GPIHBP1 mutant gene and its application

Abstract

The present invention discloses GPIHBP1 Mutant genes and applications. The present invention has obtained a series of GPIHBP1 The mutant gene and its mutant protein were identified, and the binding ability of the mutant protein to LPL was verified. The study of the binding ability of the GPIHBP1 mutant protein to LPL can be further used as a basis for judging whether the mutation site can further serve as the pathogenicity of hypertriglyceridemia acute pancreatitis. The present invention also discloses a method for constructing a spontaneous HTG-AP animal model.

Description

Technical Field

[0001] The invention belongs to the technical field of gene engineering, and specifically relates to a GPIHBP1 mutant gene and an application thereof. Background Art

[0002] Acute pancreatitis (AP) refers to the activation of pancreatic enzymes caused by various etiologies, followed by local inflammatory reactions in the pancreas, with or without changes in other organ functions. Biliary tract disease, alcohol, and hypertriglyceridemia are the three most common causes of acute pancreatitis. Hypertriglyceridemia acute pancreatitis (HTG-AP) is more severe and has a significant recurrence trend compared with pancreatitis of other etiologies. Studies have shown that hyperlipidemia acute pancreatitis is mainly characterized by elevated serum triglycerides (TG), but has nothing to do with serum cholesterol. In recent years, the incidence of HTG-AP has been on the rise. Foreign studies have shown that HTG-AP currently accounts for about 1.3% to 6.9% of the total number of APs, second only to biliary pancreatitis and alcoholic pancreatitis. The results of many domestic clinical studies show that HTG-AP accounts for as high as 7.8% to 25.6% of APs, and has exceeded alcoholic AP, ranking second.

[0003] Hypertriglyceridemia (HTG) is mainly divided into primary HTG and secondary HTG according to its etiology. Secondary HTG is mainly caused by metabolic diseases such as pregnancy, drugs, high-fat and high-protein diet, diabetes, obesity, hypothyroidism, nephrotic syndrome, etc. Primary HTG is mainly caused by gene defects, including lipoprotein lipase gene (LPL), glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1 gene (GPIHBP1), lipase maturation factor 1 gene (LMF1), apolipoprotein C2 (APOC2), apolipoprotein A5 (APOA5) and other related gene defects.

[0004] GPIHBP1 is a GPI-anchored protein in capillary endothelial cells that plays a key role in the lipolysis of triglyceride-rich lipoproteins (TRLs). It can bind to LPL and chylomicrons, acting as a lipolysis platform, and GPIHBP1 is also involved in the transport of LPL to capillary endothelial cells. Most of the GPIHBP1 mutations reported so far interfere with the folding of the protein and abolish the ability of GPIHBP1 to bind and transport LPL.

[0005] It is also widely reported in the prior art that the GPIHBP1 protein in normal people can bind and transport LPL, but when the GPIHBP1 protein has a pathogenic mutation, it will not be able to bind to LPL, leading to the occurrence of HTG-AP. Therefore, the ability of GPIHBP1 protein to bind to LPL can be used to determine the risk of HTG-AP.

[0006] At present, patients with GPIHBP1 gene mutations show severe hypertriglyceridemia or chylomicronemia, repeated attacks of acute pancreatitis, severe pancreatitis, and a high incidence of multiple organ dysfunction. However, there are still many unknown gene mutation sites for the GPIHBP1 gene. In order to further study the pathogenic mechanism of HTG-AP, isolating new pathogenic genes is of great significance for the diagnosis, treatment and prevention of HTG-AP. Summary of the invention

[0007] Purpose of the invention: The technical problem to be solved by the present invention is to provide a GPIHBP1 mutant gene.

[0008] The technical problem that the present invention needs to solve is to provide the GPIHBP1 mutant protein.

[0009] The technical problem that the present invention needs to solve is to provide an expression cassette, a recombinant vector, a recombinant cell or a recombinant bacterium.

[0010] The final technical problem to be solved by the present invention is to provide a method for constructing a spontaneous HTG-AP animal model.

[0011] Technical solution: To solve the above technical problems, the present invention provides a GPIHBP1 mutant gene, wherein the GPIHBP1 mutant gene undergoes one or more of the following mutations in the human GPIHBP1 wild-type gene:

[0012] Inserting four nucleotides GCGG between nucleotides 40 and 41 in the first exon of the wild-type GPIHBP1 gene; as shown in SEQ ID NO.3 in the sequence listing;

[0013] Insert 6 nucleotides GAGGAA between nucleotides 72-73 of the second exon region of the GPIHBP1 wild-type gene; see SEQ ID NO.4 in the sequence table;

[0014] The nucleotide at position 112 of the second exon region of the wild-type GPIHBP1 gene mutates from T to G; see SEQ ID NO.5 in the sequence table;

[0015] The nucleotide A at position 271 in the third exon of the wild-type GPIHBP1 gene is mutated to nucleotide G; see SEQ ID NO.6 in the sequence table;

[0016] The nucleotide T at position 388 in the 4th exon of the wild-type GPIHBP1 gene is mutated to a nucleotide G; see SEQ ID NO.7 in the sequence table;

[0017] In the 473rd nucleotide G of the 4th exon region of the wild-type GPIHBP1 gene, the nucleotide is mutated to an A, as shown in SEQ ID NO. 8 in the sequence table.

[0018] The present invention also includes a GPIHBP1 mutant protein, wherein the GPIHBP1 mutant protein has one or more of the following mutations in the amino acid sequence of the human GPIHBP1 wild-type protein:

[0019] The aminophenylalanine at position 14 of the wild-type GPIHBP1 protein mutated to cysteine, and a frameshift mutation occurred;

[0020] The wild-type GPIHBP1 protein has duplications of glutamic acid at position 28 and glutamic acid at position 29, and a frameshift mutation;

[0021] The amino acid tyrosine at position 38 of the wild-type GPIHBP1 protein was mutated to aspartic acid;

[0022] The amino acid threonine at position 91 of the wild-type GPIHBP1 protein was mutated to alanine;

[0023] The amino acid cysteine ​​at position 130 of the wild-type GPIHBP1 protein was mutated to glycine;

[0024] The amino acid arginine at position 158 of the wild-type GPIHBP1 protein was mutated to glutamine.

[0025] The present invention also includes an expression cassette, a recombinant vector, a recombinant cell or a recombinant bacterium, which contains the mutant gene.

[0026] Wherein, the recombinant vector is obtained by introducing the mutant gene into an expression plasmid.

[0027] A recombinant cell is obtained by introducing the mutant gene into a vector to obtain a recombinant vector, and then introducing the recombinant vector into a host cell.

[0028] The present invention also includes a method for immunoprecipitation of the GPIHBP1 mutant protein and LPL protein, comprising the following steps:

[0029] 1) Sample lysis for protein sample extraction;

[0030] 2) Pre-purify protein samples;

[0031] 3) Co-incubate the protein sample with the IP antibody to obtain an antigen-antibody complex;

[0032] 4) Co-precipitation: Add protein beads to the protein sample and IP antibody co-incubation complex.

[0033] The present invention also includes a primer pair for detecting the GPIHBP1 mutant gene, the primer pair including a primer pair GP1 for detecting exons 1 and 2 of the GPIHBP1 gene or a primer pair GP3 for detecting exons 3 and 4 of the GPIHBP1 gene, the sequence of the primer pair GP1 is shown in SEQ ID NO.9 and SEQ ID NO.10, and the sequence of the primer pair GP3 is shown in SEQ ID NO.11 and SEQ ID NO.12.

[0034] Among them, the detection conditions are as follows: PCR reaction conditions: 95°C pre-denaturation for 5 min, 95°C renaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 1 min, a total of 40 cycles, and finally 72°C extension for 10 min.

[0035] The present invention also includes a detection kit, which contains the primer pair.

[0036] Wherein, the detection kit also includes a DNA amplification enzyme for PCR and a corresponding buffer.

[0037] The present invention also includes the use of the GPIHBP1 mutant gene, the expression cassette, the recombinant vector, the recombinant cell or the recombinant bacteria, the primer pair, and the detection kit in the preparation of a reagent or a kit for diagnosing pancreatitis.

[0038] Wherein, the pancreatitis includes hypertriglyceridemia acute pancreatitis.

[0039] The present invention also includes a method for constructing a spontaneous HTG-AP animal model, wherein the GPIHBP1 gene in an animal is knocked out to obtain a Gpihbp1 gene knockout animal, and then the Gpihbp1 gene knockout animal is fed with a high-fat diet. Preferably, the animal includes a rat.

[0040] The high-fat feed includes feed in which the fat calorie ratio is greater than or equal to 60%.

[0041] The applicant of the present invention previously constructed mice with Gpihbp1 gene knockout and fed them with a high-fat diet, but they could not induce a spontaneous HTG-AP mouse model. Therefore, it is shown that the gene knockout animal must be a rat to induce the spontaneous HTG-AP rat model.

[0042] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: the present invention obtains a series of GPIHBP1 mutant genes and mutant proteins thereof through experiments, and verifies the binding ability of the mutant proteins to LPL. The study on the binding ability of the GPIHBP1 mutant proteins to LPL can further serve as a basis for judging whether the mutation site can further serve as the pathogenicity of hypertriglyceridemia acute pancreatitis. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 , c.40_41insGCGG (p.Phe14CysfsTer25) mutation Sanger sequencing results;

[0044] Figure 2 , c.84_89dup (p.Glu28_Glu29dup) mutation Sanger sequencing results;

[0045] Figure 3 , c.T112G (p.Tyr38Asp) mutation Sanger sequencing results;

[0046] Figure 4 , c.A271G (p.Thr91Ala) mutation Sanger sequencing results;

[0047] Figure 5 , c.T388G (p.Cys130Gly) mutation Sanger sequencing results;

[0048] Figure 6 , c.G473A (p.Arg158Gln) mutation Sanger sequencing results;

[0049] Figure 7 , the concentration of the constructed wild-type LPL plasmid;

[0050] Figure 8 , the concentration of the constructed wild-type GPIHBP1 plasmid;

[0051] Fig. 9, the concentration of the constructed GPIHBP1-c.40_41insGCGG plasmid;

[0052] Fig.10 , the concentration of the constructed GPIHBP1-c.84_89dup plasmid;

[0053] Fig.11 , the concentration of the constructed GPIHBP1-c.112T>G plasmid;

[0054] Fig.12 , the concentration of the constructed GPIHBP1-c.271A>G plasmid;

[0055] Fig.13 , the concentration of the constructed GPIHBP1-c.388T>G plasmid;

[0056] Fig.14 , the concentration of the constructed GPIHBP1-c.473G>A plasmid;

[0057] Fig.15 , the results of restriction enzyme digestion verification of the constructed plasmid - agarose gel electrophoresis;

[0058] Fig.16 , co-immunoprecipitation (CO-IP) experimental flow chart;

[0059] Fig.17 , the ability of GPIHBP1 p.Phe14CysfsTer25 mutant protein to bind to LPL;

[0060] Fig.18 , the ability of GPIHBP1 p.Glu28_Glu29dup mutant protein to bind to LPL;

[0061] Fig.19 , the ability of GPIHBP1 p.Y38D mutant protein to bind to LPL;

[0062] Fig. 20 , the ability of GPIHBP1 p.T91A mutant protein to bind to LPL;

[0063] Fig.21 , the ability of GPIHBP1 p.C130G mutant protein to bind to LPL;

[0064] Fig. 22 , the ability of GPIHBP1 p.R158Q mutant protein to bind to LPL;

[0065] Fig.23 , Gpihbp1 knockout rats showed severe hypertriglyceridemia;

[0066] Fig.24 , high fat diet Gpihbp1 - / - Induce spontaneous HTG-AP in rats;

[0067] Fig.25 , the relationship between GPIHBP1 c.41G>T genotype and TG peak. DETAILED DESCRIPTION

[0068] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0069] Example 1

[0070] 1. GPIHBP1 gene detection in a large sample HTG-AP population cohort

[0071] The screening subjects of the present invention include 500 HTG-AP patients (282 males and 218 females) admitted to the Severe Acute Pancreatitis Center of the Eastern Theater General Hospital from June 2018 to December 2022, with an average age of onset of about 37 years (29-43 years old). Based on high-throughput sequencing technology, whole exon gene sequencing was carried out, and a total of 6 rare missense mutations (listed in the present invention), 1 common missense mutation (c.G41T, p.C14F), 2 synonymous mutations (c.C12T, p.L4L; c.G138T, p.V46V, non-pathogenic) and 65 intron region mutations (non-pathogenic) were detected.

[0072] Six rare missense mutations were detected in HTG-AP patients. The mutation details and pathogenicity study results are shown in Example 2. The results confirmed that they were all pathogenic mutations.

[0073] The clinical characteristics and TG levels of HTG-AP patients with a common missense mutation, c.G41T (p.C14F), were analyzed using SPSS 25.0 statistical software (IBM Analytics, Armonk, NY). Continuous variables were expressed as medians and percentiles (first and third percentiles), and the significance was determined by T test; categorical variables were expressed as numbers and percentages, and the significance was determined by chi-square test; P values ​​less than 0.05 were considered statistically significant.

[0074] According to the GPIHBP1 c.41G>T mutation, HTG-AP patients were divided into a non-mutation group (WT) and a mutation group (SNP). The average age of AP onset in both the WT and SNP groups was 37 years old, with no significant difference between the two groups. The proportions of mild, moderate, and severe AP in the SNP group were 30.08%, 2.54%, and 67.37%, respectively. Compared with the non-mutation group, the incidence of MAP was higher; the recurrence rate of AP in the mutation group was 44.49%, which was higher than that in the WT group (38.32%).

[0075] Table 1 GPIHBP1 c.41G>T genotype and HTG-AP

[0076]

[0077]

[0078] In addition, the present invention also analyzed the GPIHBP1 c.41G>T phenotype and the highest level of TG in the acute phase of AP patients (TG peak ). According to the mutation of GPIHBP1 gene site 41, the patients were divided into three groups: TT group, i.e. homozygous mutation group; GT group, i.e. heterozygous mutation group and GG group, i.e. non-mutation group. Fig.25 As shown, the peak levels of acute TG in the GG, GT, and TT groups were 30.99mmol / L, 27.27mmol / L, and 31.53mmol / L, respectively, and the TG level in homozygous mutation carriers was the highest (but not statistically significant). Based on the above results, the present invention believes that GPIHBP1 c.41G>T is a benign mutation and is therefore not included in the present invention.

[0079] 2. Detection of GPIHBP1 gene mutation in HTG-AP patients

[0080] Among the 500 patients in the previous big data, 187 patients (37.40%) had a long history of HTG, and the median highest TG level at the onset of HTG-AP was 22.5mmol / L (15.8-32.8mmol / L). The proportions of MAP, MSAP, and SAP were 26.57%, 8.32%, and 65.11%, respectively. Among them, 211 patients (42.2%) had a history of recurrent acute pancreatitis. After being informed of the specific circumstances of the study, the patients agreed to participate in the study and signed the informed consent. 2ml of peripheral anticoagulated blood was collected from the patients, and the human whole exome gene detection technology based on next generation sequencing (NGS) was used to perform sequencing screening on the blood samples of HTG-AP patients included in the study. Blood samples that showed rare pathogenic mutations in GPIHBP1 were further verified by Sanger sequencing.

[0081] The primers used in the first-generation Sanger sequencing of the present invention include the following primer pairs, and the information of the primer pairs is shown in Table 2:

[0082] Table 2 Detection primer pairs

[0083] GP1 5---3 PF CCTTCATCCCACTTACCGCAGC SEQ ID NO.9 PR AGCCTCATCCCCTCCTTCTTCC SEQ ID NO.10 GP3 5---3 PF GGACGTGAGTGATGATGGGA SEQ ID NO.11 PR GGAACAAGTGCTGAGGATGG SEQ ID NO.12

[0084] Among them, the primer pair GP1 is a primer pair for exons 1 and 2 of the GPIHBP1 gene; the primer pair GP3 is a primer pair for exons 3 and 4 of the GPIHBP1 gene. The above primer pairs are used to detect the mutant gene of GPIHBP1.

[0085] The specific testing conditions are as follows:

[0086] PCR reaction conditions: 95°C pre-denaturation for 5 min, 95°C renaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 1 min, a total of 40 cycles, and a final extension at 72°C for 10 min.

[0087] The detection system is shown in Table 3:

[0088] Table 3 PCR reaction system (20 μL)

[0089] ddH2O 14.8μL 10x buffer 2μL dNTP 1μL Taq enzyme 0.2μL Forward primer 0.5μL Reverse primer 0.5μL DNA 1μL

[0090] Through genetic testing and analysis, a total of 6 rare pathogenic mutations of the GPIHBP1 gene were screened:

[0091] 1. p.F14CfsTer25 mutation

[0092] Insertion of four nucleotides GCGG between nucleotides 40-41 in the first exon of the human GPIHBP1 gene (GENEBANK ID NO.: NG_034256.1), resulting in the mutation of aminophenylalanine at position 14 of the GPIHBP1 protein to cysteine ​​and premature termination of protein translation, c.40_41insGCGG (p.Phe14CysfsTer25);

[0093] 2. p.E28_E29dup mutation

[0094] Insertion of 6 nucleotides GAGGAA between nucleotides 72-73 in the second exon region of the human GPIHBP1 gene (GENEBANK ID NO.: NG_034256.1), i.e. duplication of nucleotides AGAGGA at positions 84-89, leads to duplication of glutamic acid at positions 28 and 29 of the GPIHBP1 protein, c.84_89dup (p.Glu28_Glu29dup);

[0095] 3. p.Y38D mutation

[0096] In the exon 2 of the human GPIHBP1 gene (GENEBANK ID NO.: NG_034256.1), the nucleotide T at position 112 mutated to the nucleotide G, resulting in the amino acid tyrosine at position 38 of the GPIHBP1 protein mutated to aspartic acid, c.T112G (p.Tyr38Asp);

[0097] 4. p.T91A mutation

[0098] In the exon 3 region of the human GPIHBP1 gene (GENEBANK ID NO.: NG_034256.1), the nucleotide A at position 271 mutated to nucleotide G, resulting in the mutation of the amino acid threonine at position 91 of the GPIHBP1 protein to alanine, c.A271G (p.Thr91Ala);

[0099] 5. p.C130G mutation

[0100] In the human GPIHBP1 gene (GENEBANK ID NO.: NG_034256.1), the nucleotide T at position 388 mutated to nucleotide G, resulting in the mutation of amino acid cysteine ​​at position 130 of the GPIHBP1 protein to glycine, c.T388G (p.Cys130Gly);

[0101] 6. p.R158Q mutation

[0102] In the human GPIHBP1 gene (GENBANK ID NO.: NG_034256.1), the nucleotide G at position 473 mutated to nucleotide A, resulting in the mutation of amino acid arginine at position 158 of the GPIHBP1 protein to glutamine, c.G473A (p.Arg158Gln);

[0103] In summary, through the GPIHBP1 gene detection of HTG-AP patients in the Eastern Theater General Hospital, the following 6 mutations were found in HTG-AP patients: c.40_41insGCGG (p.Phe14CysfsTer25), c.84_89dup (p.Glu28_Glu29dup), c.112T>G (p.Tyr38Asp), c.271A>G (p.Thr91Ala), c.388T>G (p.Cys130Gly), and c.473G>A (p.Arg158Gln), a total of 6 rare GPIHBP1 mutations. Some patients carried the GPIHBP1p.T91A heterozygous mutation in addition to the GPIHBP1p.F14CfsTer25 heterozygous mutation.

[0104] Example 2 Preparation of plasmid

[0105] 1. Plasmid construction

[0106] Nanjing GenScript Biotechnology Co., Ltd. was commissioned to synthesize the wild-type LPL cDNA sequence (with V5-tag added to the N-terminus) and the GPIHBP1 cDNA sequence (with S-tag added to the N-terminus), which were cloned into the pcDNA3.1(+) plasmid vector using restriction endonucleases (BamHI / EcoRI). Then, the relevant SNP sites were introduced by site-directed mutagenesis using specific primers to prepare mutant plasmids.

[0107] Wild-type LPL cDNA sequence: SEQ ID NO.1

[0108]

[0109] Wild-type GPIHBP1 cDNA sequence: SEQ ID NO.2

[0110] GGATCCATGAAAGAAACCGCTGCTGCTAAATTCGAACGCCAGCACATGGACAGCATGAAGGCGCTCGGGGCTGTCCTGCTTGCCCTCTTGCTGTTCGGGCGGCCAGGGAGAGGGCAGACACAGCAGGAGGAAGAGGAAGAGGACGAGGACCAC GGGCCAGATGACTACGACGAGGAAGATGAGGATGAGGTGGAAGAGGAGGAGACCAACAGGCTCCCTGGTGGCAGGAGCAGAGTGCTGCTGCGGTGCTACACCTGCAAGTCCCTGCCCAGGGACGAGCGCTGCAACCTGACGCAGAACTGCTCAC ATGGCCAGACCTGCACAACCCTCATTGCCCACGGGAACACCGAGTCAGGCCTCCTGACCACCCACTCCACGTGGTGCACAGACAGCTGCCAGCCATCACCAAGACGGTGGAGGGGACCCAGGTGACCATGACCTGCTGCCAGTCCAGCCTGTG CAATGTCCCACCCTGGCAAAGCTCCCGAGTCCAGGACCCAACAGGCAAGGGGGCAGGCGGCCCCCGGGGCAGCTCCGAAACTGTGGGCGCAGCCCTCCTGCTCAACCTCCTTGCCGGCCTTGGAGCAATGGGGGCCAGGAGACCCTGAGAATTC

[0111] Construction of wild-type GPIHBP1 plasmid: The synthetic GPIHBP1 cDNA fragment was cloned into the pcDNA3.1(+) vector using restriction endonucleases BamHI and EcoRI; Construction of mutant GPIHBP1 plasmid: Using a site-directed mutagenesis kit, the desired GPIHBP1 point mutations were sequentially induced based on the pcDNA3.1-GPIHBP1WT plasmid.

[0112] The plasmid construction process is as follows:

[0113] 1. The wild-type LPL cDNA sequence, wild-type GPIHBP1 cDNA sequence and mutant GPIHBP1 cDNA sequence were synthesized respectively and constructed on the pcDNA3.1(+) vector using double restriction endonuclease sites (restriction endonucleases BamHI and EcoRI).

[0114] The specific GPIHBP1 mutation sequence is as follows:

[0115] GPIHBP1-c.40_41insGCGG cDNA sequence SEQ ID NO.3

[0116] ATGAAGGCGCTCGGGGCTGTCCTGCTTGCCCTCTTGCTGTGCGGTCGGGCGGCCAGGGAGAGGGCAGACACAGCAGGAGGAAGAGGAAGAGGACGAGGACCACGGGCCAGATGACTACGACGAGGAAGATGAGGATGAG GTGGAAGAGGAGGAGACCAACAGGCTCCCTGGTGGCAGGAGCAGAGTGCTGCTGCGGTGCTACACCTGCAAGTCCCTGCCCAGGGACGAGCGCTGCAACCTGACGCAGAACTGCTCACATGGCCAGACCTGCACAACCCT CATTGCCCACGGGAACACCGAGTCAGGCCTCTGACCACCCACTCCACGTGGGTGCACAGACAGCTGCCAGCCATCACCAAGACGGTGGAGGGGACCCAGGTGACCATGACCTGCTGCCAGTCCAGCCTGTGCAATGTCC CACCCTGGCAAAGCTCCCGAGTCCAGGACCCAACAGGCAAGGGGGCAGGCGGCCCCCGGGGCAGCTCCGAAACTGTGGGCGCAGCCCTCCTGCTCAACCTCCTTGCCGGCCTTGGAGCAATGGGGGCCAGGAGACCCTGA

[0117] GPIHBP1-c.72_73insGAGGAA cDNA sequence SEQ ID NO.4

[0118] ATGAAGGCGCTCGGGGCTGTCCTGCTTGCCCTCTTGCTGTTCGGGCGGCCAGGGAGAGGG

[0119] CAGACACAGCAGGAGGAAGAGGAAGAGGAAGAGGACGAGGACCACGGGCCAGATGACTACGACGAGGAAGATGAGGATGAGGTGGAAGAGGAGGAGACCAACAGGCTCCCTGGTGGCAGGAGCAGAGTGCTGCTGCGGTGCTACACCTGCAAGTCCCTGCCCAGGGACGAGCGCTGCAACCTGACGCAGAACTGCTCACATGGCCAGACCTGCACAACCCTCATTGCCCACGGGAACACCGAGTCAGGCCTCCTGACCACCCACTCCACGTGGTGCACAGACAGCTGCCAGCCCATCACCAAGACGGTGGAGGGGACCCAGGTGACCATGACCTGCTGCCAGTCCAGCCTGTGCAATGTCCCACCCTGGCAAAGCTCCCGAGTCCAGGACCCAACAGGCAAGGGGGCAGGCGGCCCCCGGGGCAGCTCCGAAACTGTGGGCGCAGCCCTCCTGCTCAACCTCCTTGCCGGCCTTGGAGCAATGGGGGCCAGGAGACCCTGA

[0120] GPIHBP1-c.T112G cDNA sequence SEQ ID NO.5

[0121] ATGAAGGCGCTCGGGGCTGTCCTGCTTGCCCTCTTGCTGTTCGGGCGGCCAGGGAGAGGGCAGACACAGCAGGAGGAAGAGGAAGAGGACGAGGACCACGGGCCAGATGACGACGACGAGGAAGATGAGGATGAGGTGGAAGAGGAGGAGACCAACAGGCTCCCTGGTGGCAGGAGCAGAGTGCTGCTGCGGTGCTACACCTGCAAGTCCCTGCCCAGGGACGAGCGCTGCAACCTGACGCAGAACTGCTCACATGGCCAGACCTGCACAACCCTCATTGCCCACGGGAACACCGAGTCAGGCCTCCTGACCACCCACTCCACGTGGTGCACAGACAGCTGCCAGCCCATCACCAAGACGGTGGAGGGGACCCAGGTGACCATGACCTGCTGCCAGTCCAGCCTGTGCAATGTCCCACCCTGGCAAAGCTCCCGAGTCCAGGACCCAACAGGCAAGGGGGCAGGCGGCCCCCGGGGCAGCTCCGAAACTGTGGGCGCAGCCCTCCTGCTCAACCTCCTTGCCGGCCTTGGAGCAATGGGGGCCAGGAGACCCTGA

[0122] GPIHBP1-c.A271G cDNA sequence SEQ ID NO.6

[0123] ATGAAGGCGCTCGGGGCTGTCCTGCTTGCCCTCTTGCTGTTCGGGCGGCCAGGGAGAGGG

[0124] CAGACACAGCAGGAGGAAGAGGAAGAGGACGAGGACCACGGGCCAGATGACTACGACGAGGAAGATGAGGATGAGGTGGAAGAGGAGGAGACCAACAGGCTCCCTGGTGGCAGGAGCAGAGTGCTGCTGCGGTGCTACACCTGCAAGTCCCTGCCCAGGGACGAGCGCTGCAACCTGACGCAGAACTGCTCACATGGCCAGACCTGCACAGCCCTCATTGCCCACGGGAACACCGAGTCAGGCCTCCTGACCACCCACTCCACGTGGTGCACAGACAGCTGCCAGCCCATCACCAAGACGGTGGAGGGGACCCAGGTGACCATGACCTGCTGCCAGTCCAGCCTGTGCAATGTCCCACCCTGGCAAAGCTCCCGAGTCCAGGACCCAACAGGCAAGGGGGCAGGCGGCCCCCGGGGCAGCTCCGAAACTGTGGGCGCAGCCCTCCTGCTCAACCTCCTTGCCGGCCTTGGAGCAATGGGGGCCAGGAGACCCTGA

[0125] GPIHBP1-c.T388G cDNA sequence SEQ ID NO.7

[0126] ATGAAGGCGCTCGGGGCTGTCCTGCTTGCCCTCTTGCTGTTCGGGCGGCCAGGGAGAGGGCAGACACAGCAGGAGGAAGAGGAAGAGGACGAGGACCACGGGCCAGATGACTACGACGAGGAAGATGAGGATGAGGTGGAAGAGGAGGAGACCAACAGGCTCCCTGGTGGCAGGAGCAGAGTGCTGCTGCGGTGCTACACCTGCAAGTCCCTGCCCAGGGACGAGCGCTGCAACCTGACGCAGAACTGCTCACATGGCCAGACCTGCACAACCCTCATTGCCCACGGGAACACCGAGTCAGGCCTCCTGACCACCCACTCCACGTGGTGCACAGACAGCTGCCAGCCCATCACCAAGACGGTGGAGGGGACCCAGGTGACCATGACCGGCTGCCAGTCCAGCCTGTGCAATGTCCCACCCTGGCAAAGCTCCCGAGTCCAGGACCCAACAGGCAAGGGGGCAGGCGGCCCCCGGGGCAGCTCCGAAACTGTGGGCGCAGCCCTCCTGCTCAACCTCCTTGCCGGCCTTGGAGCAATGGGGGCCAGGAGACCCTGA

[0127] GPIHBP1-c.G473A cDNA sequence SEQ ID NO.8

[0128] ATGAAGGCGCTCGGGGCTGTCCTGCTTGCCCTCTTGCTGTTCGGGCGGCCAGGGAGAGGG

[0129] CAGACACAGCAGGAGGAAGAGGAAGAGGACGAGGACCACGGGCCAGATGACTACGACGAGGAAGATGAGGATGAGGTGGAAGAGGAGGAGACCAACAGGCTCCCTGGTGGCAGGAGCAGAGTGCTGCTGCGGTGCTACACCTGCAAGTCCCTGCCCAGGGACGAGCGCTGCAACCTGACGCAGAACTGCTCACATGGCCAGACCTGCACAACCCTCATTGCCCACGGGAACACCGAGTCAGGCCTCC TGACCACCCACTCCACGTGGTGCACAGACAGCTGCCAGCCCATCACCAGACGGTGGAGGGGACCCAGGTGACCATGACCTGCTGCCAGTCCAGCCTGTGCAATGTCCCACCCTGGCAAAGCTCCCGAGTCCAGGACCCACAGGCAAGGGGGCAGGCGGCCCCAAGGGCAGCTCCGAAACTGTGGGCGCAGCCCTCCTGCTCAACCTCCTTGCCGGCCTTGGAGCAATGGGGGCCAGGAGACCCTGA

[0130] 2. Synthesize primers (specific information of each mutant primer is shown in Table 4), perform PCR amplification on the synthesized plasmid, obtain PCR products respectively and perform electrophoresis detection on them to obtain PCR products with the expected size consistent with the target sequence (i.e., LPL-wt, GPIHBP1-wt, GPIHBP1-c.40_41insGCGG, GPIHBP1-c.84_89dup, GPIHBP1-c.112T>G, GPIHBP1-c.271A>G, GPIHBP1-c.388T>G, and GPIHBP1-c.473G>A), cut the band with the expected size consistent with the target sequence, and recover the product for ligation and transformation.

[0131] Table 4 Primers for site-directed mutagenesis of GPIHBP1

[0132]

[0133] PCR conditions: pre-denaturation: 95°C, denaturation: 95°C, annealing: 60°C, extension: 72°C, 40 cycles, and then stored at 4°C.

[0134] 3. Continuous transfer operation: connect the amplified target gene PCR product (i.e. LPL-wt, GPIHBP1-wt, GPIHBP1-c.40_41insGCGG, GPIHBP1-c.84_89dup, GPIHBP1-c.112T>G, GPIHBP1-c.271A>G, GPIHBP1-c.388T>G, and GPIHBP1-c.473G>A) with the linearized vector (pcDNA3.1(+) plasmid), and transform the ligation product into competent cells (Escherichia coli) by heat shock method. Evenly spread the transformed product coating rod on the LB plate culture medium containing ampicillin antibiotics, and invert the plate in a 37°C incubator for overnight culture.

[0135] 4. Colony screening: Use a sterile pipette tip to pick up 3-6 single colonies and culture them in LB liquid culture medium containing ampicillin resistance. After culture, add nucleic acid dye for electrophoresis detection, select clones with bands consistent with the expected size, shake the bacteria to extract the plasmid, and then sequence it.

[0136] 5. Analysis and processing of sequencing results: Plasmids (i.e., LPL-wt, GPIHBP1-wt, GPIHBP1-c.40_41insGCGG, GPIHBP1-c.84_89dup, GPIHBP1-c.112T>G, GPIHBP1-c.271A>G, GPIHBP1-c.388T>G, and GPIHBP1-c.473G>A, a total of 8 plasmids) were sequenced and compared to determine whether they were correct.

[0137] Plasmid restriction enzyme digestion and Sanger sequencing were used to verify the accuracy of the constructed vector, and monoclonal colonies that met the standards were selected for expansion and culture to prepare bacterial liquid. The enzymes used for plasmid restriction enzyme digestion were LPL-wt (BamHI, EcoRI), GPIHBP1-wt (BamHI, EcoRI), GPIHBP1-c.40_41insGCGG (BamHI, EcoRI), GPIHBP1-c.84_89dup (HindIII, EcoRI), GPIHBP1-c.112T>G (HindIII, EcoRI), GPIHBP1-c.271A>G (HindIII, EcoRI), GPIHBP1-c.388T>G (HindIII, EcoRI), and GPIHBP1-c.473G>A (HindIII, EcoRI). The enzyme digestion process is as follows: 1) Number the clean, dry and sterilized eppendorf tubes (0.5ml), use a micropipette to add 1μg of DNA and 5μl of the corresponding restriction endonuclease reaction 10× buffer, then add double distilled water to make the total reaction volume 50μl, mix the solution in the tube and add the enzyme solution (1μl each), flick the tube wall with your fingers to mix the solution, or use a microcentrifuge to shake it to concentrate the solution at the bottom of the tube. When using restriction endonucleases, try to minimize the time they are out of the refrigerator to avoid reduced activity. 2) After mixing the reaction system, place the eppendorf tube on an appropriate support (foam plastic board) and keep it warm in a 37℃ water bath overnight to complete the enzyme digestion reaction. 3) Aspirate the sample and run EB gel.

[0138] 6. Plasmid amplification

[0139] The bacterial solution prepared by the above-mentioned plasmid construction was shaken overnight, and the plasmid DNA in the overnight culture solution was extracted using the TIANGEN endotoxin-free plasmid mini-extraction kit. TM The concentration of plasmid was tested by ultra-micro spectrophotometer, and plasmid was verified by enzyme digestion and EB gel electrophoresis. Figure 7-14 As shown, the enzyme digestion results are as follows Fig.15As shown. The concentrations of each plasmid are: LPL-wt (1010.83ng / μl), GPIHBP1-wt (912.26ng / μl), GPIHBP1-c.40_41insGCGG (974.57ng / μl), GPIHBP1-c.84_89dup (723.54ng / μl), GPIHBP1-c.112T>G (943.49ng / μl), GPIHBP1-c.271A>G (1028.44ng / μl), GPIHBP1-c.388T>G (980.74ng / μl), and GPIHBP1-c.473G>A (1085.45ng / μl). The size and position of each plasmid restriction electrophoresis band are correct.

[0140] By verifying the constructed plasmids, it was confirmed that a total of 8 plasmids, including LPL-wt, GPIHBP1-wt, GPIHBP1-c.40_41insGCGG (p.Phe14CysfsTer25), GPIHBP1-c.84_89dup (p.Glu28_Glu29dup), GPIHBP1-c.112T>G (p.Tyr38Asp), GPIHBP1-c.271A>G (p.Thr91Ala), GPIHBP1-c.388T>G (p.Cys130Gly), and GPIHBP1-c.473G>A (p.Arg158Gln), were successfully constructed.

[0141] Example 3 Study on the binding ability of GPIHBP1 and LPL

[0142] The HEK-293T cells (ATCC, CRL-3216, purchased from Shanghai Zhongqiao Xinzhou Company) used in this example were passaged and cultured according to standard operating procedures, wherein transfection was performed when the cell density per well in a 6-well plate (Costar, 3516) reached about 80%.

[0143] 1. Cell plasmid co-transfection

[0144] 1) Experimental groups: wild-type protein group, ( Figures 17 to 22 WT group, i.e., LPL-wt plasmid + GPIHBP1-wt plasmid co-transfection); mutant protein group, ( Figures 17 to 22 Each SNP mutation group of GPIHBP1 in the LPL-wt plasmid + GPIHBP1-SNP mutation plasmid co-transfection) and a blank control group ( Figures 17 to 22The BLANK group in the experiment is the untransfected cell extract, which does not contain LPL and / or GPIHBP1 protein. Input: It can be used as a positive control (to verify whether the co-transfection is successful, that is, whether the cell extract contains wild-type LPL + wild-type GPIHBP1 protein or wild-type LPL + GPIHBP1 mutant proteins). Input can also detect the expression levels of wild-type LPL protein, wild-type GPIHBP1 protein, and GPIHBP1 mutant proteins in the cell extract. IP: immunoprecipitation experiment, which means that each group adds the primary immunoprecipitation antibody, that is, mouse anti-GPIHBP1 antibody (mAb, sc-376598, SantaCruz Biotechnology) (anti-GPIHBP1 antibody, 1:50 dilution).

[0145] 2) Calculate the required volumes of Lipo-3000 and P3000 according to the instructions of Lip-3000 transfection reagent (Lipofectamine 3000, Thermo, L3000015), and calculate the required plasmid volume based on the plasmid concentration.

[0146] 3) Add 3 μg of plasmid (ratio of LPL plasmid to GPIHBP1 plasmid = 1:1), 6 μl of Lipofectamine 3000 Reagent, and 6 μl of P3000 Reagent to 500 μl of DMEM culture medium (GIBCO, C11995500BT), mix gently, and incubate at room temperature for 15 min.

[0147] 4) Discard the cell culture medium, add 1.5 ml of DMEM culture medium (GIBCO, C11995500BT) to each well, and slowly add the mixed solution from the previous step dropwise into the culture wells.

[0148] 5) After incubation in a 37°C incubator for 6 hours, the cell culture medium was aspirated and 2 ml of DMEM culture medium containing 2% FBS was added.

[0149] 6) After culturing in a 37°C, 5% CO2 incubator for 48 hours, cell proteins were extracted.

[0150] 2. Protein sample extraction

[0151] Co-transfected cell samples were treated with non-denaturing cell lysis buffer (1X non-denaturing RIPA lysis buffer (Merck & Millipore, RIPA Lysis Buffer, 10X, 20-188, diluted to 1X before use), protease inhibitor (Roche, PI, 05892970001), phenylmethylsulfonyl fluoride serine protease inhibitor (Beyotime, PMSF (100mM) ST506), cell lysis buffer was prepared at a ratio of 100:10:1) and the BCA method (Pierce TM BCA Protein Assay Kit) was used to determine the concentration of protein samples. The protein concentrations were as follows: LPL-wt (2.61 μg / μl), GPIHBP1-wt (2.95 μg / μl), GPIHBP1-p.Phe14CysfsTer25 (3.31 μg / μl), GPIHBP1-p.Glu28_Glu29dup (3.86 μg / μl), GPIHBP1-p.Tyr38Asp (2.92 μg / μl), GPIHBP1-p.Thr91Ala (3.24 μg / μl), GPIHBP1-p.Cys130Gly (3.75 μg / μl), and GPIHBP1-p.Arg158Gln (2.86 μg / μl). 1 / 10 of the protein sample was reserved as the input group, and after protein denaturation treatment, it was stored at -80°C for subsequent Western Blot analysis. The remaining 9 / 10 freshly prepared samples were used for subsequent CO-IP experiments.

[0152] 3. Co-immunoprecipitation (CO-IP) experiment

[0153] 3.1. Pre-purify 9 / 10 volume of freshly prepared protein sample to reduce the content of non-specific proteins in the lysis mixture and the content of proteins that may cross-react with Protein G. The specific steps are as follows:

[0154] 3.1.1) According to 200 μL of 1 mg / mL cell lysate (i.e., 9 / 10 volume of the pre-purified protein sample mentioned above) and 30 μL of 50% Pretein G agarose protein microbeads (Protein G Agarose Beads, Cell Signaling Technology, 37478), the protein sample and microbeads were mixed and incubated at 4°C for 60 min.

[0155] 3.1.2) Remove the beads by centrifugation at 4°C and keep the supernatant as the protein lysate for subsequent experiments.

[0156] 3.2 Co-incubation

[0157] 3.2.1. Add an appropriate amount of IP antibody, namely mouse anti-GPIHBP1 antibody (mAb, sc-376598, Santa Cruz Biotechnology) (anti-GPIHBP1 antibody) to the protein lysate.

[0158] (Through preliminary experiments (antibody gradient dilution) and the instructions, the IP antibody dilution was determined to be 1:50.)

[0159] 3.2.2. Incubate with rotation at 4°C overnight.

[0160] 3.3 Co-precipitation

[0161] 3.3.1. On the second day, add 30 μL of 50% Protein G beads (300 μg protein). Cut the tip of the pipette to prevent damage to the beads when adding Protein G.

[0162] 3.3.2. Incubate at 4°C with the tube turned over for 1-3 hours.

[0163] 4. Washing: The purpose is to wash away non-specific binding.

[0164] 4.1.1 Add 500 μL Wash buffer. Wash buffer is prepared with pre-cooled PBS and appropriate amount of protease inhibitor (PI) and PMSF (phenylmethylsulfonyl fluoride, serine protease inhibitor).

[0165] 4.1.2 Resuspend and invert several times.

[0166] 4.1.3 Centrifuge at 4℃ and discard the supernatant.

[0167] 4.1.4 Repeat 4-5 times.

[0168] 5. Elution: The purpose is to elute the protein from the beads.

[0169] 5.1.1. Add 30 μL of 2XSDS loading buffer, shake and centrifuge.

[0170] 5.1.2. Boil the sample for 2-5 minutes and centrifuge at 14000 x g for 1 minute.

[0171] 5.1.3. Take 15 μL of the supernatant and load it for Western Blot analysis.

[0172] 6. Western Blot Analysis

[0173] According to the standard operating procedures of Western Blot experiments, the steps of gel preparation, electrophoresis (constant voltage), membrane transfer (constant current), blocking (room temperature), primary antibody incubation (4°C overnight), secondary antibody incubation (room temperature), and imaging were performed to complete the Western Blot experiment.

[0174] For the input group, 30 μg of cell protein extract (1 / 10 volume of protein sample retained in the above protein sample extraction step) was taken from each group for Western blotting, and β-actin was used as the internal reference. The dilution of mouse monoclonal antibody against GPIHBP1 (Santa Cruz Biotechnology) was 1:1000; the dilution of rabbit monoclonal antibody against V5 tag (CellSignaling Technology) was 1:1000; the dilution of mouse monoclonal antibody against β-actin (Sigma-Aldrich) was 1:2000. The dilution of anti-mouse HRP-conjugated immunoglobulin (Cell Signaling Technology) was 1:5000 and the dilution of anti-rabbit HRP-conjugated immunoglobulin (Cell Signaling Technology) was 1:2000.

[0175] For the IP group, equal amounts of immunoprecipitates in each group were subjected to protein size fractionation on 12% Bis-Tris sodium dodecyl sulfate-polyacrylamide gels, and rabbit anti-V5 tag monoclonal antibody (Cell Signaling Technology, 1:1000) was used as the primary antibody, and anti-rabbit HRP-conjugated immunoglobulin (Cell Signaling Technology, 1:2000) was used as the secondary antibody to detect the amount of LPL bound to GPIHBP1.

[0176] The band intensities were quantified using ImageJ software, and the GPIHBP1 and LPL protein levels were normalized to β-actin levels.

[0177] 7. Results of the study on the binding ability of GPIHBP1 and LPL

[0178] like Fig.17The expression level of GPIHBP1 c.40_41insGCGG (p.Phe14CysfsTer25) mutant protein was significantly lower than that of GPIHBP1 wild-type protein (P < 0.0001, GPIHBP1 WT vs p.Phe14CysfsTer25 = 1.000 vs 0.008542). The results of co-immunoprecipitation showed that the binding ability of p.Phe14CysfsTer25 mutant protein to LPL was significantly reduced, which was lower than that of wild-type protein by more than 99% (P = 0.0005, GPIHBP1 WT vs p.Phe14CysfsTer25 = 1.000 vs 0.008756).

[0179] like Fig.18 There was no significant difference in the expression level of GPIHBP1 c.84_89dup (p.Glu28_Glu29dup) mutant compared with the wild-type GPIHBP1 protein (P=0.6900, GPIHBP1 WT vs p.Glu28_Glu29dup=1.000vs 0.9247). The results of co-immunoprecipitation showed that the p.Glu28_Glu29dup mutant protein had a significantly decreased ability to bind to LPL, which was 73% lower than that of the wild-type protein (P=0.0012, GPIHBP1 WT vs p.Glu28_Glu29dup=1.000vs 0.2715).

[0180] like Fig.19 The expression level of GPIHBP1 c.T112G (p.Y38D) mutation was significantly lower than that of GPIHBP1 wild-type protein (P=0.0036, GPIHBP1 WT vs p.Y38D=1.000vs 0.6856). The results of co-immunoprecipitation showed that the binding ability of p.Y38D mutation to LPL was significantly reduced, which was 51% lower than that of wild-type protein (P=0.0005, GPIHBP1 WT vs p.p.Y38D=1.000vs 0.4847).

[0181] like Fig. 20 The expression level of GPIHBP1 c.A271G (p.T91A) mutation was lower than that of GPIHBP1 wild-type protein to a certain extent (P=0.1705, GPIHBP1 WT vs p.T91A=1.000vs 0.8554). The results of co-immunoprecipitation showed that the binding ability of p.T91A mutation to LPL was significantly reduced, which was 39% lower than that of wild-type protein (P=0.0262, GPIHBP1 WT vs p.T91A=1.000vs 0.6124).

[0182] like Fig.21 The expression level of GPIHBP1 c.T388G (p.C130G) mutation was significantly lower than that of wild-type protein (P=0.0221, GPIHBP1 WT vs p.C130G=1.000vs 0.5071). The results of co-immunoprecipitation showed that the p.C130G mutation affected the binding ability of GPIHBP1 to LPL to a certain extent (P=0.6092, GPIHBP1 WT vs p.C130G=1.000vs0.8809).

[0183] like Fig. 22 There was no significant difference in the expression level of GPIHBP1 c.G473A (p.R158Q) mutation compared with the wild-type protein (P=0.4893, GPIHBP1 WT vs p.R158Q=1.000vs 0.9192). The results of co-immunoprecipitation showed that the binding ability of the p.R158Q mutation to LPL was significantly reduced, which was 32% lower than that of the wild-type protein (P=0.0222, GPIHBP1 WT vs p.R158Q=1.000vs 0.6821).

[0184] In summary, in terms of the binding ability of GPIHBP1 to LPL: the binding ability of GPIHBP1-(p.Phe14CysfsTer25), GPIHBP1-(p.Glu28_Glu29dup), GPIHBP1-(p.Tyr38Asp), GPIHBP1-(p.Thr91Ala), GPIHBP1-(p.Cys130Gly), and GPIHBP1-(p.Arg158Gln) decreased significantly;

[0185] In terms of GPIHBP1 protein expression level: GPIHBP1-(p.Phe14CysfsTer25), GPIHBP1-(p.Tyr38Asp) and GPIHBP1-(p.Cys130Gly) protein expression decreased significantly, GPIHBP1-(p.Glu28_Glu29dup), GPIHBP1-(p.Thr91Ala), GPIHBP1-(p.Arg158Gln) affected the protein expression level to a certain extent, all showing a downward trend. In summary, the above mutant genes obtained by the present invention can be used as a basis for diagnosing the pathogenicity of hypertriglyceridemia acute pancreatitis.

[0186] Example 4 In vivo animal experiment

[0187] 1. Construction of Gpihbp1 knockout rats

[0188] The specific pathogen free (SPF) Sprague–Dawley background wild type (WT) rats used in the present invention were purchased from the Model Animal Research Institute of Nanjing University (Nanjing, China). The rats were 8 to 10 weeks old and their body weight was controlled at 200±10 g. - / - The Gpihbp1 gene-deficient rat (Gpihbp1 - / + All experimental animals were raised and operated in accordance with the 1996 Guide for the Use of Laboratory Animals of the National Institutes of Health (NIH publication no. 85Y23). The animals were fed with standard rodent diet and drinking water, and the ambient temperature was controlled at 24±1℃, relative humidity was 45%, ventilation was good, and the light / dark cycle was 12 hours / 12 hours.

[0189] 2. Gpihbp1 - / - Identification of rat genotypes

[0190] The invention retains rat tail epithelial cells for rat DNA extraction, then uses polymerase chain reaction (PCR) to amplify the extracted genomic DNA, and finally clarifies the DNA amplification situation by agarose gel electrophoresis, the amplification primers are designed and verified for the rat Gpihbp1 gene, the upstream primer sequence is: TAAGTGGCTAAAGCTTACCGA; the downstream primer sequence is: GTCATCACCGTCATCATCGTA.

[0191] 3. Collection of experimental animal specimens

[0192] The collection of experimental animal specimens in the present invention is carried out after effective anesthesia, including the collection of blood specimens and tissue and organ specimens, as follows:

[0193] 3.1 Blood specimens

[0194] 1) Blood collection during the experiment: After the rats were briefly anesthetized with isoflurane, blood was collected through the medial canthal vein using a capillary glass tube, and then the blood was collected in a 200μL centrifuge tube. After centrifugation at 4000 rpm for 10 minutes at 4°C, the upper plasma was collected and temporarily stored at -80°C. 2) Blood collection after the experiment: The rats were briefly anesthetized with isoflurane, and then completely anesthetized with 1% sodium pentobarbital solution injected intraperitoneally at a dose of 50 mg / kg. 50μL of heparin was injected through the medial canthal vein. After 15 minutes, the eyeball was removed to obtain blood samples and collected in 1.5mL centrifuge tubes. After centrifugation at 4000 rpm for 10 minutes at 4°C, the upper plasma was collected and temporarily stored at -80°C.

[0195] 3.2 Tissue specimen collection and pathological examination

[0196] Rats were briefly anesthetized with isoflurane, and then completely anesthetized with an intraperitoneal injection of 1% sodium pentobarbital solution at a dose of 50 mg / kg. Pancreatic tissue was obtained according to the routine animal experiment sample collection procedures, and was fully fixed in 4% paraformaldehyde, and then embedded in paraffin using conventional methods. After sectioning, it was stained using conventional hematoxylin-eosin (H&E) staining methods, and photographed under a microscope to observe pancreatic damage.

[0197] 4. Serum triglyceride level detection

[0198] The present invention uses a colorimetric method to determine the triglyceride level. The specific operation is strictly carried out in accordance with the instructions of the kit (Sino-Biotech, triglyceride detection kit, item number 100000220). The steps are briefly described as follows: After the frozen serum sample is thawed on ice, it is diluted to an appropriate multiple, 5 μL of the diluted sample or standard is aspirated and added to a 96-well plate, 200 μL of triglyceride detection working solution is quickly added to each well, and the OD value at a wavelength of 505 nm is read after incubation at 37°C for 10 minutes, and the triglyceride level is calculated according to the standard curve.

[0199] 5. Experimental results:

[0200] The Gpihbp1 - / - The blood triglyceride level of rats is continuously above 1000 mg / dL, which is severe HTG. The pups show pancreatic damage and high mortality, such as Fig.23 shown. Fig.23 Embodying Gpihbp1 - / - The mortality rate of rats within 28 days after birth was greatly increased compared with wild-type rats. The blood triglyceride levels and pathological images of pancreatic tissue damage showed that rats with Gpihbp1 gene knockout showed severe hypertriglyceridemia and severe pancreatic damage after birth, indicating that this gene is the pathogenic gene of HTG-AP.

[0201] Example 5 High-fat feeding Gpihbp1 - / - Spontaneous HTG-AP can be stably induced in rats, providing a new type of humanized spontaneous HTG-AP animal

[0202] Physical Model

[0203] 1. Observe the Gpihbp1 under the feeding conditions of conventional feed (Jiangsu Collaborative Pharmaceutical Bioengineering Co., Ltd., product number: 1010002) - / - Pancreatic histopathological characteristics of WT and WT rats

[0204] Six 8-week-old mice weighing 200±10 g and with Gpihbp1 were randomly selected. - / - Rats and WT rats were fed with a conventional feed containing 10% fat calories. The body weight and food intake of the rats were recorded at 9:00 a.m. daily, and blood samples were taken to test triglyceride levels. Pancreatic tissue specimens were collected at the end of the experiment to observe the pathological characteristics of pancreatic tissue.

[0205] 2. Observation of Gpihbp1 under high-fat diet (Jiangsu Collaborative Pharmaceutical Bioengineering Co., Ltd., catalog number: d12492) feeding conditions - / - Pancreatic histopathological characteristics of WT and WT rats

[0206] Six 8-week-old mice weighing 200±10 g and with Gpihbp1 were randomly selected. - / - Rats and WT rats were fed a high-fat diet with 60% fat calories. The body weight and food intake of the rats were recorded at 9 a.m. daily, and blood samples were taken to test triglyceride levels. Pancreatic tissue specimens were collected at the end of the experiment to observe the pathological characteristics of pancreatic tissue.

[0207] The results are as follows Fig.24 After 14 days of high-fat feeding, the Gpihbp1 - / - Rats developed severe HTG-AP and significant pancreatic necrosis. In summary, the GPIHBP1 gene is a risk gene for HTG-AP, and GPIHBP1 knockout rats showed severe HTG, indicating that spontaneous HTG-AP can be stably induced by high-fat feeding alone.

Claims

1. GPIHBP1 A mutant gene, characterized in that Said GPIHBP1 Mutant genes in humans GPIHBP1 The wild-type gene has one or more of the following mutations: exist GPIHBP1 Four nucleotides GCGG were inserted between nucleotides 40 and 41 in the first exon of the wild-type gene; exist GPIHBP1 Six nucleotides GAGGAA were inserted between nucleotides 72-73 in the second exon region of the wild-type gene; exist GPIHBP1 The nucleotide 112 in the second exon of the wild-type gene mutated from T to G; exist GPIHBP1 The nucleotide A at position 271 in exon 3 of the wild-type gene mutated to nucleotide G; exist GPIHBP1 The nucleotide T at position 388 in exon 4 of the wild-type gene mutated to nucleotide G; exist GPIHBP1 The nucleotide G at position 473 in exon 4 of the wild-type gene mutated to nucleotide A.

2. A GPIHBP1 mutant protein, characterized in that: The GPIHBP1 mutant protein has one or more of the following mutations in the amino acid sequence of the human GPIHBP1 wild-type protein: The aminophenylalanine at position 14 of the wild-type GPIHBP1 protein was mutated to cysteine; The wild-type protein of GPIHBP1 has duplications of glutamic acid at position 28 and glutamic acid at position 29; The amino acid tyrosine at position 38 of the wild-type GPIHBP1 protein was mutated to aspartic acid; The amino acid threonine at position 91 of the wild-type GPIHBP1 protein was mutated to alanine; The amino acid cysteine ​​at position 130 of the wild-type GPIHBP1 protein was mutated to glycine; The amino acid arginine at position 158 of the wild-type GPIHBP1 protein was mutated to glutamine.

3. An expression cassette, a recombinant vector, a recombinant cell or a recombinant bacterium, characterized in that: It contains the mutant gene according to claim 1.

4. A recombinant cell, characterized in that The recombinant cell is obtained by introducing the mutant gene according to claim 1 into a vector to obtain a recombinant vector, and then introducing the recombinant vector into a host cell.

5. The method for co-immunoprecipitation of GPIHBP1 mutant protein and LPL protein according to claim 2, characterized in that: The following steps are involved: 1) Sample lysis for protein sample extraction; 2) Pre-purify protein samples; 3) Co-incubation: protein sample is co-incubated with IP antibody to obtain antigen-antibody complex; 4) Co-precipitation: Add protein beads to the protein sample and IP antibody co-incubation complex.

6. A method for detecting the GPIHBP1 A primer pair for a mutant gene, characterized in that: The primer pair includes a detection GPIHBP1 Primer pair GP1 or detection of exon 1 and 2 of gene GPIHBP1 The primer pair GP3 for exons 3 and 4 of the gene, the sequence of the primer pair GP1 is shown as SEQ ID NO.9 and SEQ ID NO.10, and the sequence of the primer pair GP3 is shown as SEQ ID NO.11 and SEQ ID NO.

12.

7. A detection kit, characterized in that: It contains the primer pair described in claim 6. Preferably, the detection kit also includes a DNA amplification enzyme for PCR and a corresponding buffer.

8. The method according to claim 1 GPIHBP1 Use of the mutant gene, the expression cassette, the recombinant vector, the recombinant cell or the recombinant bacteria as described in claim 3, the primer pair as described in claim 6, and the detection kit as described in claim 7 or 8 in the preparation of a reagent or a kit for diagnosing pancreatitis, preferably, the pancreatitis includes hypertriglyceridemia acute pancreatitis.

9. A method for constructing a spontaneous HTG-AP animal model, characterized in that: The animals GPIHBP1 Gene knockout Gpihbp1 Knockout animals, then Gpihbp1 The gene knockout animals are obtained by feeding a high-fat diet, and preferably, the animals include rats.

10. The method for constructing a spontaneous HTG-AP animal model according to claim 9, characterized in that: The high-fat feed includes feed in which the fat calorie ratio is greater than or equal to 60%.

Images