Application of BAK gene in enhancing waterlogging tolerance of rapeseed
By regulating the expression of BAK gene, the flood tolerance of rapeseed has been improved or reduced, solving the problem of cabbage-type rapeseed being sensitive to flood stress, and providing new gene resources and theoretical guidance.
Patent Information
- Application Number
- CN202510290606.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-12
- Publication Date
- 2025-07-01
- Estimated Expiration
- 2045-03-12
AI Technical Summary
Kale-type rapeseed is extremely sensitive to flood stress, resulting in root hypoxia, energy metabolism disorders, reactive oxygen accumulation and hormone imbalance, which in turn causes leaves yellowing, plant lodging, and erectile dysplasia, reducing yield by 20%-50%.
By overexpressing or disrupting the expression of the BAK gene, the drought tolerance of rapeseed is regulated. Specific methods include designing primers to construct overexpression vectors for the BAK gene, transfusing Agrobacterium and transforming it into rapeseed, or using CRISPR/Cas9 technology to disrupt the expression of the BAK gene.
By destroying the expression of the BAK gene, it was found that the basin tolerance of cabbage-type rapeseed was weakened, the hypocotyl growth was slow, and the chlorophyll content was reduced, providing new gene resources and theoretical guidance for the research and application of basin tolerance of rapeseed.
Smart Images

Figure CN119776424B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of crop science and agricultural molecular biology, and specifically relates to BAK Application of genes in enhancing submergence tolerance in rapeseed. Background Art
[0002] rape( Brassica napus Rapeseed oil (L.) is one of the most important oil crops in the world. Its seeds have an oil content of up to 33%-50%. It is not only the main source of edible oil, but also an important basis for feed, biodiesel and industrial raw materials. The rapeseed planting area in my country has been stable at more than 100 million mu all year round.
[0003] Botanically, rapeseed is divided into three main types: Brassica rapa, Brassica juncea, and Brassica oleracea. Brassica oleracea, due to its strong disease resistance, high yield, and wide adaptability, has become the dominant variety globally, accounting for over 70% of cultivated area. Its seeds contain 35%-45% oil, and its meal contains up to 40% protein. Its versatile properties as an oilseed, feed, and vegetable crop make it a prime example of a multi-purpose crop in modern agriculture.
[0004] However, large-scale cultivation of Brassica napus faces significant environmental challenges. Its main producing areas are climatically influenced by concentrated rainy seasons and heavy rainfall, which can lead to waterlogging in fields or soil oversaturation, causing waterlogging (flooding stress). Research has shown that Brassica napus is extremely sensitive to waterlogging stress: prolonged root hypoxia inhibits respiration, disrupting energy metabolism, accumulating reactive oxygen species (ROS), and causing hormonal imbalances. This in turn causes leaf yellowing, plant lodging, and stunted silique development, ultimately resulting in a 20%-50% yield reduction. In rice-oil rotations, the heavy clay and difficult drainage of post-harvest soils further exacerbate the risk of waterlogging. While traditional agronomic practices (such as trenching and drainage) can partially alleviate the problem, they are costly and difficult to adapt to mechanized production. Therefore, developing new technologies for regulating waterlogging tolerance is crucial to ensuring high and stable rapeseed yields. Summary of the Invention
[0005] According to the demand for new rapeseed waterlogging tolerance control technology in the prior art, the present invention provides BAK The specific technical solutions for the application of genes in enhancing rapeseed's flood tolerance are as follows:
[0006] In a first aspect, the present invention provides BAK Application of genes in enhancing rapeseed's flooding tolerance, the BAK Gene BnaA04.BAK7 gene; BnaA04.BAK7 The accession number of the gene in the GenBank is BnaA04g0150000WE.
[0007] Furthermore, the application method is:
[0008] (1) Through overexpression BAK Genes that enhance plants' ability to tolerate flooding;
[0009] or, (2) by destroying BAK The expression of genes reduces the plant's ability to tolerate flooding.
[0010] Furthermore, the overexpression BAK Gene, including the following steps:
[0011] (1) Using wild-type rapeseed cDNA as a template, primer sequences were designed to construct BAK Gene overexpression vectors;
[0012] (2) Transform the vector into Agrobacterium competent cells to obtain overexpression BAK Agrobacterium of genes;
[0013] (3) will contain BAK Agrobacterium with gene overexpression vector was transformed into wild rapeseed explants, tissue culture was performed to obtain seedlings, and screening was performed to obtain BAK Gene overexpression plants.
[0014] Furthermore, the destruction BAK Gene expression includes the following steps:
[0015] (1) According to BAK Gene target sequence, sgRNA design, and CRISPR / Cas9 vector construction;
[0016] (2) constructing an Agrobacterium genetically engineered bacterium containing the CRISPR / Cas9 vector described in step (1);
[0017] (3) Transforming the genetically engineered bacteria containing the CRISPR / Cas9 vector described in step (2) into Brassica napus to obtain a homozygous mutant strain that does not contain exogenous Cas9 protein and is stably inherited;
[0018] described BAK Gene BnaA04.BAK7 gene; BnaA04.BAK7 The accession number of the gene in the GenBank is BnaA04g0150000WE.
[0019] Furthermore, the nucleotide sequence of the sgRNA is shown in SEQ ID NO. 2~3.
[0020] In a second aspect, the present invention provides the use of BAK protein in enhancing the flooding tolerance of rapeseed, wherein the BAK protein is BnaA04.BAK7 protein; the accession number of the BnaA04.BAK7 protein in the gene bank is BnaA04g0150000WE.
[0021] In a third aspect, the present invention provides an application of a recombinant vector in enhancing the flooding tolerance of rapeseed, wherein the recombinant vector comprises BAK gene; BAK Gene BnaA04.BAK7 gene; BnaA04.BAK7 The accession number of the gene in the GenBank is BnaA04g0150000WE.
[0022] In a fourth aspect, the present invention provides the use of genetically engineered bacteria in enhancing the flooding resistance of rapeseed, wherein the genetically engineered bacteria comprises BAK gene; BAK Gene BnaA04.BAK7 gene; or BnaA04.BAK7 Gene, BnaC03.BAK7 Gene, BnaA03.BAK7 Gene, BnaA07.BAK7 Genes and BnaC07.BAK7 gene; or BnaC07.BAK1 Gene, BnaA03.BAK1 Gene, BnaC01.BAK1 Genes and BnaA08.BAK1 Gene;
[0023] described BnaA04.BAK7 The gene accession number in the gene bank is BnaA04g0150000WE; BnaC03.BAK7 The gene accession number in the gene bank is BnaC03g0413100WE; BnaA03.BAK7 The gene accession number in the gene bank is BnaA03g0402600WE; BnaA07.BAK7 The gene accession number in the gene bank is BnaA07g0046900WE; BnaC07.BAK7 The gene accession number in the gene bank is BnaC07g0066700WE; BnaC07.BAK1 The gene accession number in the gene bank is BnaC07g0455300WE; BnaA03.BAK1 The gene accession number in the gene bank is BnaA03g0542200WE; BnaC01.BAK1 The gene accession number in the gene bank is BnaC01g0030300WE; BnaA08.BAK1 The accession number of the gene in the GenBank is BnaA08g0124100WE.
[0024] In a fifth aspect, the present invention provides a method for enhancing the flooding tolerance of rapeseed, comprising the following steps:
[0025] (1) According to BAK Gene sequence, construction of overexpression vector;
[0026] (2) constructing an Agrobacterium genetically engineered bacterium containing the overexpression vector described in step (1);
[0027] (3) Transforming the genetically engineered bacteria containing the overexpression vector described in step (2) into rapeseed to obtain a rapeseed strain with enhanced flooding tolerance;
[0028] described BAK Gene BnaA04.BAK7 gene; BnaA04.BAK7 The accession number of the gene in the GenBank is BnaA04g0150000WE.
[0029] Compared with the prior art, the present invention has the following beneficial effects:
[0030] The present invention destroys BAK Gene expression, found BAK After the expression of the gene is destroyed, the flooding tolerance of Brassica napus is weakened under flooding stress, and the present invention discloses for the first time BAK The loss of gene function will lead to slow hypocotyl growth and reduced chlorophyll content in Brassica napus under waterlogging stress, providing new genetic resources and theoretical guidance for the research and application of rapeseed's waterlogging tolerance. BRIEF DESCRIPTION OF THE DRAWINGS
[0031] Figure 1 for BAK Gene molecular evolutionary tree and illustration of the mutant genes of each rapeseed mutant.
[0032] Figure 2 for Bnbak7s 、 Bnbak7p and Bnbak1q Schematic diagram of the mutation types of mutants.
[0033] Figure 3 for Bnbak7s 、 Bnbak7p 、 Bnbak1q The phenotypic identification results of mutants and westar under waterlogging stress during the germination period; among them, A is the plant phenotype diagram, B is the statistical diagram of the hypocotyl length of rapeseed plants, and Mock is the control group.
[0034] Figure 4 for Bnbak7s , Bnbak7p and Bnbak1q The phenotypic identification results of the mutant and westar seedlings under waterlogging stress; A is the plant phenotype diagram, B is the statistical diagram of the chlorophyll content in the aboveground part of the rapeseed plant, and Mock is the control group.
[0035] Figure 5 for BnaA04.BAK7 , BnaC03.BAK7 , BnaA03.BAK7 , BnaA07.BAK7 , BnaC07.BAK7 , BnaC07.BAK1 , BnaA03.BAK1 , BnaC01.BAK1 and BnaA08.BAK1 The results of gene expression identification in westar plants after 12 hours of waterlogging stress during the germination period.
[0036] Figure 6 This is the result of identifying the gene overexpression of 35S:BnaA04.BAK7-GFP overexpression material.
[0037] Figure 7 The diagram shows the phenotypic identification results of 35S:BnaA04.BAK7-GFP overexpressing materials and westar under waterlogging stress during the germination period; among them, A is the plant phenotype diagram, B is the statistical diagram of the hypocotyl length of rapeseed plants, and Mock is the control group. DETAILED DESCRIPTION
[0038] In order to make those skilled in the art better understand the present invention, the technical solution of the present invention is clearly and completely described below in conjunction with specific embodiments. It should be noted that the following detailed description is exemplary and is only a part of the embodiments of the present invention, rather than all embodiments.
[0039] Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative work should fall within the scope of protection of the present invention.
[0040] Unless otherwise specified, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which this application belongs. The experimental materials used in the examples of the present invention are all conventional experimental materials in the art and can be purchased through commercial channels. Experimental methods without detailed conditions were performed according to conventional experimental methods or according to the operating instructions recommended by the supplier.
[0041] Culture medium:
[0042] DM suspension (1 L): MS 4.4 g, sucrose 30 g, AS 100 µM, pH 5.8.
[0043] M0 medium (1 L): MS 4.4 g, Agar 8 g, pH 5.8.
[0044] M1 medium (1 L): MS 4.4 g, sucrose 30 g, Agar 8 g, AS 100 µM, Kinetin 0.3 mg, 2,4-D 1 mg, pH 5.8.
[0045] M2 medium (1 L): MS 4.4 g, sucrose 30 g, Agar 8 g, 2,4-D 1 mg, STS 0.02 mM, Kinetin 0.3 mg, Hygromycin 25 mg, Timentin 300 mg, pH 5.8.
[0046] M3 medium (1 L): MS 4.4 g, glucose 10 g, agar 8 g, zeatin 2 mg, titin 300 mg, IAA 0.1 mg, hygromycin 25 mg, pH 5.8.
[0047] M4 medium (1 L): MS 4.4 g, sucrose 10 g, Agar 8 g, pH 5.8.
[0048] The pAtU6-26-M vector and pUBQ10:Cas9-P2A-GFP vector used in the following examples are described in patent application number 201911080944.3.
[0049] In this application, BnaA04.BAK7 The CDS sequence of the gene is shown in SEQ ID NO.1, and the accession number in the gene bank is BnaA04g0150000WE; BnaC03.BAK7 The gene accession number in the gene bank is BnaC03g0413100WE; BnaA03.BAK7 The gene accession number in the gene bank is BnaA03g0402600WE; BnaA07.BAK7 The gene accession number in the gene bank is BnaA07g0046900WE; BnaC07.BAK7 The gene accession number in the gene bank is BnaC07g0066700WE; BnaC07.BAK1 The gene accession number in the gene bank is BnaC07g0455300WE; BnaA03.BAK1 The gene accession number in the gene bank is BnaA03g0542200WE; BnaC01.BAK1 The gene accession number in the gene bank is BnaC01g0030300WE; BnaA08.BAK1 The accession number of the gene in the GenBank is BnaA08g0124100WE.
[0050] SEQ ID NO.1:
[0051]
[0052] Example 1 Obtaining gene knockout mutants
[0053] The Westar rapeseed genome was used as the reference sequence, and the target genes included BnaA04.BAK7 Gene, BnaC03.BAK7 Gene, BnaA03.BAK7 Gene, BnaA07.BAK7 Gene, BnaC07.BAK7 Gene, BnaC07.BAK1 Gene, BnaA03.BAK1 Gene, BnaC01.BAK1 Genes and / or BnaA08.BAK1 Gene, the evolutionary tree of the above genes is as follows Figure 1 As shown. Figure 1 sgRNAs were designed for the mutated genes in the indicated mutants. sgRNAs were designed using the CRISPR-P 2.0 website (http: / / crispr.hzau.edu.cn / CRISPR / ).
[0054] The sgRNA sequence was constructed into the pAtU6-26-M vector to generate the pAtU6-26-sgRNA vector. The pAtU6-26-sgRNA vector was digested with Kpn I and Sal I, and the sgRNA expression sequence construct was cloned into the pUBQ10:Cas9-P2A-GFP(Hyg) vector.
[0055] by BnaA04.BAK7 The primers for the CRISPR / Cas9 vector constructed for the target gene are:
[0056] sgRNA-BnBAK7s-F: GATT GTAACATGAAACCATGAACA (SEQ ID NO. 2);
[0057] sgRNA-BnBAK7s-R:AAA CTGTTCATGGTTTCATGTTAC (SEQ ID NO. 3).
[0058] by BnaA04.BAK7 , BnaA07.BAK7 , BnaC07.BAK7 The primers for the CRISPR / Cas9 vector constructed for the target gene are:
[0059] sgRNA-Bnbak7p-F1: GATT GCTAAAAGAAGAACGTACCA;
[0060] sgRNA-Bnbak7p-R1:AAACTGGTACGTTCTTCTTTTAGC.
[0061] by BnaC03.BAK7 , BnaA03.BAK7 The primers for the CRISPR / Cas9 vector constructed for the target gene are:
[0062] sgRNA-Bnbak7p-F2:GATTGGTGGAGTAGAGATAGGAGG;
[0063] sgRNA-Bnbak7p-R2:AAACCCTCCTATCTCTACTCCACC.
[0064] by BnaC07.BAK1 , BnaA03.BAK1 , BnaC01.BAK1 The primers for the CRISPR / Cas9 vector constructed for the target gene are:
[0065] sgRNA-Bnbak1q-F1: GATT GTAATTCTATTACTCCCTGC;
[0066] sgRNA-Bnbak1q-R1:AAACGCAGGGAGTAATAGAATTAC.
[0067] by BnaA08.BAK1 The primers for the CRISPR / Cas9 vector constructed for the target gene are:
[0068] sgRNA-Bnbak1q-F2:GATTGGACAATCCCAGAGACGCTT;
[0069] sgRNA-Bnbak1q-R2:AAAC AAGCGTCTCTGGGATTGTCC.
[0070] The specific steps are:
[0071] (1) F primer and R primer were mixed in equal amounts, annealed, and sgRNA oligo was obtained; pAtU6-26-M vector was digested with BbsI restriction endonuclease, recovered by gel, and ligated with sgRNA oligo to obtain pAtU6-26-BnBAK7s vector, pAtU6-26-Bnbak7p-1 vector, pAtU6-26-Bnbak7p-2 vector, pAtU6-26-Bnbak1q-1 vector, and pAtU6-26-Bnbak1q-2 vector.
[0072] (2) The pAtU6-26-Bnbak7p-1 vector and the pAtU6-26-Bnbak1q-1 vector were digested with NheI and SalI restriction enzymes to serve as backbone vectors; the pAtU6-26-Bnbak7p-2 vector and the pAtU6-26-Bnbak1q-2 vector were digested with SpeI and SalI restriction enzymes to serve as insert fragments. The pAtU6-26-Bnbak7p-1 digested vector fragment and the pAtU6-26-Bnbak7p-2 digested vector fragment were ligated using T4 ligase to obtain the pAtU6-26-Bnbak7p vector. The pAtU6-26-Bnbak1q-1 digested vector fragment and the pAtU6-26-Bnbak1q-2 digested vector fragment were ligated using T4 ligase to obtain the pAtU6-26-Bnbak1q vector.
[0073] (3) KpnI and SalI restriction endonucleases were used to digest the pAtU6-26-BnBAK7s vector, pAtU6-26-Bnbak7p vector, and pAtU6-26-Bnbak1q vector, and the AtU6-26-sgRNA fragments were recovered. KpnI and SalI restriction endonucleases were used to digest the pUBQ10:Cas9-P2A-GFP(Hyg) vector, and the vector was ligated with the AtU6-26-sgRNA fragments to obtain the final gene editing vectors pUBQ10:Cas9-P2A-GFP-Bnbak7s vector, pUBQ10:Cas9-P2A-GFP-Bnbak7p vector, and pUBQ10:Cas9-P2A-GFP-Bnbak1q vector.
[0074] The final vector was transformed into Agrobacterium GV3101 competent cells. The specific steps are as follows:
[0075] (1) Add 100 ng of vector plasmid to 100 μL of GV3101 competent cells, mix gently, place on ice for 5 minutes, then in liquid nitrogen for 5 minutes, and at 37°C for 5 minutes.
[0076] (2) Add 0.5 mL of LB liquid culture medium and culture in a shaking incubator at 28°C for 3 hours. Take 0.2 mL of the bacterial liquid and spread it on LB solid culture medium containing kanamycin (50 μg / mL), gentamicin (25 μg / mL), and rifampicin (25 μg / mL), and place it in a 28°C incubator until colonies grow.
[0077] The specific steps for obtaining mutant plants are as follows:
[0078] (1) Sterilize westar seeds with 75% ethanol for 1 minute, 50% 84 solution for 10 minutes, and rinse with sterile deionized water 5 times.
[0079] (2) The sterilized westar seeds were sown on M0 medium, 40 seeds / medium, and cultured in the dark in an incubator at 22°C for 6 days.
[0080] (3) After 4 days of dark culture, pick a positive single colony of Agrobacterium and inoculate it into 2 mL of LB liquid resistance medium (kanamycin 50 μg / mL, gentamicin 25 μg / mL, rifampicin 25 μg / mL). Incubate it in a shaker at 28°C and 220 rpm for 24 hours. Inoculate it into 5 mL of LB liquid resistance medium at a ratio of 1:100 and incubate it in a shaker at 28°C and 220 rpm for 12 hours.
[0081] (4) Take 2 mL of fresh bacterial culture and centrifuge at room temperature for 10 minutes (6000 rpm); discard the supernatant, resuspend the bacteria in 2 mL of DM infection medium, and centrifuge at room temperature for 5 minutes (6000 rpm); discard the supernatant, and resuspend the bacteria in 20 mL of DM infection medium.
[0082] (5) Rapeseed hypocotyls cultured in the dark for 6 days are used to prepare explants: the hypocotyls are immersed in M1 liquid culture medium and cut into about 1 cm long using a sterilized scalpel.
[0083] (6) Transfer the hypocotyl explants to the infection solution described in step (4) and infect for 15 minutes, shaking three times during the infection. After the infection is completed, place the explants on sterilized filter paper to absorb the excess bacterial solution.
[0084] (6) Place the hypocotyl explants on M1 solid culture medium and culture in a dark incubator at 22°C for 2 days.
[0085] (7) After 2 days of dark culture, the hypocotyl explants were transferred to M2 solid culture medium and cultured at 22°C under long-light conditions for 18 days.
[0086] (8) After 18 days, transfer the hypocotyl explants to M3 solid medium and transfer them to fresh M3 solid medium every 14 days.
[0087] (9) The explants with true leaves grown on M3 medium were transferred to M4 solid medium for rooting culture, and finally BnBAK7s Single mutant, Bnbak7p Five mutant plants and Bnbak1q Quadruple mutant plants.
[0088] Identification of mutant plants:
[0089] To get BnBAK7s Single mutant, Bnbak7p Five mutant plants and Bnbak1q The four mutant plants were identified for mutation type, and the results are as follows Figure 2 As shown, Bnbak7s Single mutant BnaA04.BAK7 The gene has 1 base inserted. Bnbak7p Among the five mutants, BnaC03.BAK7 64% of the mutation types of the gene are deletions of 1 base, and 36% of the mutation types are deletions of 5 bases. BnaA03.BAK7 58% of the mutations in the gene were 1 base deletions, and 42% were 5 base deletions. BnaA04.BAK7 The gene is missing 8 bases. BnaA07.BAK7 The gene is a 2-base deletion. BnaC07.BAK7 The gene is a 55-base deletion. Bnbak1q Among the four mutants, BnaC07.BAK1 The gene is a 1-base insertion. BnaA03.BAK1 The gene is a 1-base insertion. BnaC01.BAK1 The gene is missing 4 bases. BnaA08.BAK1 The gene is a deletion of 1 base. The above mutations all lead to frameshift mutations.
[0090] Example 2 Phenotypic Observation of Knockout Mutants
[0091] For the germination period flooding stress experiment, the Bnbak7s mutants, Bnbak7p mutants, Bnbak1q Seeds of the mutant and westar wild-type were disinfected with 5% (v / v) NaClO, washed five times with sterile deionized water, and then inoculated onto 1 / 2MS medium. The seeds were grown under white light for 36 hours. White seeds from the treatment group were transferred to a 5.0 mL centrifuge tube filled with sterile deionized water and submerged for 6 hours. The treated seeds were then transferred to 1 / 2MS solid medium and allowed to recover for 2 days. A control group was grown entirely on 1 / 2MS solid medium. Three biological replicates were set up for each control and treatment group, and hypocotyl length was measured.
[0092] The results are as follows Picture 3 As shown in A and B, after flooding during the germination period, Bnbak7s mutants, Bnbak7p Mutants and Bnbak1q The hypocotyl length of the mutant is significantly reduced compared to the westar wild type. BAK The loss of the gene affects the hypocotyl elongation of rapeseed under flooding conditions.
[0093] For the seedling stage flooding stress experiment, the Bnbak7s mutants, Bnbak7p Mutants and Bnbak1qSeeds of the mutant and wild-type westar were sown in soil and flooded at the two-leaf, one-heart stage. Water was maintained at the soil level for seven days, simulating flooding, followed by two days of growth recovery. The control group maintained normal water supply throughout the treatment period. Three biological replicates were set for each control and treatment group, and chlorophyll content in the aboveground part was measured. Picture 4 As shown in A, after flooding stress at the seedling stage, Bnbak7s mutants, Bnbak7p Mutants and Bnbak1q The leaves of the mutant turned yellow and red, while the leaves of westar remained green. Picture 4 As shown in Figure B, there is no significant difference in chlorophyll content between the mutant and the wild type in the control group, but the chlorophyll content of the mutant in the treatment group is significantly lower than that of the wild type. BAK The loss of the gene will affect the accumulation of chlorophyll when rapeseed encounters waterlogging stress during the seedling stage.
[0094] Therefore, the present invention destroys BAK The function of the gene reduces the flooding tolerance of Brassica napus under waterlogging stress.
[0095] Example 3 Detection of BnBAK copy gene expression under flooding stress
[0096] Westar seeds of rapeseed were sterilized with 5% (v / v) NaClO, washed five times with sterile deionized water, and inoculated on 1 / 2MS medium. They were grown under white light for 36 hours. White seeds of the treatment group were transferred to a 5.0 mL centrifuge tube filled with sterile deionized water. After 12 hours of flooding, the seeds of each group were tested. BnBAK Expression level detection. The test results are as follows Picture 5 As shown, BnaA04.BAK7 、 BnaA08.BAK1 、 BnaC07.BAK1 、 BnaA03.BAK1 The gene was significantly induced by flooding stress, and BnaA04.BAK7 The gene has the highest induction fold. BnaC03.BAK7 Genes and BnaA03.BAK7 The overall gene expression level, and BnaA07.BAK7 Gene, BnaC07.BAK7 The gene was significantly suppressed under flooding stress. BnaC07.BAK1 There is no significant difference in gene expression under flooding stress. BnaA04.BAK7 The gene expression was induced to the greatest extent by flooding stress.
[0097] Example 4 Obtaining overexpression mutants
[0098] The BnIR website (https: / / yanglab.hzau.edu.cn / ) BnaA04.BAK7The CDS sequence of BnaA04.BAK7 Full-length CDS sequence.
[0099] Amplification BnaA04.BAK7 Sequence primers:
[0100] F: AGAGAACACCTGCAGGTCGAC ATGGAACAAGGAAGAACACCCC;
[0101] R:ACCCGGGGATCCTCTAGAGTCTCTTGGACCCGATAGGTAATC.
[0102] The pCAMBIA1300 35S:GFP (C) vector plasmid was digested with SalI restriction enzyme and homologous recombination was used to transform BnaA04.BAK7 The gene fragment was recombined with the restriction enzyme-cut plasmid to obtain the pCAMBIA1300 35S:BnaA04.BAK7-GFP vector.
[0103] The method of transferring the final vector into Agrobacterium and obtaining the mutant plant is as described in Example 1, and finally the mutant plant is obtained. BnaA04.BAK7 Gene overexpression plants, BnaA04.BAK7 Detection of gene expression, such as Picture 6 As shown, in the overexpression lines BnaA04.BAK7 The gene is in an overexpressed state.
[0104] Example 5 Observation of waterlogging phenotype of overexpressing plants
[0105] Take rapeseed wild type Westar seeds and the one obtained in Example 3 BnaA04.BAK7-GFP The overexpression strains were disinfected with 5% (v / v) NaClO, washed five times with sterile deionized water, and then inoculated onto 1 / 2MS medium. They were grown under white light for 36 hours. White seeds from the treatment group were transferred to a 5.0 ml centrifuge tube filled with sterile deionized water and submerged for 6 hours. The treated seeds were then transferred to 1 / 2MS solid medium to resume growth for 2 days. The control group was grown entirely on 1 / 2MS solid medium as the control group. Three biological replicates were set up for each control and treatment group to test the phenotype of each plant. Picture 7 As shown, after waterlogging stress during the germination period, 35S: BnaA04.BAK7 The hypocotyl length of the transgenic material is significantly longer than that of the wild type, while there is no significant difference in the hypocotyl length between the two under normal culture conditions. BnaA04.BAK7 Gene overexpression alleviated the growth inhibition of the hypocotyl of rapeseed under waterlogging stress during the germination stage.
Claims
1. BAK The application of the gene in enhancing the flooding tolerance of rapeseed is characterized in that: Said BAK Gene BnaA04.BAK7 gene; BnaA04.BAK7 The accession number of the gene in the gene bank is BnaA04g0150000WE.
2. The use according to claim 1, characterized in that: The application pathways are: (1) Through overexpression BAK Genes that enhance plants' ability to withstand flooding; or, (2) by destroying BAK The expression of genes reduces the plant's ability to tolerate flooding.
3. The use according to claim 2, characterized in that: The overexpression BAK Gene, including the following steps: (1) Using wild-type rapeseed cDNA as a template, primer sequences were designed to construct BAK Gene overexpression vectors; (2) Transforming the vector into Agrobacterium competent cells to obtain overexpression BAK Agrobacterium tumefaciens of genes; (3) Include BAK Agrobacterium carrying the gene overexpression vector was transferred into the explants of common wild-type rapeseed, and seedlings were obtained by tissue culture. BAK Gene overexpression plants.
4. The use according to claim 2, characterized in that: The destruction BAK Gene expression includes the following steps: (1) Based on BAK Gene target sequence, sgRNA design, and CRISPR / Cas9 vector construction; (2) constructing an Agrobacterium genetically engineered bacterium containing the CRISPR / Cas9 vector described in step (1); (3) transforming the genetically engineered bacteria containing the CRISPR / Cas9 vector described in step (2) into Brassica napus to obtain a homozygous mutant strain that does not contain exogenous Cas9 protein and is stably inherited; Said BAK Gene BnaA04.BAK7 gene; BnaA04.BAK7 The accession number of the gene in the gene bank is BnaA04g0150000WE.
5. The use according to claim 4, characterized in that The nucleotide sequence of the sgRNA is shown in SEQ ID NO.2~3.
6. Application of BAK protein in enhancing the flooding tolerance of rapeseed, characterized in that: The BAK protein is BnaA04.BAK7 protein; the accession number of the BnaA04.BAK7 protein in the gene bank is BnaA04g0150000WE.
7. Application of the recombinant vector in enhancing the flooding tolerance of rapeseed, characterized in that: The recombinant vector comprises BAK gene; BAK Gene BnaA04.BAK7 gene; BnaA04.BAK7 The accession number of the gene in the gene bank is BnaA04g0150000WE.
8. The use of genetically engineered bacteria in enhancing the flood resistance of rapeseed, characterized in that: The genetically engineered bacteria comprises BAK gene; BAK Gene BnaA04.BAK7 Gene; Said BnaA04.BAK7 The accession number of the gene in the gene bank is BnaA04g0150000WE.
9. A method for enhancing the flooding tolerance of rapeseed, characterized in that: The following steps are involved: (1) Based on BAK Gene sequence, construction of overexpression vector; (2) constructing an Agrobacterium genetically engineered bacterium containing the overexpression vector described in step (1); (3) transforming the genetically engineered bacteria containing the overexpression vector described in step (2) into rapeseed to obtain a rapeseed strain with enhanced flooding tolerance; Said BAK Gene BnaA04.BAK7 gene; BnaA04.BAK7 The accession number of the gene in the gene bank is BnaA04g0150000WE.
Citation Information
Patent Citations
CRISPR / Cas9 system and method for efficiently generating mutants without transgenic elements in plants.
CN110747186B
Application of BnaC2.WRKY22 gene in improving water logging resistance of plant
CN117089570A
Application of PGIP2 gene in regulation and control of crop waterlogging tolerance
CN118440956A