A gene scn6293 that positively regulates avermectin, its overexpressed genetically engineered bacterium, preparation method and application

Abstract

A glabermycin positive regulatory gene scn6293, its overexpressing genetically engineered bacterium, preparation method and application belong to the technical field of genetic engineering. In order to improve the yield of glabermycin, the present invention has discovered a glabermycin positive regulatory gene scn6293 from the glabermycin-producing bacterium Streptomyces caniferus NEAU6, which encodes a transcriptional regulator of the XRE family; in addition, the present invention uses Streptomyces caniferus NEAU6 as the starting strain to construct a recombinant bacterium overexpressing scn6293, and it is found that the recombinant bacterium can significantly improve the yield of glabermycin compared with the control strain and can be applied to the production of glabermycin.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to a positive regulatory gene scn6293 of avermectin, an overexpressed genetically engineered bacterium thereof, a preparation method and an application. Background Art

[0002] Avermectin is a purine nucleoside natural product produced by Streptomyces, and has been registered as a new pesticide for increasing rice yield in recent years due to its excellent biological activities such as promoting seed germination, tillering and early maturity of plants. However, the relatively low fermentation titer and high production cost of avermectin greatly limit its wide application. Systematically exploring the transcriptional regulatory network of avermectin biosynthesis, especially the regulatory mechanism of important transcription factors, is a necessary step to achieve high yield of avermectin and promote its wide application in rice production.

[0003] Natural products in Streptomyces are usually produced at relatively low levels, mainly because Streptomyces has a complex internal regulatory network that strictly controls their biosynthesis. Transcriptional regulatory factors are the main components of this regulatory network and play a key role in determining the production and final yield of natural products. Streptomyces caniferus NEAU6 is an avermectin-producing bacterium with independent intellectual property rights, and its genome contains 652 genes encoding transcriptional regulatory factors, but the functions of the vast majority of transcription factors are unknown. Mining the transcriptional regulatory genes affecting avermectin synthesis in Streptomyces caniferus NEAU6 will provide important gene resources for the construction of high-yield avermectin-producing bacteria. Summary of the Invention

[0004] In order to improve the yield of avermectin, the present invention has mined a positive regulatory gene scn6293 of avermectin from Streptomyces caniferus NEAU6, an avermectin-producing bacterium, which encodes a transcriptional regulatory factor of the XRE family; in addition, using Streptomyces caniferus NEAU6 as the starting strain, a recombinant bacterium overexpressing scn6293 has been constructed, and it has been found that the recombinant bacterium can increase the yield of avermectin compared with the control strain.

[0005] To solve the above technical problems and achieve the corresponding technical effects, the present invention provides the following technical solutions:

[0006] The first object of the present invention is to provide a positive regulatory gene scn6293 of avermectin, wherein the positive regulatory gene scn6293 of avermectin encodes a transcriptional regulatory factor of the XRE family, and its nucleotide sequence is as shown in SEQ ID NO.1.

[0007] The second object of the present invention is to provide a recombinant expression vector containing the above positive regulatory gene scn6293 of avermectin.

[0008] The third object of the present invention is to provide the application of the above-mentioned gouvein positive regulatory gene scn6293 or the above-mentioned recombinant expression vector in increasing the yield of gouvein.

[0009] The fourth object of the present invention is to provide an overexpressing genetically engineered bacterium containing the above-mentioned gouvein positive regulatory gene scn6293 or the above-mentioned recombinant expression vector.

[0010] In one embodiment of the present invention, the starting strain of the overexpressing genetically engineered bacterium is Streptomyces caniferus NEAU6.

[0011] The fifth object of the present invention is to provide the application of the above-mentioned overexpressing genetically engineered bacterium in increasing the yield of gouvein. The application is to culture the overexpressing genetically engineered bacterium of the present invention under conditions suitable for the production of gouvein, that is, the overexpressing genetically engineered bacterium is cultured in a seed medium and then fermented in a fermentation medium to synthesize gouvein.

[0012] In one embodiment of the present invention, the composition of the seed medium is: 20 g / L of sucrose, 20 g / L of maltodextrin, 60 g / L of soybean powder, 3 g / L of calcium carbonate, the balance being water, and the pH is 7.0.

[0013] In one embodiment of the present invention, the composition of the fermentation medium is: 10 g / L of sucrose, 60 g / L of maltodextrin, 40 g / L of soybean powder, 4 g / L of calcium carbonate, the balance being water, and the pH is 7.2.

[0014] The sixth object of the present invention is to provide a method for preparing the above-mentioned overexpressing genetically engineered bacterium. The preparation method includes the following steps:

[0015] 1) Construction of the overexpression plasmid of the target gene: Using the genomic DNA of Streptomyces caniferus NEAU6 as a template, the target gene and its own promoter fragment are obtained by PCR amplification, and this fragment is ligated into the pSET152 vector backbone to obtain the overexpression plasmid of the target gene; the target gene is the gouvein positive regulatory gene scn6293, and its nucleotide sequence is as shown in SEQ ID NO.1;

[0016] 2) Introduce the overexpression plasmid of the target gene into Escherichia coli and transfer it into Streptomyces caniferus NEAU6 by intergeneric conjugation to obtain the overexpressing genetically engineered bacterium of the target gene.

[0017] In one embodiment of the present invention, the primers used in the PCR amplification in step 1) are scn6293-LF with a nucleotide sequence as shown in SEQ ID NO.2 and scn6293-LR with a nucleotide sequence as shown in SEQ ID NO.3.

[0018] In one embodiment of the present invention, the target gene and its own promoter fragment are assembled with the vector pSET152 digested by double enzymes XbaI and EcoRI through the ClonExpress MultiS kit to obtain the target gene overexpression plasmid.

[0019] In one embodiment of the present invention, the Escherichia coli in step 2) is E. coli ET12567 / pUZ8002.

[0020] In one embodiment of the present invention, the overexpression also includes other promoters with different strengths and types.

[0021] Definitions and abbreviations:

[0022] In the present invention, the starting Streptomyces for generating the recombinant Streptomyces refers to the Streptomyces on which the genetic operations shown in the present invention, such as gene overexpression, are performed. As used herein, "recombinant" refers to a strain with the desired modifications obtained through intentional human intervention.

[0023] Advantages of the present invention:

[0024] The present invention discloses a gene scn6293 in Streptomyces caniferus NEAU6, which is a transcriptional regulator of the XRE family and can positively regulate the synthesis of avermectin. In addition, the present invention uses Streptomyces caniferus NEAU6 as the starting strain, constructs a recombinant strain Oscn6293 based on this gene, and finds that when using the recombinant strain Oscn6293 to ferment and produce avermectin, compared with the control strain NEAU6 / pSET152, the final avermectin yield of the recombinant strain Oscn6293 is increased from 504 mg / L to 923 mg / L, an increase of 0.8 times. Description of the drawings

[0025] Figure 1 Schematic diagram for the construction of the recombinant plasmid pSET152::scn6293;

[0026] Figure 2 Detection result diagram of the avermectin content in the fermentation broth of the recombinant strain Oscn6293, the control strain NEAU6 / pSET152, and the original strain NEAU6; ****p<0.0001. Detailed implementation manners

[0027] To make the objectives, technical solutions, and advantages of the present invention more clearly understood, the present invention will be further described in detail below in conjunction with specific embodiments and the accompanying drawings of the specification. It should be noted that the embodiments mentioned below are only applicable to explaining the present invention, but not for limiting the scope of the present invention. The embodiments mentioned below are only a part of the embodiments of the present invention, not all embodiments. In the art, if other technicians do not make creative efforts, the embodiments they obtain are protected by the present invention.

[0028] Unless otherwise specified, the experimental methods used in the following embodiments are all conventional methods. The materials, reagents, culture media, and instruments used, unless otherwise specified, are all conventional materials, reagents, culture media, and instruments in the art, and can be obtained by those skilled in the art through commercial channels. For the molecular biology experimental operations such as PCR amplification, restriction enzyme digestion and ligation, and transformation involved in the present invention, unless otherwise specified, they are all conventional experimental operations in the art or can be carried out in accordance with the product instructions of the corresponding reagents.

[0029] The specific detection method of the avermectin used in the present invention is recorded in Shi, H. et al. Synthetic and Systems Biotechnology 10, 237 - 246, doi: https: / / doi.org / 10.1016 / j.synbio.2024.11.001 (2025).

[0030] The ClonExpress MultiS kit used in the present invention is purchased from Novoprotein.

[0031] The culture media used in the present invention and their compositions are as follows:

[0032] The solid culture medium for cell growth and fermentation in the present invention is the YMS solid culture medium, and its composition is:

[0033] In 1 L of the culture medium, there are 4 g of yeast extract powder, 10 g of malt extract powder, 4 g of soluble starch, 20 g of agar, and the pH is 7.4.

[0034] The composition of the seed culture medium of Streptomyces cinereogriseus NEAU6 used in the present invention is:

[0035] In 1 L of the culture medium, there are 20 g of sucrose, 20 g of maltodextrin, 60 g of soybean powder, 3 g of calcium carbonate, and the pH is 7.0.

[0036] The composition of the fermentation culture medium of Streptomyces cinereogriseus NEAU6 used in the present invention is:

[0037] In 1 L of the culture medium, there are 10 g of sucrose, 60 g of maltodextrin, 40 g of soybean powder, 4 g of calcium carbonate, and the pH is 7.2.

[0038] Starting strain used in the present invention:

[0039] Streptomyces caniferus NEAU6, a producer of avemectin with independent intellectual property rights, is recorded in the Chinese patent with the application number 201910189570.2 and the invention title of "A Streptomyces Strain and Its Application", and the public can obtain it from the Institute of Plant Protection, Chinese Academy of Agricultural Sciences.

[0040] The plasmid information involved in the following examples is shown in Table 1; the strain information involved is shown in Table 2; the primer information involved is shown in Table 3.

[0041] Table 1 Plasmid information involved in the examples

[0042]

[0043] Table 2 Strain information involved in the examples

[0044]

[0045] Example 1: Construction of a genetically engineered bacterium overexpressing the avemectin positive regulatory gene scn6293

[0046] In this example, a recombinant bacterium Oscn6293 overexpressing the avemectin positive regulatory gene scn6293 and a control strain NEAU6 / pSET152 containing an empty plasmid were constructed. The recombinant bacterium Oscn6293 was obtained by using Streptomyces caniferus NEAU6 as the starting strain and overexpressing the gene scn6293; the control strain NEAU6 / pSET152 was obtained by using Streptomyces caniferus NEAU6 as the starting strain and introducing the empty vector pSET152. The specific construction method is as follows:

[0047] 1. Construction of the recombinant bacterium Oscn6293

[0048] (1) Construction of the recombinant vector

[0049] Using polymerase chain reaction (PCR) and the Q5 high-fidelity enzyme system, with the genome of Streptomyces tenebrarius NEAU6 as the template and scn6293-LF / R as the primers, a fragment containing the gene scn6293 and its own promoter was amplified (the nucleotide sequence of the gene scn6293 is shown in SEQ ID NO.1). The PCR reaction system is as follows: 5 μL of 10×KOD Buffer, 5 μL of 2 mM dNTPs, 10 pg - 1000 ng of template DNA (the genome of Streptomyces tenebrarius NEAU6), 2 μL each of 10 μM upstream and downstream primers, 2 μL of 25 mM MgSO4, 1 μL of 1 U / μL KOD plus DNA polymerase, 3 μL of DMSO, and ddH2O was added to make up to 50 μL. The PCR reaction conditions are as follows: 94°C for 4 min; 94°C for 1 min, 65°C for 30 sec, 68°C for 3 min, for 31 cycles; 68°C for 10 min. The PCR product was ligated with the vector pSET152 that had been double-digested with XbaI and EcoRI (the digestion system: 2 μg of plasmid pSET152, 10 μL of 10×M buffer, 10 μL of BSA, 3 μL of XbaI, 3 μL of EcoRI, and ddH2O was added to make up to 100 μL) using the ClonExpress MultiS kit. The ligation system is as follows: 60 - 70 ng of vector pSET152, 15 - 16 ng of fragment scn6293, 2 μL of 5×CE MultiS Buffer, 1 μL of Exnase MultiS, and ddH2O was added to make up to 10 μL. Then the ligation product was introduced into Escherichia coli JM109 by transformation, spread on plates, colonies were picked and cultured in small test tubes containing apramycin (final concentration 100 μg / mL), and the plasmid was extracted using a plasmid extraction kit. After electrophoresis detection, enzymatic digestion verification and sequencing verification were carried out to obtain the recombinant plasmid pSET152::scn6293 (as Figure 1 ).

[0050] (2) Construction of recombinant bacteria

[0051] The recombinant plasmid pSET152::scn6293 was transferred into Escherichia coli ET12567 / pUZ8002, and then introduced into Streptomyces tenebrarius NEAU6 by conjugation transfer. Then the conjugants were picked onto YMS medium containing apramycin (final concentration 16 μg / mL) and nalidixic acid (final concentration 25 μg / mL) and cultured at 28°C for 7 days. Through the determination of the transcriptional expression level of this gene, a recombinant strain overexpressing scn6293 (Oscn6293) was obtained.

[0052] SEQ ID NO.1:

[0053] atgaccgccgcgcagccgagcagcgatccgtccctgcgccgctacctggaccatccgcgcggcggcccgaccgtcctgcgtatcgtgctgggcacccaactgcgccggctgcgtgagggagcgggcatcacccgggaggccgccggggacgccatccgcggttcgcacgcgaagatcagccgcctggaactcggccgggtgagctgcaaggagcgggatgtcgccgatctgctgacgctctacaacgtcacggacgacgcggtccgctcggacttcctcaagctggcccgcaagaccagcagtccggggtggtggcatcagtacggcgatgtgctgcccggctggttcgagacgcacatcggcctcgaagaagccgcctcggtgatccgtacgtacgaagtccagttcgtgcccggcctgttgcagacggcggactacgcccgtgcggtggcgcagctcgggcatccgcggtcctccccggaggagatcgaacgacgggtgcagctgcgcgtacagcgccaggagctgctgaccgtcccggacgcgccgcgggtatgggccgtgatcgacgaggcgtcgctgcgccgtccgctcggcggacctgaggtgatggccggccagctcagacatctgctgaagatggccgagctgccgaatgtcacgttgcagatcgcgccgttcagcctcggcggcctggcggcggccggtggcccgatcacgatcctgcggttcctggagccggatctgccggacatcgtctatctggagcagctgaccagcgcgctctatctggacaagcgcgatgatgtcgatcattacctcgcggtgatggaccggctcagcgcacagtccgagtctccccgcgagtcacgggagatcctggagcggctgctcaagcaggagagctga

[0054] 2. Construction of control strain NEAU6 / pSET152

[0055] The empty plasmid pSET152 was transferred into Escherichia coli ET12567 / pUZ8002 and then introduced into Streptomyces cinereogriseus NEAU6 by conjugation transfer method. Then the conjugants were picked onto YMS medium containing apramycin (final concentration 16 μg / mL) and nalidixic acid (final concentration 25 μg / mL) and cultured at 28 °C for 7 days to obtain the control strain NEAU6 / pSET152.

[0056] Example 2: Application of the overexpressed genetic engineering strain of scn6293 in improving the yield of gulvactin

[0057] The method for producing gulvactin using the recombinant strain Oscn6293 was as follows: The recombinant strain Oscn6293 was inoculated onto YMS solid medium and cultured at a constant temperature of 28 °C for 7 days. About 1 square centimeter of spores were scraped and inoculated into the seed medium of Streptomyces cinereogriseus NEAU6, and cultured at 28 °C and 250 rpm for 24 hours. Then, with an inoculation amount of 5%, it was inoculated into the fermentation medium of Streptomyces cinereogriseus NEAU6 and cultured at 28 °C and 250 rpm for 8 days.

[0058] HPLC was used to detect and verify the change in the yield of gulvactin in the recombinant strain Oscn6293:

[0059] The recombinant strain Oscn6293, the control strain NEAU6 / pSET152, and the original strain NEAU6 were respectively inoculated onto YMS solid medium and cultured at a constant temperature of 28 °C for 7 days. About 1 square centimeter of spores were scraped and inoculated into the seed medium of Streptomyces cinereogriseus NEAU6, and cultured at 28 °C and 250 rpm for 24 hours. Then, with an inoculation amount of 5%, it was inoculated into the fermentation medium of Streptomyces cinereogriseus NEAU6, and cultured at 28 °C and 250 rpm for 8 days to obtain the fermentation broths of the strains NEAU6, Oscn6293, and NEAU6 / pSET152 respectively.

[0060] The detection method for the total production of gulvactin was as follows: 0.4 mL of the fermentation broth was taken and soaked in 1.6 mL of ethanol, and rotated overnight for extraction. Centrifuged at 12000 rpm for 10 min, the supernatant was taken, filtered through a 0.22 μm organic filter membrane, and subjected to HPLC detection. The liquid phase conditions were: 0 - 30 min, 90% solvent A and 10% solvent B (solvent A: water; solvent B: acetonitrile), the flow rate was 0.8 mL / min, the column was an AligenSq-C18 column (Zorbax, 4.6×250 mm, 5 μm), and the detection wavelength was 260 nm.

[0061] The HPLC detection results are as Figure 2As shown, it can be seen from this figure that the avermectin production of the recombinant strain Oscn6293 (923 mg / L) is about 0.8 times higher than that of the control strain NEAU6 / pSET152 (504 mg / L). Therefore, the recombinant strain overexpressing the avermectin positive regulatory gene scn6293 can be used to increase the avermectin production of Streptomyces tenebrarius NEAU6 in fermentation.

[0062] Although the present invention has been disclosed above with preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.

Claims

1. Application of a gene positively regulating avermectin in increasing avermectin production, characterized in that, scn6293 The application is to overexpress the positive regulatory gene of avermectin in Streptomyces cinereus Streptomyces caniferus NEAU6), and the positive regulatory gene of avermectin scn6293, The nucleotide sequence of the positive regulatory gene of avermectin scn6293 is shown in SEQ ID NO.

1. ​ 2. Application of a recombinant expression vector containing the positive regulatory gene of glabervicin in increasing the yield of glabervicin, characterized in that, scn6293 The application is to introduce the recombinant expression vector into Escherichia coli and then transfer it into Streptomyces caesius NEAU6, and the positive regulatory gene of avermectin scn6293 has the nucleotide sequence shown in SEQ ID NO.

1. ​

Images