A gene scn1155 that positively regulates avermectin, its overexpressing genetically engineered bacterium, preparation method and application

Abstract

A glidobactin positive regulatory gene scn1155, its overexpressing genetically engineered bacterium, preparation method and application belong to the technical field of genetic engineering. In order to improve the yield of glidobactin, the present invention has excavated a glidobactin positive regulatory gene scn1155 from the glidobactin-producing bacterium Streptomyces caniferus NEAU6, which encodes a transcriptional regulatory factor of the Fur family; in addition, the present invention uses Streptomyces caniferus NEAU6 as the starting strain to construct a recombinant bacterium overexpressing scn1155, and it is found that the recombinant bacterium can significantly improve the yield of glidobactin compared with the control strain, and can be applied to the production of glidobactin.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to a glivemycin positive regulatory gene scn1155, an overexpressed genetically engineered bacterium thereof, a preparation method and an application. Background Art

[0002] Glivemycin is a purine nucleoside natural product produced by Streptomyces. In recent years, it has been registered as a new pesticide for increasing rice yield because of its excellent biological activities such as promoting seed germination, tillering and early maturity of plants. However, the low fermentation titer and high production cost of glivemycin have greatly limited its wide application. Systematically exploring the transcriptional regulation network of glivemycin biosynthesis, especially the regulatory mechanism of important transcription factors, is a necessary step to achieve high yield of glivemycin and promote its wide application in rice production.

[0003] Natural products in Streptomyces are usually produced at relatively low levels, mainly because Streptomyces has a complex internal regulatory network that strictly controls their biosynthesis. Transcriptional regulatory factors are the main components of this regulatory network and play a key role in determining the production and final yield of natural products. Streptomyces caniferus NEAU6 is a glivemycin-producing strain with independent intellectual property rights, and its genome contains 652 genes encoding transcriptional regulatory factors, but the functions of the vast majority of transcription factors are unknown. Mining the transcriptional regulatory genes affecting glivemycin synthesis in Streptomyces caniferus NEAU6 will provide important high-yield breeding gene resources for the construction of high-yield glivemycin strains. Summary of the Invention

[0004] In order to improve the yield of glivemycin, the present invention has mined a glivemycin positive regulatory gene scn1155 from the glivemycin-producing strain Streptomyces caniferus NEAU6, which encodes a transcriptional regulatory protein of the Fur family; in addition, using Streptomyces caniferus NEAU6 as the starting strain, a recombinant bacterium overexpressing scn1155 has been constructed, and it has been found that the recombinant bacterium can improve the yield of glivemycin compared with the control strain.

[0005] To solve the above technical problems and achieve the corresponding technical effects, the present invention provides the following technical solutions:

[0006] The first object of the present invention is to provide a glivemycin positive regulatory gene scn1155, wherein the glivemycin positive regulatory gene scn1155 encodes a transcriptional regulatory factor of the Fur family, and the nucleotide sequence is as shown in SEQ ID NO.1.

[0007] The second object of the present invention is to provide a recombinant expression vector containing the above glivemycin positive regulatory gene scn1155.

[0008] The third object of the present invention is to provide the use of the above-mentioned gouvei mycin positive regulatory gene scn1155 or the above-mentioned recombinant expression vector in increasing the yield of gouvei mycin.

[0009] The fourth object of the present invention is to provide an overexpressing genetically engineered bacterium containing the above-mentioned gouvei mycin positive regulatory gene scn1155 or the above-mentioned recombinant expression vector.

[0010] In one embodiment of the present invention, the starting strain of the overexpressing genetically engineered bacterium is Streptomyces caniferus NEAU6.

[0011] The fifth object of the present invention is to provide the use of the above-mentioned overexpressing genetically engineered bacterium in increasing the yield of gouvei mycin. The application is to culture the overexpressing genetically engineered bacterium of the present invention under conditions suitable for the production of gouvei mycin, that is, the overexpressing genetically engineered bacterium is cultured in a seed medium and then fermented in a fermentation medium to synthesize gouvei mycin.

[0012] In one embodiment of the present invention, the composition of the seed medium is: sucrose 20 g / L, maltodextrin 20 g / L, soybean powder 60 g / L, calcium carbonate 3 g / L, the balance is water, pH 7.0.

[0013] In one embodiment of the present invention, the composition of the fermentation medium is: sucrose 10 g / L, maltodextrin 60 g / L, soybean powder 40 g / L, calcium carbonate 4 g / L, the balance is water, pH 7.2.

[0014] The sixth object of the present invention is to provide a method for preparing the above-mentioned overexpressing genetically engineered bacterium. The preparation method includes the following steps:

[0015] 1) Construction of the overexpression plasmid of the target gene: Using the genomic DNA of Streptomyces caniferus NEAU6 as a template, the target gene and the P hrdB promoter fragment are obtained by PCR amplification, and this fragment is ligated into the pSET152 vector backbone to obtain the overexpression plasmid of the target gene; the target gene is the gouvei mycin positive regulatory gene scn1155, and the nucleotide sequence is as shown in SEQ ID NO.1;

[0016] 2) Introduce the overexpression plasmid of the target gene into Escherichia coli and transfer it into Streptomyces caniferus NEAU6 by intergeneric conjugation to obtain the overexpressing genetically engineered bacterium of the target gene.

[0017] In one embodiment of the present invention, the primers used in step 1) of the PCR amplification are scn1155-LF with a nucleotide sequence as shown in SEQ ID NO.2 and scn1155-LR with a nucleotide sequence as shown in SEQ ID NO.3; P hrdB The primers used for the PCR amplification of the promoter fragment are PhrdB-F with a nucleotide sequence as shown in SEQ ID NO.4 and PhrdB-R with a nucleotide sequence as shown in SEQ ID NO.5.

[0018] In one embodiment of the present invention, the target gene and P hrdB The promoter fragment and the vector pSET152 digested with XbaI and EcoRI are assembled through the ClonExpress MultiS kit to obtain the overexpression plasmid of the target gene.

[0019] In one embodiment of the present invention, the Escherichia coli in step 2) is E.coli ET12567 / pUZ8002.

[0020] In one embodiment of the present invention, the overexpression also includes other promoters with different strengths and types.

[0021] Definitions and abbreviations:

[0022] In the present invention, the starting Streptomyces for generating the recombinant Streptomyces refers to the Streptomyces on which genetic operations such as gene overexpression shown in the present invention are performed. As used herein, "recombinant" refers to a strain with the desired modification obtained through intentional human intervention.

[0023] Advantages of the present invention:

[0024] The present invention discloses a gene scn1155 in Streptomyces caniferus NEAU6, which is a transcriptional regulator of the Fur family and can positively regulate the synthesis of avermectin. In addition, taking Streptomyces caniferus NEAU6 as the starting strain, the recombinant strain Oscn1155 was constructed based on this gene. It was found that when using the recombinant strain Oscn1155 for fermentation to produce avermectin, compared with the control strain NEAU6 / pSET152, the final avermectin yield of the recombinant strain Oscn1155 increased from 504 mg / L to 751 mg / L, a 0.5-fold increase. Description of the drawings

[0025] Figure 1 Schematic diagram for the construction of the recombinant plasmid pSET152::scn1155;

[0026] Figure 2Detection results of the content of avermectin in the fermentation broth of recombinant strain Oscn1155, control strain NEAU6 / pSET152, and original strain NEAU6; ***p<0.001. Detailed implementation manners

[0027] In order to make the objectives, technical solutions and advantages of the present invention clearer, the present invention will be further described in detail below in combination with specific implementation manners and the accompanying drawings of the specification. It should be noted that the embodiments mentioned below are only applicable to explaining the present invention, but not for limiting the scope of the present invention. The embodiments mentioned below are only a part of the embodiments of the present invention rather than all embodiments. In the art, if other technical personnel do not make creative efforts, the embodiments obtained by them are protected by the present invention.

[0028] The experimental methods used in the following embodiments are all conventional methods unless otherwise specified. The materials, reagents, culture media and instruments used are all conventional materials, reagents, culture media and instruments in the art unless otherwise specified, and those skilled in the art can obtain them through commercial channels. The molecular biology experimental operations such as PCR amplification, restriction enzyme digestion and ligation, and transformation involved in the present invention are all conventional experimental operations in the art or can be carried out in accordance with the product specifications of the corresponding reagents unless otherwise specified.

[0029] The specific detection method of avermectin used in the present invention is recorded in Shi, H. et al. Synthetic and Systems Biotechnology 10, 237 - 246, doi: https: / / doi.org / 10.1016 / j.synbio.2024.11.001(2025).

[0030] The ClonExpress MultiS kit used in the present invention is purchased from Novoprotein.

[0031] The culture media used in the present invention and their compositions are as follows:

[0032] The solid culture medium for cell growth and fermentation in the present invention is YMS solid culture medium, and its composition is:

[0033] In 1 L of the culture medium, 4 g of yeast extract powder, 10 g of malt extract powder, 4 g of soluble starch, 20 g of agar, pH 7.4.

[0034] The composition of the seed culture medium of Streptomyces cinereus NEAU6 used in the present invention is:

[0035] In 1 L of the culture medium, 20 g of sucrose, 20 g of maltodextrin, 60 g of soybean powder, 3 g of calcium carbonate, pH 7.0.

[0036] The composition of the fermentation medium of Streptomyces caniferus NEAU6 used in the present invention is as follows:

[0037] In 1 L of the medium, there are 10 g of sucrose, 60 g of maltodextrin, 40 g of soybean powder, 4 g of calcium carbonate, and the pH is 7.2.

[0038] The starting strain used in the present invention:

[0039] Streptomyces caniferus NEAU6 is a producer of avemectin with independent intellectual property rights. This strain is recorded in the Chinese patent with the application number 201910189570.2 and the invention title of "A Streptomyces Strain and Its Application", and the public can obtain it from the Institute of Plant Protection, Chinese Academy of Agricultural Sciences.

[0040] The plasmid information involved in the following examples is shown in Table 1; the strain information involved is shown in Table 2; the primer information involved is shown in Table 3.

[0041] Table 1 Plasmid information involved in the examples

[0042]

[0043] Table 2 Strain information involved in the examples

[0044]

[0045] Table 3 Primer information involved in the examples

[0046]

[0047] Example 1: Construction of an overexpressing gene engineering bacterium of the avemectin positive regulatory gene scn1155

[0048] In this example, a recombinant bacterium Oscn1155 overexpressing the avemectin positive regulatory gene scn1155 and a control strain NEAU6 / pSET152 containing an empty plasmid were constructed. The recombinant bacterium Oscn1155 was obtained by overexpressing the gene scn1155 using Streptomyces caniferus NEAU6 as the starting strain; the control strain NEAU6 / pSET152 was obtained by introducing the empty vector pSET152 using Streptomyces caniferus NEAU6 as the starting strain. The specific construction method is as follows:

[0049] 1. Construction of the recombinant bacterium Oscn1155

[0050] (1) Construction of the recombinant vector

[0051] Using polymerase chain reaction (PCR) and the Q5 high-fidelity enzyme system, with the genome of Streptomyces tenebrarius NEAU6 as the template, the target genes scn1155 and the PhrdB promoter (the nucleotide sequence of the gene scn1155 is shown in SEQ ID NO.1) were amplified using the primers scn1155-LF / R and PhrdB-F / R, respectively. The PCR reaction system was as follows: 5 μL of 10×KOD Buffer, 5 μL of 2 mM dNTPs, 10 pg - 1000 ng of template DNA (the genome of Streptomyces tenebrarius NEAU6), 2 μL of each of the 10 μM upstream and downstream primers, 2 μL of 25 mM MgSO4, 1 μL of 1 U / μL KOD plus DNA polymerase, 3 μL of DMSO, and ddH2O was added to make up to 50 μL. The PCR reaction conditions were as follows: 94°C for 4 min; 94°C for 1 min, 65°C for 30 sec, 68°C for 3 min, for 31 cycles; 68°C for 10 min. The PCR product was ligated with the vector pSET152 treated with double digestion by XbaI and EcoRI (the digestion system: 2 μg of plasmid pSET152, 10 μL of 10×M buffer, 10 μL of BSA, 3 μL of XbaI, 3 μL of EcoRI, and ddH2O was added to make up to 100 μL) through the ClonExpress MultiS kit. The ligation system was as follows: 60 - 70 ng of vector pSET152, 10 ng of fragment scn1155, 10 ng of fragment PhrdB, 2 μL of 5×CE MultiS Buffer, 1 μL of Exnase MultiS, and ddH2O was added to make up to 10 μL. Then the ligation product was transformed into Escherichia coli JM109, coated, and clones were picked into small test tubes containing apramycin (final concentration 100 μg / mL) for culture, and the plasmid was extracted using a plasmid extraction kit. After electrophoresis detection, enzyme digestion verification and sequencing verification were carried out to obtain the recombinant plasmid pSET152::scn1155 (as Figure 1 ).

[0052] (2) Construction of recombinant bacteria

[0053] The recombinant plasmid pSET152::scn1155 was transferred into Escherichia coli ET12567 / pUZ8002, and then introduced into Streptomyces tenebrarius NEAU6 by the conjugation transfer method. Then the conjugants were picked onto YMS medium containing apramycin (final concentration 16 μg / mL) and nalidixic acid (final concentration 25 μg / mL), and cultured at 28°C for 7 days. Through the determination of the transcriptional expression level of this gene, a recombinant strain overexpressing scn1155 (Oscn1155) was obtained.

[0054] SEQ ID NO.1:

[0055] atgagtgacctgcgggaccggcttcgccgacgtggctggcggatgacggcccagcgccgggtggtcgccgaggtactcgacggcgagcatgtccacctcaccgcggacgaggtgctcgcgcgcgccgccgcccggctgccggagatctctcgcgcgaccgtctacaacaccctcggcgaactcgtctcgctcggcgaggtgagcgaggtgaccaccgacggccgcgccaagcgctacgacccgaacgcccaccgcccgcaccagcacctggtctgctccgactgcggcgccgtgcgcgacgtccaccccggcggcgacccactggccgatctgcccgactccgagcggttcggcttcctcgtctccgaggtggagatgacctaccggggccgctgccccgactgcgcccgccgctga

[0056] 2. Construction of control strain NEAU6 / pSET152

[0057] The empty plasmid pSET152 was transferred into Escherichia coli ET12567 / pUZ8002, and then introduced into Streptomyces tenebrarius NEAU6 by conjugation transfer method. Then the conjugants were picked onto YMS medium containing apramycin (final concentration 16 μg / mL) and nalidixic acid (final concentration 25 μg / mL), and cultured at 28 °C for 7 days to obtain the control strain NEAU6 / pSET152.

[0058] Example 2: Application of scn1155 overexpressing genetically engineered bacteria in increasing the yield of gouvein

[0059] The method for producing gouvein using the recombinant bacterium Oscn1155 is as follows: The recombinant bacterium Oscn1155 was inoculated on YMS solid medium and cultured at a constant temperature of 28 °C for 7 days. About 1 square centimeter of spores were scraped and inoculated into the seed medium of Streptomyces tenebrarius NEAU6, and cultured at 28 °C and 250 rpm for 24 hours. Then, with an inoculation amount of 5%, it was inoculated into the fermentation medium of Streptomyces tenebrarius NEAU6, and cultured at 28 °C and 250 rpm for 8 days.

[0060] Verification of the change in gouvein yield in the recombinant bacterium Oscn1155 by HPLC detection

[0061] The recombinant strain Oscn1155, the control strain NEAU6 / pSET152, and the original strain NEAU6 were respectively inoculated on YMS solid medium and cultured at a constant temperature of 28°C for 7 days. About 1 square centimeter of spores were scraped and inoculated into the Streptomyces tenebrarius NEAU6 seed medium, and cultured at 28°C and 250 rpm for 24 hours. Then, with an inoculation amount of 5%, they were inoculated into the Streptomyces tenebrarius NEAU6 fermentation medium and cultured at 28°C and 250 rpm for 8 days to obtain the fermentation broths of strains NEAU6, Oscn1155, and NEAU6 / pSET152 respectively.

[0062] The detection method for the total avermectin production was as follows: 0.4 mL of the fermentation broth was immersed in 1.6 mL of ethanol and extracted by rotation overnight. Centrifuged at 12000 rpm for 10 min, the supernatant was taken, filtered through a 0.22 μm organic filter membrane, and subjected to HPLC detection. The liquid phase conditions were as follows: from 0 to 30 min, 90% solvent A and 10% solvent B (solvent A: water; solvent B: acetonitrile), the flow rate was 0.8 mL / min, the column was an AligenSq-C18 column (Zorbax, 4.6×250 mm, 5 μm), and the detection wavelength was 260 nm.

[0063] The HPLC detection results were as Figure 2 shown. It can be seen from this figure that the avermectin production of the recombinant strain Oscn1155 (751 mg / L) was increased by about 0.5 times compared with that of the control strain NEAU6 / pSET152 (504 mg / L). Therefore, the recombinant strain overexpressing the avermectin positive regulatory gene scn1155 can be used to improve the avermectin production of Streptomyces tenebrarius NEAU6 by fermentation.

[0064] Although the present invention has been disclosed above with preferred embodiments, it is not intended to limit the present invention. Any person familiar with this technology can make various modifications and decorations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.

Claims

1. Use of the gene scn1155 that positively regulates avermectin in increasing the yield of avermectin, characterized in that, The application is to overexpress the positive regulatory gene scn1155 of avermectin in Streptomyces caniferus NEAU6, and the nucleotide sequence of the positive regulatory gene scn1155 of avermectin is shown in SEQ ID NO.

1.

2. Use of a recombinant expression vector containing the scn1155 gene that positively regulates avermectin in claim 1 in increasing the yield of avermectin, characterized in that, The application is to introduce the recombinant expression vector into Escherichia coli and then transfer it into Streptomyces caniferus NEAU6.

3. Use of an overexpressing genetically engineered bacterium containing the scn1155 gene that positively regulates avermectin described in claim 1 or the overexpressing gene of the recombinant expression vector described in claim 2 in increasing the yield of avermectin, characterized in that, The starting strain of the overexpressed genetically engineered bacterium is Streptomyces caniferus NEAU6.

Images