptophan.

Images