CML37 gene of beach cowpea root system and application thereof

Abstract

This invention provides a CML37 gene for the root system of cowpea, the coding region of which is shown in SEQ ID NO:1. This invention is the first to clone the CML37 gene from the root system of cowpea. Studies show that this gene can significantly improve the survival ability of plants under stresses such as high salt content, promote plant growth, increase root length, increase chlorophyll content, reduce electrolyte leakage rate and leaf drop rate, and reduce sodium levels in plants. + Cl ‑ Content, increase the calcium content in plants 2+ Content, etc. The CML37 gene significantly enhances the salt tolerance and drought resistance of soybeans, potentially leading to the development of salt-tolerant or drought-resistant transgenic soybean varieties for cultivation in saline-alkali and arid regions. This invention provides new candidate genes for research on improving plant stress resistance, promoting plant growth, and altering plant phenotypes.

Description

Technical Field

[0001] This invention belongs to the field of biology, specifically relating to the CML37 gene in the root system of cowpea and its application. Background Technology

[0002] *Vigna marina* (Burm.) Merr. is a perennial herbaceous plant belonging to the genus *Vigna*. It is creeping and can also climb, reaching lengths of several meters. It is a wild leguminous plant widely distributed in coastal sandy areas. *Vigna marina* is found throughout tropical and subtropical regions, and is widely distributed in the coastal areas of southern China. Due to its morphological characteristics such as thick leaves, small specific leaf area, well-developed palisade tissue, high stomatal density, and high stomatal area index, it can adapt to high-temperature, arid, and infertile growing environments. *Vigna marina* belongs to the group of "pantropical plants with marine-drifting seeds," demonstrating a certain degree of adaptability to marine dispersal. Its root system has well-developed root nodules, which, in symbiosis with rhizobia, fix nitrogen, increasing soil fertility and improving saline-alkali land, thus benefiting the growth of surrounding plant communities. Extracts from its stems and leaves have significant effects in treating skin wounds. *Vigna marina* grows vigorously in coastal mudflats and is a potential gene source for cultivating drought- and salt-tolerant high-quality varieties. Currently, there is limited research on the regulation of drought and salt tolerance genes in cowpea, making it difficult to reveal the unique ecological and biological characteristics of cowpea, especially the regulatory role of drought and salt tolerance at the gene level. Summary of the Invention

[0003] The purpose of this invention is to overcome the shortcomings of the prior art and provide a CML37 gene in the root system of cowpea and its application.

[0004] The first aspect of the present invention is to provide a CML37 gene for the root system of cowpea, the coding region of which is shown in SEQ ID NO:1.

[0005] A second aspect of the present invention is to provide a protein encoded by the CML37 gene in the root system of cowpea as described in the first aspect of the present invention.

[0006] A third aspect of the present invention is to provide a recombinant vector containing the coding region of the CML37 gene of cowpea roots as described in the first aspect of the present invention.

[0007] The original vector for the recombinant vector can be a vector commonly used in the field of gene recombination, such as a virus or plasmid. This invention does not limit this. In one specific embodiment of this invention, the original vector is PHB and WMV069, but it should be understood that other plasmids or viruses can also be used.

[0008] Preferably, the original vector of the recombinant vector is a PHB expression vector, and the coding region of the CML37 gene in cowpea roots is located between the BamHI and PstI restriction endonuclease sites of the PHB expression vector.

[0009] Preferably, the original vector of the recombinant vector is the WMV069 expression vector, and the coding region of the CML37 gene in cowpea roots is located between the BamHI and SpeI restriction endonuclease sites of the WMV069 expression vector.

[0010] A fourth aspect of the present invention is to provide a host bacterium containing the coding region of the CML37 gene of cowpea roots as described in the first aspect.

[0011] A fifth aspect of the present invention is to provide an expression cassette containing the coding region of the CML37 gene in the root system of cowpea as described in the first aspect of the present invention.

[0012] The sixth aspect of the present invention is to provide the use of the CML37 gene of cowpea root as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacterium as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in improving plant salt tolerance and / or improving plant drought tolerance.

[0013] The seventh aspect of the present invention is to provide the use of the CML37 gene of cowpea root as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacterium as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in promoting plant growth.

[0014] The eighth aspect of the present invention is to provide the use of the CML37 gene of cowpea root as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacterium as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in increasing plant root length and / or increasing the relative chlorophyll content of plants, and / or reducing the rate of electrolyte leakage from plants.

[0015] In one specific embodiment of the present invention, the plant is Arabidopsis thaliana.

[0016] The ninth aspect of the present invention is to provide the CML37 gene of cowpea roots as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacterium as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention, to improve the photosynthetic rate of plants, and / or increase the relative chlorophyll content of plants, and / or reduce the electrolyte efflux rate of plants, and / or reduce the Na+ content in plants. + Cl - Content and / or increase the calcium content in plants 2+Applications in reducing plant leaf drop rate and content.

[0017] In one specific embodiment of the present invention, the plant is soybean.

[0018] A tenth aspect of the present invention is to provide a primer pair, wherein the primer pair is F':TCGAGTGATGGAAAGCGTGTG and R':TCTGCGGACTTGAAGACCTGG; or the primer pair is F':GAGCGTAATGTGTC GAGTGAT and R':CTGATTCTTCCGTCTCCGTTT as primers.

[0019] This invention is the first to clone the CML37 gene from the root system of cowpea. Studies have shown that this gene can significantly improve the plant's survival ability under stresses such as salt tolerance and drought resistance, promote plant growth, increase root length, increase chlorophyll content, reduce electrolyte leakage rate, and reduce sodium levels in the plant. + Cl - Content, increase the calcium content in plants 2+ This invention improves the salt tolerance and drought resistance of soybeans by increasing their salt content and reducing leaf drop rate. The CML37 gene significantly enhances these properties, potentially leading to the development of salt-tolerant or drought-resistant transgenic soybean varieties for cultivation in saline-alkali and arid regions. This invention provides new candidate genes for research on improving plant stress resistance, promoting plant growth, and altering plant phenotypes. Attached Figure Description

[0020] Figure 1 The phenotype, root length, relative chlorophyll content, and electrolyte leakage rate of Arabidopsis thaliana transgenic CML37 after 6 days of treatment with 200 mM NaCl were determined. WT represented wild-type Arabidopsis thaliana, and lines 1-3 represented three plant types of Arabidopsis thaliana transgenic SLAH1. The control group was grown under normal conditions.

[0021] Figure 2 The spectrum is for the empty vector WMV069.

[0022] Figure 3 The phenotype, photosynthetic rate, relative chlorophyll content, and electrolyte leakage rate of CML37 soybean were determined after 12 days of treatment with 200 mM NaCl. The control group was grown under normal conditions, and JACK was a soybean variety transformed with an empty vector.

[0023] Figure 4 After treating CML37 soybeans with 200mM NaCl for 12 days, the Na content in the roots, stems, and leaves was... + Cl - Ca 2+ Content. JACK is a soybean variety transformed with an empty vector. CK represents normal cultivation conditions, and T represents 200 mM NaCl stress treatment.

[0024] Figure 5 The results show the fresh weight and leaf blight rate of CML37 soybeans after 12 days of treatment with 200mM NaCl. JACK is a soybean variety transformed with an empty vector. The control group was grown under normal conditions.

[0025] Figure 6 The results show the phenotypic, relative moisture content, and relative chlorophyll content of CML37 soybean after 20 days of drought simulation treatment with 6% PEG. JACK is a soybean variety transformed with an empty vector. The control group was grown under normal conditions.

[0026] Figure 7 The results show the photosynthetic rate and leaf blight rate of CML37 soybeans after 20 days of simulated drought treatment with 6% PEG. JACK is a soybean variety transformed with an empty vector. The control group was grown under normal conditions. Detailed Implementation

[0027] The present invention will be further described below with reference to the accompanying drawings and specific embodiments to better understand the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0028] Example 1: Cloning of the CML37 gene

[0029] The germplasm of *Cowpea* was collected from the seaside of Gancheng Town, Dongfang City, Hainan Province, at longitude 108.634°, latitude 18.867°, and altitude -9.35 meters. Total RNA was extracted from the roots of *Cowpea*, and the first strand of cDNA was obtained by reverse transcription. Using the first strand of cDNA as a template, PCR amplification was performed using primers F':TCGAGTGATGGAAAGCGTGTG and R':TCTGCGGACTTGAAGACCTGG.

[0030] (1) PCR amplification reaction system:

[0031]

[0032] (2) PCR amplification reaction conditions:

[0033]

[0034] Melting curve:

[0035]

[0036] The amplification product was recovered to obtain the CML37 gene from cowpea roots. Sequencing was performed, and the coding region sequence of the CML37 gene from cowpea roots is shown in SEQ ID NO:1.

[0037] Example 2: Arabidopsis thaliana transgenic with the CML37 gene

[0038] 1. Cultivation of Arabidopsis thaliana

[0039] 1) Preparation of culture medium: MS medium was selected for Arabidopsis thaliana and prepared in advance (pH=5.8).

[0040] 2) Seed disinfection: Add 1 ml of 5% sodium hypochlorite solution (containing 1 drop of Tween) to a 1.5 ml centrifuge tube, invert and mix for 8 minutes, then rinse 5 times with sterile water;

[0041] 3) After sterilizing the seeds, mix them with culture medium at 40-50℃, pour them into a plate, and spread them evenly (about 4-5 ml of culture medium is needed for a small petri dish).

[0042] 4) Seal the petri dishes and vernalize them in a refrigerator at 4℃ for 2-3 days. Then, place them in an artificial climate chamber to begin germination and growth. The plant growth environment is as follows: relative humidity 60%; constant temperature 21-23℃; photoperiod of 16 hours of light followed by 8 hours of darkness; light intensity 80-200 μmol / m². 2 / S;

[0043] 5) Preparation of planting soil: Mix peat moss and vermiculite in a 2:1 ratio and set aside for later use;

[0044] 6) Soaking the soil: Fill the planting pot with soil to about 1cm from the rim, and soak it completely with Flower Perfection compound fertilizer (N, P, K = 20%, 20%, 20%).

[0045] 7) Transplanting: 7-12 days after germination, select healthy seedlings with uniform growth and transplant them into potting soil that has been soaked in Flower Perfection solution beforehand. Cover them with plastic wrap and remove it after the seedlings have taken root.

[0046] 8) Cultivate until bolting and flowering.

[0047] 2. Agrobacterium tumefaciens positive for CML37 gene

[0048] (1) Construction of recombinant vector

[0049] Total RNA was extracted from the roots of cowpea and reverse transcribed to obtain the first strand of cDNA. Using the first strand of cDNA as a template, and primers F':TCGAGTGATGGAAAGCGTGTG and R':TCTGCGGACTTGAAGACCTGG, PCR amplification was performed. The reaction system and procedure are as follows:

[0050] PCR system:

[0051]

[0052] Reaction conditions:

[0053]

[0054] The amplification product was recovered to obtain the full-length CML37 sequence with BamHI and PstI restriction sites. The empty PHB vector and the full-length CML37 sequence with added restriction sites were digested with BamHI and PstI, and the two fragments were ligated. The resulting fragments were transformed into competent E. coli cells, plated on LB agar, and after single colonies grew, positive PCR was performed to obtain the PHB expression vector.

[0055] (2) Culture of Agrobacterium

[0056] Agrobacterium culture medium was LB medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, pH 7.0 (Note: Add 15 g agar per liter when preparing solid medium).

[0057] Take competent Agrobacterium cells stored at -80℃ and allow them to partially thaw at room temperature or in your hand, then insert them into ice while they are in an ice-water mixture. Add 0.1 μg (no more than 10 μl) of plasmid DNA to each 100 μl of competent cells, mix thoroughly by hand, and incubate sequentially on ice for 5 min, in liquid nitrogen for 5 min, in a 37℃ water bath for 5 min, and in an ice bath for 5 min. Add 700 μl of antibiotic-free LB broth and incubate at 28℃ with shaking at 200 rpm for 2–3 h. Centrifuge at 6000 rpm for one minute to collect the bacteria, and resuspend approximately 100 μl of the supernatant by gently pipetting and spreading it onto an LB agar plate containing 50 μg / ml kanamycin. Invert the plate and incubate at 28℃ for 2–3 days. Randomly select one single colony for colony PCR, and label the correctly identified Agrobacterium single clone for later use.

[0058] Using a sterile pipette tip, pick up a labeled Agrobacterium single clone and inoculate it into 1.5 ml of LB liquid medium containing the appropriate antibiotic (using a 50 ml blue-cap centrifuge tube). Incubate at 30°C with shaking at 200 rpm for 24 h. Add 1% of the slightly shaken Agrobacterium culture to 100 ml of LB liquid medium containing antibiotic, and incubate at 30°C with shaking until OD600 = approximately 1.0. Centrifuge at 20°C, 4,000 rpm for 15 min and collect the cells. Resuspend the cells in transformation buffer until OD600 = approximately 1.0, and set aside for later use.

[0059]

[0060] 3. Transformation of Arabidopsis thaliana

[0061] Water the plants that are currently bolting and flowering thoroughly one day in advance. Invert the small pot and place all the inflorescences upside down into the bacterial solution that has been suspended in conversion buffer for about 30 seconds. Repeat the conversion process once after 7 days. After 2-3 weeks, reduce the amount of nutrient solution applied to accelerate aging. Collect the mature seeds in paper bags and store them in a desiccator for 7 days.

[0062] 4. Screening of transgenic Arabidopsis thaliana

[0063] 1) Preparation of culture medium: Arabidopsis thaliana culture medium is 1 / 2 MS (0.8% agar powder, sucrose-free, pH 5.8).

[0064] Preparation method for 1 / 2 MS (1 L):

[0065] MS Basal Salt Mixture (Phyto Technology Laboratories#M524): 2.17g

[0066] Murashige and SkoogVitaminpowder(Sigma#M3900): 0.5ml

[0067] Inositol 50mg

[0068] Add water to 1L and adjust the pH to 5.8.

[0069] Add 8g of fat powder and sterilize at 121℃ for 20 minutes.

[0070] 2) Seed disinfection: 70% ethanol for 1 min, add 1 ml of 7% sodium hypochlorite solution (containing 1 drop of Tween) for 10 min, invert and mix for 5 min, and rinse 5 times with sterile water.

[0071] 3) Resuspend the disinfected seeds in 100 μl of sterile water, and use a 1 ml pipette tip to spot them onto a 1 / 2 MS medium plate (the medium contains screening antibiotics: 50 μg / ml KAN or 30 μg / ml HYG or 50 μM Glufosinate-ammonium).

[0072] 4) Seal the petri dishes and vernalize them at 4℃ for 48 hours. Then, place them in an artificial climate chamber to begin germination and growth. The plant growth environment is as follows: relative humidity 60%; constant temperature 20-22℃; photoperiod of 16 hours of light followed by 8 hours of darkness; light intensity 80-200 μmol / M. 2 / S.

[0073] 5) After 8-15 days, observe and use positive PCR testing to distinguish positive transplants into the planting soil.

[0074] Preparation of planting soil: Mix peat moss and vermiculite in a 2:1 ratio and set aside for later use.

[0075] 6) Soaking the soil: Fill the planting pot with soil to about 1cm from the rim, and soak it completely with Flower Perfection compound fertilizer (N, P, K = 20%, 20%, 20%).

[0076] 7) Transplanting: 20 days after germination, select healthy seedlings with uniform growth and transplant them into potting soil that has been soaked in Flower Perfection fertilizer beforehand. Cover them with plastic wrap and remove it after the seedlings have survived.

[0077] 8) Continue culturing according to the culture method of non-transgenic normal Arabidopsis thaliana to obtain transgenic Arabidopsis thaliana seeds.

[0078] 5. Salt tolerance test

[0079] Transgenic Arabidopsis seeds germinated on a medium containing hygromycin and 200 mM NaCl. Wild-type Arabidopsis was used as a control (WT). The control group was cultured normally without NaCl treatment. Results were observed after 6 days. Figure 1 As shown, under 200 mM NaCl treatment, the root length of transgenic Arabidopsis thaliana was significantly longer than that of the control, the chlorophyll content was significantly increased, and the electrolyte permeability was significantly reduced.

[0080] Method for determining the relative chlorophyll content: The SPAD value of chlorophyll content was measured using a TYS-B chlorophyll meter (Zhejiang Top Company). The measurement was performed on healthy and mature leaves from the upper part of the plant.

[0081] Electrolyte extravasation rate determination method: Following Zou Qi's method (2004), the conductivity method was adopted and improved. 20 ml of deionized water was added to a 50 ml centrifuge tube, and the initial conductivity E0 (S0 < 0.4) was measured. Healthy and mature leaves were randomly cut from the upper part of the plant, washed with distilled water, and dried with absorbent paper. 0.5 g of each leaf was accurately weighed, cut into 1 cm segments, and placed in a test tube with the measured initial conductivity. The tube was shaken for 24 hours, and then the conductivity value E1 was measured using a DDS-320 digital conductivity meter (manufactured by Shanghai Dapu Instrument Co., Ltd.). The test tube was then sealed and placed in a boiling water bath for 30 minutes to kill the plant tissue. After removing the test tube, it was cooled to room temperature with tap water, shaken well, and the conductivity value E2 was measured using a conductivity meter. The relative conductivity was calculated using the formula EL(%) = (E1 - E0 / E2 - E0) × 100%.

[0082] Example 3: CML37 gene-transgenic soybean

[0083] 1. Agrobacterium tumefaciens positive for CML37 gene

[0084] (1) Construction of recombinant vector

[0085] Total RNA was extracted from the roots of cowpea and reverse transcribed to obtain the first strand of cDNA. Using the first strand of cDNA as a template, PCR amplification was performed with F':GAGCGTAATGTGTCGAGTGAT and R':CTGATTCTTCCGTCTCCGTTT.

[0086] PCR reaction 50μm system:

[0087]

[0088] The reaction procedure is as follows:

[0089] The PCR instrument runs the following series of reactions

[0090]

[0091] The amplification product was recovered to obtain the full-length CML37 sequence with BamHI and SpeI restriction sites. The empty WMV069 vector and the full-length CML37 sequence with added restriction sites were digested with BamHI and SpeI, and the two fragments were ligated. The resulting fragments were transformed into competent E. coli cells, plated on LB agar, and after single colonies grew, positive PCR was performed to obtain the WMV069 expression vector.

[0092] The WMV069 empty vector was modified from the PCAMBIA3300 vector by Weimi Biotechnology Co., Ltd. The spectrum of the WMV069 empty vector is shown below. Figure 2 As shown.

[0093] (2) Culture of Agrobacterium

[0094] 1) Add 20 μl Agrobacterium (EHA105-WM) + 1 μl recombinant plasmid, incubate on ice for 5 min, flash freeze in liquid nitrogen for 5 min, incubate in water at 37℃ for 5 min, and incubate on ice for 5 min. Add 100 μl of antibiotic-free LB, shake at 200 rpm for 2 h at 28℃, and directly plate onto a plate containing the corresponding bacterial antibiotic + rifampin, and incubate at 28℃ for two days.

[0095] 2) Pick a single clone of bacteria and shake it:

[0096] Two days later, select one monoclonal antibody and place it in a 5ml sterile EP tube. Add 2ml of the corresponding bacterial antibiotic and rifampin beforehand, and shake overnight.

[0097] 3) Preservation of glycerol bacteria: 400 μl of bacterial culture + 100 μl of 75% sterile glycerol, label clearly, and store in a -70°C freezer. Extract plasmid from the remaining bacterial culture and transform it into E. coli (1 μl of plasmid + 20 μl of competent E. coli cells, incubate on ice for 30 min, heat shock at 42°C for 35 s, incubate on ice for 2 min, add 100 μl of antibiotic-free LB, shake at 37°C and 200 rpm for 1 h, plate, add LB and corresponding bacterial antibiotic, and incubate at 37°C for one day).

[0098] 4) Select a single clone, shake the culture in the morning, and send the culture directly for sequencing in the evening, selecting a portion for sequencing.

[0099] 5) If the sequencing feedback is correct and the Agrobacterium is verified to be working properly, the prepared Agrobacterium can be used for subsequent transformation experiments.

[0100] 2. Genetic transformation

[0101] Using soybean cultivar JACK, which had germinated for 1 day, as material, explants were placed in petri dishes containing 50 ml of Agrobacterium suspension. Approximately 150 explants were treated within 2 hours and incubated at room temperature for 30 minutes for infection. After infection, the Agrobacterium suspension was discarded, and the explants were placed in a co-culture medium and co-cultured in the dark at 23°C for 3 days. After co-culture, the embryos were transferred to resting medium and cultured in light at 25°C for 7 days. Then, they were placed on the appropriate resistance selection medium and cultured for three weeks to induce resistant shoots. These shoots were then transferred to the appropriate resistance elongation medium and cultured in light for 6-9 weeks. The regenerated seedlings were then subjected to rooting culture.

[0102] After transplanting into seedling trays, T0 plants were subjected to gene testing, and positive plants were obtained. Primers: Bar-F1: CCATCGTCAACCACTACATCGAGACA and Bar-R1: CTTCAGCAGGTGGGTGTAGAGCGT, amplified to 269 bp. The reaction system (20 μl) consisted of: 10 μl 2*PCR buffer, 7 μl H2O, 1 μl upstream primer (10 μM), 1 μl downstream primer (10 μM), and 1 μl DNA. The reaction procedure is as follows:

[0103]

[0104]

[0105] 3. Salt tolerance test

[0106] After transgenic soybean seedlings were cultured to the T2 generation, one-month-old transgenic soybean seedlings (CML37) grown in sand culture were used as a control. The seedlings were then irrigated with Hongland nutrient solution (control) and Hongland nutrient solution containing 200 mM NaCl, respectively, once daily. Soybean seedlings transformed with an empty vector served as a blank control (JACK). Results were observed after 12 days. Figure 3 and Figure 4 , Figure 5 As shown, Figure 3 In the image above, the first pot on the left is the control (soybean transformed with an empty vector), and the second to fourth pots on the left are CML37 transgenic soybeans. Under salt treatment conditions, the transgenic soybean seedlings (CML37) showed significantly higher growth vigor, plant height, and biomass than the soybeans transformed with an empty vector (JACK), significantly increased photosynthetic rate and relative chlorophyll content, and significantly decreased electrolyte leakage rate; the Na+ in the leaves of the transgenic soybean plants was also significantly higher. + Cl - The Ca content in both roots and leaves was significantly lower than that in soybeans transformed with empty vectors. 2+ The sodium content was significantly higher than that of soybeans transformed with empty vectors, and the leaf blight rate of transgenic soybeans was significantly lower than that of soybeans transformed with empty vectors. This indicates that the salt tolerance of transgenic soybeans is significantly improved, and it is expected that salt-tolerant transgenic soybean varieties can be bred for planting in saline-alkali land. Under normal cultivation conditions, the photosynthetic rate, chlorophyll, and electrolyte efflux rate did not change significantly, while the sodium content in roots, stems, and leaves was significantly higher. + Ca 2+ The content change was not significant. Figure 3 control group and Figure 4 (CK group). Under normal cultivation conditions, neither the empty vector-transformed soybean nor the CML37-transformed soybean showed any leaf blight, i.e., the leaf blight rate was 0%.

[0107] Photosynthetic rate measurement method: The net photosynthetic rate (Pn, μmol·CO2 m) of leaves was measured using a Li-6400 XT photosynthesis system (USA). -2 s -1 The photosynthesis measurement parameters were set as follows: CO2 concentration 400 μmol·mol⁻¹ -1 The flow rate was 400 μmol·s. -1 The light intensity is 1000 μmol·m -2 s -1 The leaves measured were randomly selected from the upper part of the plant, showing healthy and mature growth.

[0108] The formula for calculating the leaf withering rate is: the percentage of leaves with withering symptoms in 50% of the area out of the total number of leaves (Feng, 2018).

[0109] Method for determining the relative chlorophyll content: The SPAD value of chlorophyll content was measured using a TYS-B chlorophyll meter (Zhejiang Top Company). The measurement was performed on healthy and mature leaves from the upper part of the plant.

[0110] Electrolyte extravasation rate determination method: Following Zou Qi's method (2004), the conductivity method was adopted and improved. 20 ml of deionized water was added to a 50 ml centrifuge tube, and the initial conductivity E0 (S0 < 0.4) was measured. Healthy and mature leaves were randomly cut from the upper part of the plant, washed with distilled water, and dried with absorbent paper. 0.5 g of each leaf was accurately weighed, cut into 1 cm segments, and placed in a test tube with the measured initial conductivity. The tube was shaken for 24 hours, and then the conductivity value E1 was measured using a DDS-320 digital conductivity meter (manufactured by Shanghai Dapu Instrument Co., Ltd.). The test tube was then sealed and placed in a boiling water bath for 30 minutes to kill the plant tissue. After removing the test tube, it was cooled to room temperature with tap water, shaken well, and the conductivity value E2 was measured using a conductivity meter. The relative conductivity was calculated using the formula EL(%) = (E1 - E0 / E2 - E0) × 100%.

[0111] Na + Ca 2+ Content determination method: Microwave digestion-ICP OES method; Cl - Content determination method: Argentometric titration (direct titration).

[0112] 4. Drought resistance experiment

[0113] After transgenic soybean seedlings reached the T2 generation, seedlings (CML37) grown in sand culture for 12 days were treated with 6% PEG for 20 days. The experimental materials were placed in plastic pots (90×70×9cm) to simulate drought treatment, containing Hongland nutrient solution with 6% PEG, and aerated using an air pump. Soybeans transformed with an empty vector served as a blank control (JACK). Observations were made after 20 days. The control group was cultivated normally without any stress treatment. Results are as follows: Figure 6 and Figure 7 As shown. Figure 6 The image above shows the phenotypes of soybean plants under drought treatment. The first three pots on the left represent soybeans transformed with an empty vector, while the fourth to sixth pots represent CML37 transgenic soybeans. The results show that under drought treatment, the leaf drop rate of CML37 transgenic soybeans was significantly reduced, and their relative chlorophyll content, relative water content, and photosynthetic rate were significantly higher than those of the control empty vector-transgenic soybeans. This indicates that the drought resistance of CML37 transgenic soybeans is significantly enhanced, and they hold promise for developing drought-resistant transgenic soybean varieties. Under normal cultivation conditions, neither the empty vector-transgenic soybeans nor the CML37 transgenic soybeans showed any leaf drop (0%). Therefore, under normal cultivation conditions, there were no significant differences in photosynthetic rate, relative chlorophyll content, relative water content, and leaf drop rate between the empty vector-transgenic soybeans and the CML37 transgenic soybeans.

[0114] The formula for calculating the leaf withering rate is: the percentage of leaves with withering symptoms in 50% of the area out of the total number of leaves (Feng, 2018).

[0115] Method for determining the relative chlorophyll content: The SPAD value of chlorophyll content was measured using a TYS-B chlorophyll meter (Zhejiang Top Company). The measurement was performed on healthy and mature leaves from the upper part of the plant.

[0116] Method for determining the relative water content of leaves: The relative water content of leaves is determined using the saturated weighing method. Approximately 0.2g of the leaf sample to be tested is cut and placed in a centrifuge tube of known weight. Its fresh weight (W1) is immediately measured using a 0.01% balance. The weighed fresh plant material is then soaked in water for 24 hours. After removing the sample and absorbing the surface moisture, its saturated weight (W2) is measured. Finally, after blanching in a 105℃ oven for 1 hour, the sample is dried at 85℃ to constant weight, and its dry weight (W3) is measured. The calculation formula is:

[0117]

[0118] The specific embodiments of the present invention have been described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions to this utility model are also within the scope of the present invention. Therefore, all equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered within the scope of the present invention.

Claims

1. A beach pea root system CML37 gene characterized in that, The coding region sequence is shown as SEQ ID NO:

1.

2. The root system of Glycine wightii according to claim 1. CML37 the protein encoded by the gene.

3. A plant comprising the roots of the bean of claim 1. CML37 a recombinant vector or host cell or expression cassette comprising the gene coding region.

4. The recombinant vector of claim 3, wherein, The original vector of the recombinant vector is a PHB expression vector, and the rhizosphere of the Vigna umbellata CML37 The gene coding region is located between the BamHI and PstI restriction enzyme sites of the PHB expression vector.

5. The Glycine wushiensis root system of claim 1. CML37 The use of the gene of claim 1, or the protein of claim 2, or the recombinant vector or host cell or expression cassette of claim 3 in improving salt tolerance and / or promoting plant growth in Arabidopsis and / or soybean.

6. The roots of Glycine max of claim 1. CML37 The use of the gene of claim 1, or the protein of claim 2, or the recombinant vector or host cell or expression cassette of claim 3 in increasing the length of the roots of Arabidopsis thaliana, and / or increasing the relative content of chlorophyll of Arabidopsis thaliana, and / or decreasing the electrolyte leakage rate of Arabidopsis thaliana.

7. The Glycine max root system of claim 1. CML37 CML37 The use of the gene of claim 2, or the protein of claim 3, or the recombinant vector or host cell or expression cassette of claim 3 in increasing photosynthetic rate, and / or increasing relative chlorophyll content, and / or decreasing electrolyte leakage, and / or decreasing Na + , Cl - content, and / or increasing Ca 2+ content, and / or decreasing leaf wilting, and / or increasing biomass, and / or increasing drought tolerance in plants, wherein the plants are Glycine max.

Images