Wheat stripe rust resistance regulation gene TaWAK2, and encoded protein and application thereof
By discovering the TaWAK2 gene on wheat chromosome 3B and silencing its expression using VIGS technology, the problem of insufficient resistance to wheat stripe rust was solved, achieving efficient disease-resistant breeding and yield improvement in wheat.
Patent Information
- Application Number
- CN202411979111.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-31
- Publication Date
- 2025-11-07
- Estimated Expiration
- 2044-12-31
AI Technical Summary
Existing wheat varieties lack sufficient resistance to stripe rust, resulting in severe yield losses. Chemical control is costly and poses environmental risks. Therefore, it is necessary to discover new stripe rust resistance-regulating genes to improve wheat's resistance to the disease.
We discovered and verified that the TaWAK2 gene on wheat chromosome 3B negatively regulates stripe rust resistance. By silencing the TaWAK2 gene using virus-induced gene silencing technology (VIGS), we improved wheat stripe rust resistance. We also developed an InDel molecular marker combo for identification and breeding.
It significantly improved wheat resistance to stripe rust, provided new gene targets and molecular genetic basis for wheat breeding, broadened the disease resistance gene resource pool, and reduced reliance on chemical control.
Smart Images

Figure CN119776376B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of molecular biology, in particular to a wheat stripe rust resistance regulating gene TaWAK2, the encoded protein and application thereof. BACKGROUND
[0002] Wheat has a long history of cultivation. Today, more than 35% of the world's population relies on wheat as their main food. As one of the world's three major food crops, wheat provides 20% of the world's protein and energy, so increasing wheat production is of great significance to global food security stability (Li Chao, Huangtu Plateau Dryland Wheat Yield Increase Quality Increase Efficiency Restricting Factors and Regulation Measures. Doctoral dissertation, Yangling, Shaanxi, 2023). However, in recent years, the spring temperature fluctuations are serious, the winter is warm, and the simplified cultivation technology is implemented, combined with the low disease resistance level of winter wheat varieties in most parts of the country, resulting in increasingly serious wheat disease problems. Wheat stripe rust caused by Puccinia striiformis f. sp. tritici (Pst) is one of the world's most prevalent diseases, which has a devastating impact on wheat production. In epidemic years, it can cause more than 40% reduction in wheat yield, or even complete loss (Chen Wanquan, Kang Zhen-sheng, Ma Zhahong, et al. Theory and practice of comprehensive management of wheat stripe rust in China. Chinese Journal of Agricultural Sciences, 4254-4262, 2013; Gao Xinpei, Zhao Yun, Liu Bo-fan, et al. Genetic analysis of Puccinia striiformis population in main winter wheat areas based on virulence phenotype and genotype. Chinese Journal of Agricultural Sciences, 2629-2642, 2023). Although in recent years, with the promotion of the national one-spray-three-prevention technology, the yield loss caused by the large-scale epidemic of stripe rust has been effectively reduced. For example, in 2017 and 2020, two large-scale epidemics of stripe rust caused a 428 million kg and 249 million kg reduction in actual wheat yield, respectively (Liu Wancai, Wang Baotong, Zhao Zhonghua, et al. Historical review and countermeasures of China's wheat stripe rust epidemic. China Plant Protection Guide, 42(6):21-27+41, 2022). However, the cost of using chemical agents is too high, and there is a potential environmental risk. In the long run, cultivating high-yield and disease-resistant wheat varieties is the most economical and environmentally friendly solution to ensure national food security strategy. Therefore, continuously exploring new stripe rust regulating genes and in-depth study of the molecular mechanism of gene regulation of stripe rust has very important scientific significance for crop breeding improvement.
[0003] Wheat stripe rust resistance genes are divided into seedling resistance (SR) genes and adult-plant resistance (APR) genes. SR genes can express throughout the growth stage of wheat, and usually have small race specificity (Chen YY, Zhang PP, Zhang BL, et al. Development of molecular markers linked to Yr52, a high-temperature adult-plant resistance gene to stripe rust in wheat based on BSE-seq. Plant Protection, 1-10, 2024). As of 2024, there are 87 officially named stripe rust resistance genes, namely Yr1–Yr87, but most of the genes belong to SR class (58), and the resistance is often not durable (Sharma D, Avni R, Gonzalez G J, et al. A single NLR gene confers resistance to leaf and stripe rust in wheat. Nature communications, 2024, 15(1): 9925.).In the past 50 years, due to the emergence and prevalence of new virulence races of Puccinia striiformis f. sp. tritici, China has experienced several stripe rust epidemics. For example, CYR17 and CYR18 caused Avros and their derivatives to lose resistance in 1975, CYR29 caused Yr9 in Loxes to lose resistance in 1985, CYR32 caused Yr3 and Yr4 in Jimai6 and its derivatives to lose resistance in 1991, and CYR34 caused Yr24 / Yr26 / YrCH42 in 92R, Guinong, and Chuanmai to lose resistance in recent years (Hu, Wang, and Kang. Research progress on virulence variation of Puccinia striiformis f. sp. tritici in China. Chinese Journal of Wheat and Wheat Improvement, 34(05):709-716, 2014; Yao, Wang, Meng, et al. Virulence and genetic diversity of Puccinia striiformis f. sp. tritici races CYR32 and CYR33 in China. Plant Protection, 46-52, 2018; Wan et al. Wheat stripe rust epidemic and virulence of Puccinia striiformis f. sp. tritici in China in 2002. Plant Disease, 896-904, 2004; Wang et al. Stripe rust resistance to a burgeoning Puccinia striiformis f. sp. tritici race CYR34 in current Chinese wheat cultivars for breeding and research. Euphytica, 215, 2019), which has caused serious threats to national food security. Therefore, it is of great significance to continuously excavate new wheat stripe rust resistance regulatory genes, broaden and enrich the wheat stripe rust gene resource library, and breed wheat resistant to stripe rust.
[0004] With the rapid development of genome sequencing technology, a number of wheat SNP chips have been widely used in the mining of genetic loci related to wheat yield and disease resistance (Sun et al., The Wheat 660K SNP array demonstrates great potential for marker-assisted selection in polyploid wheat. Plant Biontechnology Journal. 1354-1360, 2020; Ma et al., Identification of major QTLs for yield-related traits with improved genetic map in wheat. FRONTIERS IN PLANT SCIENCE, 2023; Liu et al., A 55K SNP array-based genetic map and its utilization in QTL mapping for productive tiller number in common wheat. THEORETICAL AND APPLIED GENETICS, 2439-2450, 2018), which has significantly improved the speed of fine mapping and cloning of wheat disease resistance genes. In the previous study, the applicant used a wheat association population and a RIL population for genome-wide association analysis and linkage analysis, and mined a new wheat stripe rust resistance QTL site QYr.hau-3BS on the 3BS chromosome of Zhou 8425B, which is between molecular markers M328 and M311. On this basis, the present study further fine-mapped the QTL site using a secondary separation large population constructed by the remaining heterozygous lines, and combined the information of the Chinese spring transcriptome database and the fungus-induced transcriptome analysis to mine important candidate genes TaWAK1 and TaWAK2 that regulate stripe rust resistance, and then used virus-induced gene silencing technology to confirm that TaWAK2 gene negatively regulates wheat stripe rust resistance, which can be used as a new gene target for wheat stripe rust resistance breeding.
[0005] In summary, mining wheat stripe rust resistance-related genes with breeding application value and effectively utilizing them is the most economical, effective and green way to prevent and control wheat stripe rust. Therefore, mining wheat stripe rust resistance-related genes through genetic means and then exploring their functions will provide an important theoretical basis and new gene targets for wheat stripe rust molecular breeding. SUMMARY
[0006] The application aims to provide a wheat stripe rust resistance regulating gene TaWAK2, an encoding protein thereof and an application thereof, so as to solve the problems in the prior art.
[0007] To achieve the above-mentioned object, the application provides the following solutions.
[0008] In one of the technical solutions of the application, the application of the TaWAK2 gene or the protein encoded by the TaWAK2 gene in regulating wheat stripe rust resistance is provided.
[0009] In another of the technical solutions of the application, the application of a recombinant vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing the TaWAK2 gene in regulating wheat stripe rust resistance is provided.
[0010] In a third of the technical solutions of the application, a method for regulating wheat stripe rust resistance is provided, in which the TaWAK2 gene is silenced or knocked out to improve the resistance of wheat to stripe rust.
[0011] In a fourth of the technical solutions of the application, an InDel molecular marker combination related to wheat stripe rust resistance is provided, the molecular marker combination is located on the 3BS chromosome of wheat, and includes InDel 1 and InDel 2.
[0012] The InDel 1 is a nucleotide sequence as shown in SEQ ID NO. 9, and the insertion or deletion of 2 bases at positions 8 and 9 of the nucleotide sequence.
[0013] The InDel 2 is a nucleotide sequence as shown in SEQ ID NO. 9, and the insertion or deletion of 8 bases from position 124 to position 131 of the nucleotide sequence.
[0014] In a fifth of the technical solutions of the application, a primer set for amplifying the InDel molecular marker combination is provided, and includes an upstream primer as shown in SEQ ID NO: 7 and a downstream primer as shown in SEQ ID NO: 8.
[0015] In a sixth of the technical solutions of the application, a method for identifying wheat stripe rust resistance is provided, in which a wheat gene to be tested is used as a template, the primer set is used for amplification, if the size of the amplification product is 173bp, the plant is a disease-resistant plant, and if the size of the amplification product is 163bp, the plant is a disease-susceptible plant.
[0016] In a seventh of the technical solutions of the application, the application of the InDel molecular marker combination in wheat stripe rust resistance-related trait breeding is provided.
[0017] In an eighth of the technical solutions of the application, the application of the InDel molecular marker combination in identifying or assisting in identifying wheat stripe rust resistance-related traits is provided.
[0018] Based on the above technical scheme, the application has the following technical effects:
[0019] The application discloses a novel wheat stripe rust resistance regulating gene TaWAK2, the gene is located on the short arm of wheat 3B chromosome, and the expressed protein can negatively regulate wheat stripe rust resistance; the virus-induced gene silencing technology (VIGS) is used to prove that the stripe rust resistance of the plant is obviously improved by silencing TaWAK2 in the wheat plant, and it is indicated that TaWAK2 is an important gene for regulating wheat stripe rust resistance. BRIEF DESCRIPTION OF DRAWINGS
[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments will be briefly introduced as follows. Obviously, the drawings in the following description only constitute some embodiments of the present application, and other drawings can be obtained by those skilled in the art without any creative effort on the basis of these drawings.
[0021] Figure 1 For fine mapping of the wheat stripe rust resistance QTL site QYr.hau-3BS, wherein, XHM818 represents Xinhua 818; YM1 represents Yumai 1; R1-S5 represents 11 exchange types; n represents the number of single plants of different exchange types; M328-M311 represents the names of different molecular markers; the different colors of the bottom arrows represent different annotated genes in the section, and the length and position of different annotated genes are represented by the length.
[0022] Figure 2 For the leaf expression level column chart of the genes differentially expressed in the section of fine mapping of the QTL and induced by the fungus, wherein, a represents the expression level of the three candidate genes in different tissues in the section; b represents the gene expression level of the three candidate genes inoculated at different time points, 0, 24, 36, 48 and 72 respectively represent 0 hours, 24 hours, 36 hours, 48 hours and 72 hours after inoculation.
[0023] Figure 3 For the expression pattern of TaWAK1 / 2 at different times and spaces after CYR34 inoculation treatment.
[0024] Figure 4The relative expression column chart of two candidate genes in VIGS silencing test (the receptor material is the susceptible parent Yannong 1) and the photos of resistance reaction to wheat stripe rust. Among them, a is the phenotype photos of wheat stripe rust at seedling stage of TaWAK1 and TaWAK12 gene silenced plants and control plants, b is the relative expression of TaWAK1 and TaWAK12 genes of gene silenced plants and control plants, c is the relative quantification of Puccinia striiformis of TaWAK1 and TaWAK12 gene silenced plants and control plants, d is the severity of wheat stripe rust of TaWAK1 and TaWAK12 gene silenced plants and control plants.
[0025] Figure 5 The electrophoretogram of M306 marker developed according to two InDels. Among them, M represents DNA Marker, R lines represent resistant materials, and S lines represent susceptible materials. DETAILED DESCRIPTION
[0026] Various exemplary embodiments of the present application will now be described in detail, which should be considered in a descriptive sense only and not for purposes of limitation to the present application. Rather, it is understood that certain aspects, particular features and embodiments of the application are described for illustrative purposes only and are not exhaustive of all aspects, particular features, and embodiments of the application.
[0027] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. In addition, for a range of values of a parameter, unless otherwise stated, each intervening value of the parameter is also specifically included within the scope of the present application. The intervening values of the parameter are combined with a stated value of the parameter in range form. Furthermore, each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is also encompassed within the scope of the present application. The same is true for any other delineated range of values. Moreover, any listed maximum numerical limitation constitutes both a strict maximum and a strict minimum for the characterizing property.
[0028] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All publications mentioned in this specification are herein incorporated by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The citation of any reference in this specification is not an admission that it is prior art.
[0029] Many modifications and variations of this application specification can be made in light of its description, which should be considered within the scope of the present application. Other embodiments of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application. The specification and examples are illustrative only.
[0030] As used herein, "comprise", "comprising", "including", "include", "contain", "containing", "have", "having", and the like, are open-ended terms that are intended to mean including, but not limited to.
[0031] The technical solutions described in the present application are conventional solutions in the art if not specifically stated, and the reagents or raw materials used are purchased from commercial channels or are disclosed if not specifically stated.
[0032] In the quantitative test in the following examples, three repeated experiments were set, and the results were averaged. The primer synthesis and sequencing work were completed by Shengong Bioengineering (Shanghai) Co., Ltd.
[0033] The application provides an application of a TaWAK2 gene or a protein coded by the TaWAK2 gene in regulating wheat stripe rust resistance, and a CDS nucleotide sequence of the TaWAK2 gene is shown in SEQ ID NO: 3.
[0034] In some specific embodiments, the TaWAK2 gene is silenced or knocked out to improve the resistance of wheat to stripe rust.
[0035] The application also provides an application of a recombinant vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing the TaWAK2 gene in regulating wheat stripe rust resistance.
[0036] In some specific embodiments, the TaWAK2 gene is silenced or knocked out to improve the resistance of wheat to stripe rust.
[0037] The application also provides a method for regulating wheat stripe rust resistance, and the TaWAK2 gene is silenced or knocked out to improve the resistance of wheat to stripe rust.
[0038] The application also provides an InDel molecular marker combination related to wheat stripe rust resistance, the molecular marker combination is located on a 3BS chromosome of wheat, and includes InDel 1 and InDel 2.
[0039] The InDel 1 is a nucleotide sequence shown in SEQ ID NO. 9, and the InDel 1 is an insertion or deletion of two bases at positions 8 and 9 of the nucleotide sequence.
[0040] The InDel 2 is a nucleotide sequence shown in SEQ ID NO. 9, and the InDel 2 is an insertion or deletion of eight bases from position 124 to position 131 of the nucleotide sequence.
[0041] The application also provides a primer set for amplifying the InDel molecular marker combination, and the primer set includes an upstream primer shown in SEQ ID NO: 7 and a downstream primer shown in SEQ ID NO: 8.
[0042] The application also provides a method for identifying the resistance of wheat stripe rust, using a wheat gene as a template, using the primer set for amplification, if the size of the amplification product is 173bp, it is a disease-resistant plant, and if the size of the amplification product is 163bp, it is a disease-susceptible plant.
[0043] The application also provides application of the InDel molecular marker combination in breeding of wheat resistance to stripe rust.
[0044] The application also provides application of the InDel molecular marker combination in identifying or assisting in identifying wheat resistance to stripe rust.
[0045] The wheat material involved in the embodiment includes:
[0046] Parent materials: disease-resistant parent Xinhua Mai 818 and disease-susceptible parent Yumai No. 1
[0047] Secondary separation population: 1021 F2 single plants constructed by using Xinhua Mai 818 / Yumai No. 1 hybrid F4 population
[0048] Receptor material: Yumai No. 1
[0049] Embodiment 1
[0050] Fine mapping of wheat resistance to stripe rust QTL and candidate gene mining are carried out through the secondary separation population, and the specific process is as follows:
[0051] 1. Planting of parents and population
[0052] The 1021 F2 single plants used for fine mapping are planted in the scientific research base of Sichuan Academy of Agricultural Sciences in the 2023-2024 growing season, a completely randomized block design is adopted, single row planting is adopted, 15 seeds per row, and the test field is managed according to the standard. No drought and pest occurrence occurs during the whole growth period. After maturation and harvesting, uniform threshing, drying and preservation are carried out.
[0053] 2. Field inoculation and investigation of stripe rust
[0054] When the wheat is at 3-4 leaf stage, the susceptible plants Mingxian 169 inoculated with mixed races of stripe rust in the greenhouse are transplanted in the field at a density of 2 seedlings per meter, and then the transplanted plants are inoculated with mixed races of stripe rust. It should be noted that if the weather is dry, water should be irrigated in time to ensure the success of the stripe rust epidemic. The mixed races of stripe rust used for inoculation are provided by the local plant protection station and represent the local stripe rust composition, including CYR32, CYR33, CYR34, Shui4, Shui6, Hy6 and Hy7, etc. Field disease investigation is carried out on the test population and its parents when the stripe rust epidemic is the most serious (i.e. when the leaves of the susceptible control Mingxian 169 are almost covered with urediniospore piles of stripe rust). The investigation index is the maximum severity (MDS), i.e. the percentage of the area of urediniospore piles on the leaf to the total leaf area. The disease investigation in this example was carried out on March 31, 2024 in Chengdu, Sichuan.
[0055] 3Plant genomic DNA extraction
[0056] The plant genomic DNA extraction was carried out by SLS extraction method, and the specific steps were as follows:
[0057] The leaf samples taken back from Sichuan were taken out from the -20°C refrigerator, added into 2 mL centrifuge tubes respectively, and steel balls were added, and placed in liquid nitrogen. After all the samples were dispensed, a sample puncher was used to crush them into powder. 800 μL of SLS solution prepared in advance was added, and then placed in a 37°C shaker for 10 min. Then 800 μL of DNA extraction reagent (three-in-one) was added, and also placed in a 37°C shaker for 10 min. Then it was balanced in a centrifuge at 12000 rpm for 10 min. After centrifugation, 650 μL of supernatant was taken into a 1.5 mL centrifuge tube, and isopropanol was added in the same volume as the supernatant, and slowly inverted up and down to mix, and placed in a -20°C refrigerator for at least 30 min. After taking the mixture out of the -20°C refrigerator, it was placed in a centrifuge at 12000 rpm for 10 min. The supernatant was poured out, and the white precipitate at the bottom was left. 1 mL of 75% alcohol was added to the centrifuge tube, and placed in a centrifuge at 12000 rpm for 10 min. The supernatant was discarded, 1 mL of anhydrous ethanol was added, and placed in a centrifuge at 12000 rpm for 10 min. The supernatant was discarded again, and left to dry at room temperature. Then 100 μL of ddH2O was added to dissolve, and the concentration was measured.
[0058] 4InDel marker development
[0059] According to the information of Chinese Spring V1.0 reference genome published by IWGSC (https: / / urgi.versailles.inra.fr / blast_iwgsc / ) and the information of Zhong 8425B genome completed by College of Agronomy, Henan Agricultural University (internal communication), the physical interval of the flanking markers of QYr.hau-3BS preliminary mapping is 13.25-14.16 Mb (Chinese Spring) or 18.60-20.33 Mb (Zhong 8425B). Based on the genomic sequence information of Chinese Spring and Zhong 8425B in the mapping segment, the two genomic sequences are aligned to find the insertion and deletion (Indel) sites that are different between the two genomes, and the sequences of 300 bp upstream and downstream of the Indel sites are extracted, respectively. The primers are designed by NCBI and the physical positions of the primers in Chinese Spring and Zhong 8425b are recorded. The developed primers are detected in parents to verify whether the primers are effective, and the primers with polymorphism between parents are selected for detection in the segregation population, and the genotypes are recorded. Based on the above method, a total of 7 polymorphic markers are finally developed in the above mapping segment for QTL fine mapping, wherein M306 (i.e. the primer pair consisting of SEQ ID NO: 5 and SEQ ID NO: 6) is co-segregated with the stripe rust phenotype.
[0060] SEQ ID NO: 5: 5'-TGCTCTAGTGGTCTGAGTGT-3';
[0061] SEQ ID NO: 6: 5'-GGGGGCAGAACATGATGAAA-3'.
[0062] 5Screening of exchange single plants and candidate gene mining
[0063] The genotypes of F2 single plants of the secondary segregation population are detected by using 7 InDel markers (M298-1, M298-3, M13, M344, M305, M306, M352) spanning the QYr.hau-3BS preliminary mapping region, and the exchange single plants are screened in combination with the maximum disease severity (MDS) of stripe rust in the field, and a total of 18 exchange single plants are screened, of which 12 are heterozygous exchange and 6 are homozygous exchange. These exchange single plants are divided into 11 exchange types ( Figure 1 ). The screening results of the exchange single plants show that QYr.hau-3BS is further located between markers 13,963,083 bp and 14,000,266 bp, corresponding to a physical segment of about 37.18 Kb (13.96-14.00 Mb) of Chinese Spring reference genome (http: / / 202.194.139.32 / ) ( Figure 1 ). According to the annotation information of Chinese reference genome, there are 3 high-confidence annotated genes in this segment, which are named as TaWAK1, TaWAK2 and TaE3B according to the annotation information of Chinese Spring genome, respectively.
[0064] The expression levels of the above three genes in the wheat root, stem, leaf, ear and grain were analyzed, showing that TaWAK1 and TaWAK2 genes had higher expression in the leaf Figure 2 a); To further clarify the candidate genes, the above three genes were analyzed using the transcriptome data induced by stripe rust, and it was found that TaWAK1 and TaWAK2 strongly responded to stripe rust induction Figure 2 b); In addition, the qRT-PCR results showed that at 48h after inoculation, TaWAK1 and TaWAK2 genes were induced and up-regulated in the susceptible parent Yumai No. 1 and the susceptible pool material Figure 2 b). Therefore, it is believed that TaWAK1 and TaWAK2 genes are important candidate genes of the wheat stripe rust resistance QTL QYr.hau-3BS.
[0065] Example 2
[0066] VIGS silencing test of TaWAK1 and TaWAK2 genes and identification of stripe rust resistance
[0067] The susceptible parent Yumai No. 1 was selected as the receptor material, and the VIGS technology was used to silence the wheat genes TaWAK1 and TaWAK2, and then inoculated with stripe rust CYR34 for gene function verification. After 2 weeks of VIGS silencing, the relative expression of TaWAK1 and TaWAK2 genes in the silencing plants (BSMVg) and the virus empty plants (BSMV0) was detected by qRT-PCR technology, as shown in Figure 4 The results showed that the relative expression of TaWAK1 and TaWAK2 genes in the receptor material plants was significantly down-regulated, and the genes were effectively silenced in different receptor material plants. Further investigation of the stripe rust resistance of the receptor material silencing plants showed that compared with the control plants WT (control plants without inoculation of virus) and BSMV-γ0 (plants inoculated with empty BSMV virus), the degree of stripe rust infection of TaWAK2 silencing plants was extremely significantly reduced, while the stripe rust phenotype of TaWAK1 silencing plants had no obvious change Figure 4 ). In summary, TaWAK2 gene is an important negative regulatory gene in the response process of wheat stripe rust, which significantly affects the resistance of wheat stripe rust.
[0068] The construction method of the VIGS vector of TaWAK1 and TaWAK2 genes is as follows:
[0069] According to the CDS sequence of TaWAK1 gene, primers were designed, and enzyme digestion sites and protection bases were added to the 5' ends of the forward and reverse primers, respectively, to form the upstream primer shown in SEQ ID NO. 11 and the downstream primer shown in SEQ ID NO. 12.
[0070] SEQ ID NO. 11: 5'-TCCTCCTGCTCTGTCTTCTG-3';
[0071] SEQ ID NO. 12: 5'-GGTCACTTTGCATGGTCCA-3'.
[0072] The primer pair is used to amplify the VIGS silencing fragment of the TaWAK1 gene and recovered for standby.
[0073] The primer is designed according to the CDS sequence of the TaWAK2 gene, and the enzyme cutting site and protection base are added to the 5' end of the forward and reverse primers respectively to form the upstream primer shown in SEQ ID NO. 13 and the downstream primer shown in SEQ ID NO. 14.
[0074] SEQ ID NO. 13: 5'-ACCCTGCAAGCCTTATTAATCT-3';
[0075] SEQ ID NO. 14: 5'-GCTTGTTCTCGGTGCAAAC-3'.
[0076] The primer pair is used to amplify the VIGS silencing fragment of the TaWAK2 gene and recovered for standby.
[0077] The VIGS silencing fragments of the TaWAK1 and TaWAK2 genes and the γ-PDS-as vector are further double enzyme cut by Pac1 and Not1, the silencing fragments and the corresponding γ linearized vector fragments are recovered, and the recombination vector construction (γ-WAK1 / 2) is completed by using the homologous recombination method.
[0078] Subsequently, the virus vectors (α, β, γ, γ-PDS) and the TaWAK1 / 2 gene silencing recombination vector (γ-WAK1 / 2) plasmid are linearized by enzyme cutting, and the linearized plasmid is further transcribed in vitro by using the RiboMAXTM Large Scale RNA Production Systems-T7 kit to obtain the in vitro transcription products of different components of the virus. Take 2.5 μL of the in vitro transcription products α, β, γ / γ-PDS / γ-WAK1 / 2, mix them in a ratio of 1:1:1 and dilute with an equal volume of DEPC water, and take 5 μL of the diluted mixture and add it to 90 μL of FES buffer and mix well. Four different treatments are set for each test, which are: complete blank control group (WT), virus blank control group (α+β+γ), albino positive control group (α+β+γ-PDS) and gene silencing group (α+β+γ-WAK1 / 2).
[0079] When the virus infects, a small amount of DEPC water is first sprayed on the surface of the plant to be infected, 8-10 μL of FES mixed solution is taken and applied to the second leaf of the seedling by rubbing from the base to the tip of the leaf 3 times. The rubbing force is controlled, and after rubbing, a small amount of DEPC water is sprayed from top to bottom to keep the humidity. Each treatment needs to use a clean glove. After virus inoculation, the plants are placed in a 23±2°C incubator for 24 hours, and then the light and dark cycles are adjusted to 16h / 8h. The phenotype changes are observed and recorded regularly.
[0080] After 2 weeks of VIGS silencing, the relative expression of TaWAK1 / 2 gene in the silencing plants (BSMVg) and virus empty plants (BSMV0) was detected by qRT-PCR technology, as shown in Figure 4 The results showed that the relative expression of TaWAK1 / 2 gene in the recipient material plants was significantly down-regulated, and the gene was effectively silenced in different recipient material plants.
[0081] Further investigation of the resistance of the silencing plants of the recipient material Yumai No. 1 to stripe rust showed that the number of spores of Puccinia striiformis attached to the leaf surface of the TaWAK2 gene silencing plants was significantly reduced, and the number of mycelium colonization was significantly reduced, and the disease resistance was significantly enhanced. However, the TaWAK1 gene silencing plants had no obvious change in resistance to stripe rust compared with the control plants. Figure 4 ).
[0082] In summary, the resistance of the TaWAK2 gene silencing plants changed greatly, indicating that the gene is a negative regulatory gene in the response process of wheat stripe rust.
[0083] Example 3
[0084] Development and application of TaWAK2 allelic marker
[0085] The genomic nucleotide sequence of TaWAK2 gene is shown in SEQ ID NO: 1.
[0086]
[0087] The nucleotide sequence of the full-length cDNA of TaWAK2 gene is shown as SEQ ID NO: 2.
[0088]
[0089] The nucleotide sequence of the CDS of the TaWAK2 gene is shown as SEQ ID NO: 3.
[0090]
[0091] The protein sequence encoded by the TaWAK2 gene is shown as SEQ ID NO: 4.
[0092] SEQ ID NO: 4: MAICSSLHLSTTLQALLIFVVLAVLLRDVHGRHHCDTFSCGHLHNISHPFRRQGDPHGCGVQSYELVCTENKPKIQINTATYFVTEINYTDSSFRVVDVNLDMNSSCPLPRWDELPYFNGIQRSDKDQSWELLPMYTDTVGSFVNCSQAVSLTNEFYQYSYTSVPCLSNNHSFVYIVTDTVPIEYLAPSCGYLAMFLLSDPGPGNYYNFSHYADFVKHLRLGFSVRFPLLDPPMSIIGRINFCLNESFRDRNHVTGNNIKSWTMDILLMDFSFWACIFGVNLNSNNMLLYMRVMIHDDQSFHHVLPPVFALVIAKWIAVLCRILLAPLAVLMFLAQKYWKTRITIDAVEKFLQMQQMIGPTRYAYTDIVALTSHFRDKLGQGGYGSVFKGVLLPGNVNIAVKMLEGSSNCNGEDFISEVSTIGRIHHVNVVRLVGFCSEEMRRALVYEYMPRGSLDKYIFSAQKSFSWDKLNEIALGTARGINYLHQGCEMQILHFDIKPHNILLDNNFVPKVADFGLAKLYPRDNSFVPSNALRGTVGYIAPEMISRSFGTISSKSDVYSFGMLLLEMAGGRRNADPNAANSSQSYYPSWVYDKLTAQEADAISLVADMHELERKLCIVGLWCIQMKSHDRPTMSEVIEMLEGGFDGLQMPSRPFFCDDEHTAVPDSYPLLSELTEISAEDEISDSYVSRVL.
[0093] According to the 10bp InDel between the two positions from the 108th to the 109th base before the translational initiation site and after the ATG in the sequence shown as SEQ ID NO: 1, a specific molecular marker is developed to detect the difference site, and the specific primer pair for amplifying the mutation site comprises the upstream primer sequence shown as SEQ ID NO: 7 and the downstream primer sequence shown as SEQ ID NO: 8.
[0094] SEQ ID NO: 7: 5'-GCAAGCCATGGCGATTTGTA-3';
[0095] SEQ ID NO: 8: 5'-CCGGCGGAAAGGATGTGATA-3'.
[0096] The disease-resistant parent (Xinhua 818), the disease-susceptible parent (Yumai 1), the disease-resistant pool, and the disease-susceptible pool were used as samples. The genomic DNA of each sample was used as a template to perform PCR amplification with the markers M306 (i.e., SEQ ID NO: 7 and SEQ ID NO: 8), respectively. The PCR amplification products were recovered with a 40% polyacrylamide gel to obtain bands of 173 bp (SEQ ID NO: 9, disease-resistant genotype) or 163 bp (SEQ ID NO: 10, disease-susceptible genotype), respectively.
[0097] SEQ ID NO: 9: GCAAGCC AT ATGGCGATTTGTAGTTCACTTCATCTTTCTACTACCCTGCAAGCCTTATTAATCTTTGTTGTGCTTGCAGTACTCTTACGTGATGTTCATGGGCGACACCACTGTGATACTTTC ACACTTTC TCCTGTGGACATCTCCATAATATATCACATCCTTTCCGCCGG;
[0098] SEQ ID NO: 10: GCAAGCCATGGCGATTTGTAGTTCACTTCATCTTTCTACTACCCTGCAAGCCTTATTAATCTTTGTTGTGCTTGCAGTACTCTTACGTGATGTTCATGGGCGACACCACTGTGATACTTTCTCCTGTGGACATCTCCATAATATATCACATCCTTTCCGCCGG.
[0099] The primers were designed according to the CDS sequence of the TaWAK1 gene, and enzyme cutting sites and protection bases were added to the 5' ends of the forward and reverse primers, respectively, to form the upstream primer shown in SEQ ID NO. 11 and the downstream primer shown in SEQ ID NO. 12.
[0100] SEQ ID NO. 11: 5'-TCCTCCTGCTCTGTCTTCTG-3';
[0101] SEQ ID NO. 12: 5'-GGTCACTTTGCATGGTCCA-3'.
[0102] According to the CDS sequence of the TaWAK2 gene, a primer is designed, and a restriction enzyme site and a protection base are added to the 5' end of the forward and reverse primers respectively to form the upstream primer shown in SEQ ID NO. 13 and the downstream primer shown in SEQ ID NO. 14.
[0103] SEQ ID NO. 13: 5'-ACCCTGCAAGCCTTATTAATCT-3';
[0104] SEQ ID NO. 14: 5'-GCTTGTTCTCGGTGCAAAC-3'.
[0105] The amplification results of the marker M306 on the resistant parent and the resistant-susceptible pool are shown in Fig. 2. Figure 5 In the figure, M represents a DNA molecular weight marker, R represents a resistant strain, and S represents a susceptible strain. The black arrow in the figure represents the fragment corresponding to the molecular marker M306-1.
[0106] The results show that the molecular marker M306 located on the 3BS chromosome has consistent polymorphism between the parent and the resistant-susceptible pool, that is, the Xinhuamai 818 and the resistant strain can both amplify a 173bp DNA fragment, while the Yumai 1 and the susceptible strain can both amplify a 163bp DNA fragment, proving that the molecular marker is closely linked to the stripe rust resistance gene.
[0107] Obviously, the above embodiments of the present application are only examples for clearly illustrating the present application, and are not intended to limit the embodiments of the present application. For ordinary skilled users in the art, other different forms of changes or variations can be made on the basis of the above description. Here, it is not necessary and impossible to exhaust all the embodiments. Any modification, equivalent replacement and improvement made within the spirit and principle of the present application should be included in the protection scope of the claims of the present application.
Claims
1. TaWAK2 The use of a gene or its encoded protein in increasing the resistance of wheat to stripe rust, characterized in that, The TaWAK2 The CDS nucleotide sequence of the gene is shown as SEQ ID NO: 3; Silencing or knocking out TaWAK2 genes, increasing the resistance of wheat to stripe rust.
2. A method of increasing resistance to stripe rust in wheat, comprising, Silencing or knocking out TaWAK2 The CDS nucleotide sequence of the gene is shown as SEQ ID NO:
3. TaWAK2 The CDS nucleotide sequence of the gene is shown as SEQ ID NO:
3.
3. An InDel molecular marker combination associated with resistance to wheat stripe rust, characterized in that, The molecular marker combination is located on the 3BS chromosome of wheat, and includes InDel 1 and InDel 2; The InDel 1 is a nucleotide sequence as shown in SEQ ID NO. 9, and the insertion or deletion of 2 bases at positions 8-9 of the nucleotide sequence; The InDel 2 is a nucleotide sequence as shown in SEQ ID NO. 9, and the insertion or deletion of 8 bases at positions 124-131 of the nucleotide sequence.
4. A method of identifying resistance to stripe rust in wheat, characterized by, Using a wheat genome to be tested as a template, a primer group is used for amplification, if the size of the amplification product is 173 bp, it is a resistant plant, if the size of the amplification product is 163 bp, it is a susceptible plant; The primer group includes an upstream primer as shown in SEQ ID NO: 7 and a downstream primer as shown in SEQ ID NO:
8.
5. The application of the InDel molecular marker combination of claim 3 in the breeding of wheat resistant to stripe rust.
6. The application of the InDel molecular marker combination of claim 3 in identifying or assisting in identifying the resistance of wheat to stripe rust.