A methylation-sensitive ribozyme-based tRNA m 1 A modification detection method and uses
By mutating specific sites in the VMC10 enzyme activity sequence, its ability to recognize tRNA m1A modifications is enhanced, providing an efficient detection method that solves the problem of tRNA m1A modification detection in existing technologies and achieves accurate quantitative and qualitative analysis of m1A modifications.
Patent Information
- Application Number
- CN202510061578.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-15
- Publication Date
- 2026-01-16
- Estimated Expiration
- 2045-01-15
AI Technical Summary
Existing technologies lack efficient methods for detecting tRNA m1A modifications, especially in terms of their ability to detect specific sites.
By employing a mutated methylation-sensitive ribozyme VMC10, the ability to recognize m1A modifications is enhanced through specific site mutations in its enzyme activity sequence. Combined with kits and detection methods, this enables precise quantitative and qualitative analysis of m1A modifications.
It achieves efficient identification and quantitative detection of tRNA m1A modification. The mutant VMC10 has a significantly enhanced ability to recognize m1A and can effectively cleave unmethylated sites in different RNA types, providing a precise detection tool and method.
Smart Images

Figure BDA0005243042630000041 
Figure BDA0005243042630000051 
Figure BDA0005243042630000052
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of RNA methylation level detection, and particularly relates to a tRNA m 1 A modification detection method and application. BACKGROUND
[0002] tRNA plays an important role in the translation process. In addition to tRNA abundance, chemical modifications on tRNA can affect the translation process by stabilizing tRNA structure, helping tRNA to recognize codons, etc. Among them, N1-methyladenosine (m 1 A) is an important post-transcriptional modification of RNA, which is formed by adding a methyl group to the N1 position of adenosine. m 1 A is the most abundant and conserved modification on tRNA, which is located at positions 9, 14 and 58 of tRNA, and plays an important role in maintaining the secondary structure of tRNA and its stability. m 1 A on tRNA is modified by the TRMT6 / TRMT61A complex, and tRNA-m 1 A modification can enhance translation initiation and elongation; removal of m 1 A modification can promote the degradation of tRNA into tRNA fragments. At present, there is a lack of precise quantitative and qualitative analysis technology for tRNA m 1 A modification. It is a technical difficulty to detect the modification of specific m 1 A sites on specific tRNAs.
[0003] VMC10 is a functional ribozyme (DNAzyme) with cleavage activity. Previous studies have shown that the presence of N6-methyladenosine (m 6 A) modification at the VMC10 cleavage site of the target RNA will hinder the cleavage of VMC10. Therefore, VMC10 can be used to detect RNA m 6 A modification. However, there is no prior art indicating that VMC10 has the ability to detect m 1 A modification. SUMMARY
[0004] The first aspect of the application aims to provide the application of methylation ribozyme VMC10 in preparing a product for detecting m 1 A modified RNA.
[0005] The second aspect of the application aims to provide a mutated methylation-sensitive ribozyme VMC10.
[0006] The third aspect of the application aims to provide a kit for detecting m 1 A modification.
[0007] The fourth aspect of the present application aims to provide a method for detecting RNA m 1 A modified method.
[0008] In order to achieve the above-mentioned purposes of the present application, the technical solutions adopted by the present application are as follows:
[0009] The first aspect of the present application provides a methylation-sensitive nuclease VMC10 in the preparation of a product for detecting m 1 A modified product.
[0010] The enzyme active sequence of the methylation-sensitive nuclease VMC10 is 5'-GGGTCTCCAGCTGGACGTTA-3'(SEQ ID NO: 1).
[0011] In some embodiments of the present application, the 20th A in the enzyme active sequence of the methylation-sensitive nuclease VMC10 is mutated into G, and the sequence is 5'-GGGTCTCCAGCTGGACGTTG-3'(SEQ ID NO: 2).
[0012] In some embodiments of the present application, the 20th A in the enzyme active sequence of the methylation-sensitive nuclease VMC10 is mutated into C, and the sequence is 5'-GGGTCTCCAGCTGGACGTTC-3'(SEQ ID NO: 3).
[0013] In some embodiments of the present application, the 20th A in the enzyme active sequence of the methylation-sensitive nuclease VMC10 is mutated into T, and the sequence is 5'-GGGTCTCCAGCTGGACGTTT-3'(SEQ ID NO: 4).
[0014] In some embodiments of the present application, the 20th A in the enzyme active sequence of the methylation-sensitive nuclease VMC10 is deleted, and the sequence is 5'-GGGTCTCCAGCTGGACGTT-3'(SEQ ID NO: 5).
[0015] In some embodiments of the present application, the methylation-sensitive nuclease VMC10 further comprises two complementary arms, the enzyme active sequence is located in the middle of the two complementary arms, and the two end complementary arms are complementary to the target RNA sequence and are generally 8nt-20nt in length. The structural schematic diagram is shown in Figure 1 .
[0016] In some embodiments of the present application, the product is used for detecting m 1 A modification.
[0017] In some embodiments of the present application, the RNA comprises at least one of linear RNA and circular RNA.
[0018] Preferably, the RNA is tRNA.
[0019] Preferably, when the RNA is linear RNA, a methylation-sensitive ribozyme with a sequence as shown in SEQ ID NO: 1, 2, 3, 4, 5 is used for detection.
[0020] Preferably, when the RNA is tRNA, a methylation-sensitive ribozyme with a sequence as shown in SEQ ID NO: 1, 2 is used for detection.
[0021] In some embodiments of the present application, the product comprises a reagent, a kit.
[0022] In a second aspect of the present application, a mutated methylation-sensitive ribozyme VMC10 is provided.
[0023] In some embodiments of the present application, the enzyme active sequence of the methylation-sensitive ribozyme VMC10 is mutated at position 20 from A to G, and the sequence is as shown in SEQ ID NO: 2.
[0024] In some embodiments of the present application, the enzyme active sequence of the methylation-sensitive ribozyme VMC10 is mutated at position 20 from A to C, and the sequence is as shown in SEQ ID NO: 3.
[0025] In some embodiments of the present application, the enzyme active sequence of the methylation-sensitive ribozyme VMC10 is mutated at position 20 from A to T, and the sequence is as shown in SEQ ID NO: 4.
[0026] In some embodiments of the present application, the enzyme active sequence of the methylation-sensitive ribozyme VMC10 is mutated at position 20 from A to be deleted, and the sequence is as shown in SEQ ID NO: 5.
[0027] In a third aspect of the present application, a method for detecting m 1 A kit for detecting m
[0028] In some embodiments of the present application, the kit further comprises at least one of a buffer, magnesium ions, a positive control, and a negative control.
[0029] In a fourth aspect of the present application, a method for detecting RNA m 1 The method comprises the step of detecting using the kit of the third aspect of the present application.
[0030] The present application has the following beneficial effects:
[0031] The present application provides a methylation-sensitive ribozyme VMC10 for use in the preparation of a medicament for detecting m 1Application in A modified product. The present application finds that the methylsensitive ribozyme VMC10 has m 1 A sensitivity, when the target RNA m 1 A site is a cleavage target, m 1 A modification will hinder the cleavage of VMC10 to RNA, so as to detect the modification of the site. Further, the present application provides a mutant VMC10, which is mutated at the 20th A to G, and has stronger recognition ability to tRNA m 1 A modification. BRIEF DESCRIPTION OF DRAWINGS
[0032] The present application will be further described below in combination with the drawings and examples, in which:
[0033] Figure 1 It is a structural schematic diagram of the methylsensitive ribozyme VMC10.
[0034] Figure 2 It is a gel electrophoresis result of VMC10 and its mutants in detecting linear RNA m 1 A modification.
[0035] Figure 3 It is a RT-qPCR result of VMC10 and its mutants in detecting linear RNA m 1 A modification.
[0036] Figure 4 It is a detection result of different VMC10 mutants to tRNA m 1 A modification.
[0037] Figure 5 It is a qualitative detection result of VMC10 (A20G) to oligo tRNA eMet 58 site tRNA m 1 A modification.
[0038] Figure 6 It is a quantitative detection result of VMC10 (A20G) to oligo tRNA eMet 58 site tRNA m 1 A modification.
[0039] Figure 7 It is a principle schematic diagram of VMC10 (A20G) used for linear RNA m 1 A modification detection.
[0040] Figure 8 It is a principle schematic diagram of VMC10 (A20G) used for tRNA m 1 A modification detection.
[0041] Figure 9VMC10(A20G) on tRNA eMet 58 position of tRNA 1 A modification qualitative detection results.
[0042] Figure 10 VMC10(A20G) on tRNA eMet 52 position of tRNA eMet 58 position of tRNA 1 A modification qualitative detection results. DETAILED DESCRIPTION
[0043] The concept and technical effects of the present application will be described below in combination with examples, so as to fully understand the purpose, features and effects of the present application. Obviously, the described examples are only part of the examples of the present application, but not all examples. Based on the examples of the present application, other examples obtained by those skilled in the art without creative labor are within the scope of protection of the present application.
[0044] Example 1 VMC10 on m 1 A has sensitivity
[0045] 1. Experimental materials and methods
[0046] Substrate RNA Oligo-A or Oligo-m 1 A and the corresponding designed ribozyme (the active sequence is unchanged, and the two end complementary arms are changed).
[0047] The sequences are shown in Table 1.
[0048] Table 1
[0049]
[0050] The underlined part represents the enzyme active sequence.
[0051] Deoxyribozyme VMC10-1 (10 pmol), substrate RNA Oligo-A or Oligo-m 1 A (1 pmol) and water, and the final volume was 7 μL. The mixture was placed at 95°C for 5 min, and then at 25°C for 15 min. In order to start the enzyme digestion reaction, buffer Tris-HCl (50 mM, pH 7.5), NaCl (150 mM) and MgCl2(20 mM) were added, and the reaction mixture was incubated at 37°C for 10 hours. After the enzyme digestion was completed, 7M urea denaturing PAGE analysis was performed, and after SYBR Gold staining, the PAGE gel was imaged on an ultra-high sensitivity chemiluminescence imaging system.
[0052] Experimental results:
[0053] PAGE gel results show that VMC10-1 produces corresponding enzyme cleavage fragment bands (23nt) after Oligo-A treatment, indicating that VMC10 can successfully recognize and cleave non-methylated Oligo-A, while Oligo-m 1 A only detects an intact band (42nt), indicating that methylated A (m 1 A) will hinder the cleavage of VMC10 to Oligo-A. Figure 2 Therefore, it is proved by experiments that VMC10 has sensitivity to m 1 A.
[0054] Example 2 Recognition results of mutants of VMC10 to linear RNA m 1 A modification
[0055] Since VMC10 can recognize m 6 A and m 1 A at the same time, in order to make VMC10 have better m 1 A specificity, this embodiment further mutates the enzyme active center A20 of VMC10, and detects its effect of distinguishing tRNAm 1 A. This embodiment is tested in linear RNA first.
[0056] The mutation type group includes: A20 (original sequence), A20G (20th position changes from A to G), A20C (20th position changes from A to C), A20T (20th position changes from A to T), ΔA20 (delete the 20th A).
[0057] Each sequence is shown in Table 2.
[0058] Table 2
[0059]
[0060] The underlined part represents the enzyme active sequence.
[0061] Detection process:
[0062] Cleavage detection of linear RNA: the gel detection experiment method is the same as in Example 1.
[0063] Further, 2 μL of enzyme digestion product is added to a specific reverse transcription primer RT-oligo-23nt (SEQ ID NO: 13) for stem loop reverse transcription, and after generating cDNA, primers q-oligo-23nt-F and q-oligo-23nt-R (SEQ ID NO: 14, 15) are added for real-time fluorescent quantitative PCR to determine the content of the generated enzyme cleavage fragment.
[0064] The primer sequences are shown in Table 3.
[0065] Table 3
[0066]
[0067] For the cleavage of linear RNA, VMC10 and all its mutants have cleavage activity.
[0068] The PAGE gel results show that Oligo-A treated by VMC10 mutants produces a band of corresponding enzyme cleavage fragments (23 nt), indicating that VMC10 mutants can successfully recognize and cleave non-methylated Oligo-A, while Oligo-m 1 A only produces a complete band (42 nt), indicating that methylated A (m 1 A) will hinder the cleavage of Oligo-A by VMC10 mutants. Figure 2 Therefore, it is proved by experiments that VMC10 mutants are also sensitive to m 1 A of linear RNA.
[0069] The RT-qPCR results are consistent with the PAGE gel results: compared with Oligo-m 1 A treated by VMC10 and VMC10 mutants, Oligo-A has a lower Ct value, indicating that more enzyme cleavage fragments are produced. Figure 3
[0070] Example 3 Recognition results of mutants of VMC10 to tRNA m 1 A modification
[0071] The tRNA oligo target RNA sequences and the corresponding ribozyme sequences are shown in Table 4.
[0072] Table 4
[0073]
[0074] The underlined part represents the enzyme active sequence.
[0075] Cleavage detection of tRNA:
[0076] Deoxyribozyme VMC10 and its mutants (10 pmol), substrate Oligo tRNA eMet -m 1 A, Oligo tRNA eMet A (1 pmol) and water, final volume 7 μL. The mixture was placed at 95 °C for 5 min, then 25 °C for 15 min. To initiate the cleavage reaction, buffer Tris-HCl (50 mM, pH 7.5), NaCl (150 mM) and MgCl2(20 mM) were added, and the reaction mixture was incubated at 37 °C for 12 hours. After the cleavage was completed, 1 μL of the cleavage product was taken and specific reverse transcription primer RT-Met-57nt (SEQ ID NO: 23) was added for stem-loop reverse transcription. After the cDNA was generated, primers q-Met-57nt-F and q-Met-57nt-R (SEQ ID NO: 24, 15) were added for real-time fluorescent quantitative PCR to determine the content of the cleavage fragment produced. The primer sequences are shown in Table 5.
[0077] Table 5
[0078]
[0079] For the cleavage of tRNA, the results are shown in the figure: VMC10 body has m 1 A recognition effect. As for the mutants, when VMC10 A20 is guanine, it has better m 1 A recognition effect Figure 4 ). And the rest of the mutants are not good.
[0080] Subsequently, VMC10 (A20G) will be used as a tool for tRNA m 1 A recognition, and the reaction conditions will be optimized. The preferred reaction conditions finally obtained are: ① VMC10 (A20G) hybridizes with tRNA oligo, the reaction conditions are 95 °C for 5 min; 25 °C for 15 min or room temperature cooling for 10 min; ② VMC10 (A20G) cleavage: the reaction system is incubated at 37 °C for 12 hours under the condition of buffer Tris-HCl (50 mM, pH 7.5), NaCl (150 mM) and MgCl2(50 mM). ③ Result detection and analysis: 7M urea denaturation PAGE analysis or RT-qPCR detection of amplification product difference.
[0081] Example 4 VMC10 (A20G) for tRNA Met 58 position m 1 A modification qualitative detection results
[0082] 1. Experimental materials
[0083] Substrate RNA oligo-tRNA eMet -A or oligo-tRNA eMet -m 1 A
[0084] 2. Experimental method
[0085] Deoxyribozyme VMC10(A20G) (50 pmol), substrate RNA oligo-tRNA eMet -A or oligo-tRNA eMet -m 1 A (1 pmol) and water, with a final volume of 7 μL. The mixture was placed at 95 °C for 5 min, followed by 25 °C for 15 min. To initiate the cleavage reaction, buffer Tris-HCl (50 mM, pH 7.5), NaCl (150 mM) and MgCl2(50 mM) were added, and the reaction mixture was incubated at 37 °C for 12 hours. After the cleavage was completed, 7M urea denaturing PAGE analysis was used, and after SYBR Gold staining, the PAGE gel was imaged on an ultra-high sensitivity chemiluminescence imaging system.
[0086] 3. Experimental results
[0087] The results show that oligo-tRNA eMet -A treated with VMC10(A20G) produced a band of the corresponding cleavage fragment (57 nt), indicating that VMC10(A20G) can successfully recognize and cleave the non-methylated oligo-tRNA eMet -A. While oligo-tRNA eMet -m 1 A treated with VMC10(A20G) only detected a complete band of 76 nt, indicating that the methylated A(m 1 -A) would hinder the cleavage of oligo-tRNA eMet -m 1 A by VMC10(A20G). Figure 5
[0088] Example 5 VMC10 A20G tRNA Met 58 position m 1 A modification quantitative detection results
[0089] 1. Experimental materials
[0090] The same as Example 3.
[0091] The remaining materials include reverse transcription primers RT-Met-57nt; PCR primers q-Met-57nt-F, q-Met-57nt-R; sequences are shown in Tables 4 and 5.
[0092] 2. Experimental method
[0093] Deoxyribozyme VMC10(A20G) (50 pmol) and substrate RNA oligo-tRNAeMet A or oligo-tRNA eMet -m 1 A (1 pmol) and water, final volume 7 μL. The mixture was heated to 95 °C for 5 min, then 25 °C for 15 min. To initiate the cleavage reaction, buffer Tris-HCl (50 mM, pH 7.5), NaCl (150 mM) and MgCl2(50 mM) were added, and the reaction mixture was incubated at 37 °C for 12 hours. After the cleavage was completed, the produced cleavage fragments were quantified by RT-qPCR. 1 μL of the cleavage product was taken, stem-loop reverse transcription was performed with reverse transcription primer RT-Met-57nt (SEQ ID NO: 23), after the cDNA was generated, primers q-Met-57nt-F and q-Met-57nt-R (SEQ ID NO: 24, 15) were added for real-time fluorescent quantitative PCR to determine the content of the produced cleavage fragments.
[0094] 3. Experimental results
[0095] Consistent with the PAGE gel results in Example 3, oligo-tRNA treated with VMC10(A20G) eMet -m 1 oligo-tRNA treated with VMC10(A20G) compared with A eMet A has a lower Ct value, indicating that more cleavage fragments are produced, further proving that VMC10(A20G) can effectively cleave unmethylated oligo-tRNA eMet A, and can be quantified by RT-qPCR Figure 6 .
[0096] Example 6 VMC10(A20G) cleavage of tRNA Met 58 in vivo 1 A modification qualitative detection
[0097] 1. Experimental materials
[0098] The same as in Example
[0099] The remaining materials include HEK-293T, Dynabeads TM M-280 streptavidin, Qubit TM RNA HS quantification kit, biotinylated probe tRNA eMetCAT(Sequence: 5'biotin-TGCCCCGTGTGAGGATCGAACTCAC GACCT; SEQ ID NO: 25) Reverse transcription primer RT-Met-57nt; PCR primers q-Met-57nt-F, q-Met-57nt-R; sequences are shown in Tables 4 and 5.
[0100] 2. Experimental Methods
[0101] 2.1 Isolation and purification of specific tRNAs:
[0102] HEK-293T cells were cultured in high-glucose DMEM medium containing 10% fetal bovine serum at 37°C and 5% CO2 until the cells reached the required growth density.
[0103] Total RNA was extracted from cells using Trizol reagent. 30 μL of M-280 streptavidin beads were washed three times with binding / washing buffer (5 mM Tris-HCl, pH 7.5, 0.5 mM EDTA, 1 M NaCl) to remove any potential impurities. The washed beads were then conjugated with biotinylated probe tRNA. eMetCAT Mix and incubate at 4°C for 2 hours. After incubation, wash the magnetic beads four times with binding / washing buffer to remove unbound biotinylated probes. Then, equilibrate the magnetic beads in 6×SSC solution (0.9M NaCl, 0.09M sodium citrate, pH 7.0). Incubate the magnetic beads and SSC solution containing total RNA separately at 75°C for 10 minutes, then mix and incubate at 75°C for another 10 minutes to allow tRNA to bind to the biotinylated probes on the magnetic beads. Incubate the tRNA-bound magnetic beads at room temperature for 4 hours to ensure sufficient tRNA binding. After room temperature incubation, wash the magnetic beads three times with 3×SSC solution to remove unbound RNA and other impurities. Then, wash twice with 1×SSC solution, followed by one wash with 0.1×SSC solution. Finally, wash the magnetic beads with 10 μL of RNase-free water at 70°C for 5 minutes. Use Qubit TM RNA HS Quantitative Reagent Kit tRNA was measured on a 3.0 fluorometer. eMetCAT The concentration.
[0104] 2.2 Deoxyribonuclease VMC10 (A20G) (50 pmol) and purified tRNA eMetCATand water, final volume 14 μΐ. The mixture was placed at 95 °C for 5 min, then 25 °C for 15 min. To initiate the cleavage reaction, buffer Tris-HCl (50 mM, pH 7.5), NaCl (150 mM) and MgCl2(50 mM) were added, and the reaction mixture was incubated at 37 °C for 12 h. After the cleavage was completed, the generated cleavage fragments were quantified by RT-qPCR. 2 μΐ of the cleavage product was taken, and stem-loop reverse transcription was performed by adding reverse transcription primer RT-Met-57nt (SEQ ID NO: 23). After the cDNA was generated, real-time fluorescent quantitative PCR was performed by adding primers q-Met-57nt-F and q-Met-57nt-R (SEQ ID NO: 24, 15) to determine the content of the generated cleavage fragments. 3. Experimental results: The results showed that, compared with the control group, the tRNA eMet with lower Ct value and more cleavage fragments, proving that VMC10(A20G) can modify tRNA eMet 58 in cells. 1 A qualitative detection of modification Figure 9 ).
[0105] Example 7
[0106] The tRNA eMet 52 in cells as an internal reference, VMC10(A20G) was used to modify tRNA eMet 58 in cells. 1 A qualitative detection of modification.
[0107] 1. Experimental materials
[0108] The same as Example 6.
[0109] The rest of the materials contain the corresponding ribozyme sequences and primer sequences of tRNA eMetCAT 52; the corresponding ribozyme sequences and primer sequences of tRNA eMetCAT 58 are shown in Tables 4 and 5.
[0110] Table 6
[0111]
[0112] 2. Experimental methods
[0113] (1) Isolation and purification of specific tRNA: the same as Example 6. HEK-293T WT control group and overexpression of m 1 A demethylase ALKBH3 group were set up.
[0114] The expression sequence of ALKBH3 is shown as SEQ ID NO: 29: ATGGAGGAAAAAAGACGGCGAGCCCGAGTTCAGGGAGCCTGGGCTGCCCCTGTTAAAAGCCAGGCCATTGCTCAGCCAGCTACCACTGCTAAGAGCCATCTCCACCAGAAGCCTGGCCAGACCTGGAAGAACAAAGAGCATCATCTCTCTGACAGAGAGTTGTGTTCAAAGAACCTCAGCAGGTAGTACGTAGAGCTCCTGAGCCACGAGTGATTGACAGAGAGGGTGTGTATGAAATCAGCCTGTCACCCACAGGTGTATCTAGGGTCTGTTTGTATCCTGGCTTTGTTGACGTGAAAGAAGCTGACTGGATATTGGAACAGCTTTGTCAAGATGTTCCCTGGAAACAGAGGACCGGCATCAGAGAGGATATAACTTATCAGCAACCAAGACTTACAGCATGGTATGGAGAACTTCCTTACACTTATTCAAGAATCACTATGGAACCAAATCCTCACTGGCACCCTGTGCTGCGCACACTAAAGAACCGCATTGAAGAGAACACTGGCCACACCTTCAACTCCTTACTCTGCAATCTTTATCGCAATGAGAAGGACAGCGTGGACTGGCACAGTGATGATGAACCCTCACTAGGGAGGTGCCCCATTATTGCTTCACTAAGTTTTGGTGCCACACGCACATTTGAGATGAGAAAGAAGCCACCACCAGAAGAGAATGGAGACTACACATATGTGGAAAGAGTGAAGATACCCTTGGATCATGGGACCTTGTTAATCATGGAAGGAGCGACACAAGCTGACTGGCAGCATCGAGTGCCCAAAGAATACCACTCTAGAGAACCGAGAGTGAACCTGACCTTTCGGACAGTCTATCCAGACCCTCGAGGGGCACCCTGGTGA.
[0115] The sequence was inserted into the PPB vector to construct the overexpression vector.
[0116] (2) tRNA eMet52-position designed deoxyribonuclease VMC10 (50 pmol) or targeting tRNA eMet 58-position designed deoxyribonuclease VMC10(A20G) (50 pmol) and purified tRNA eMetCAT Mix with water to a final volume of 14 μL. Incubate the mixture at 95 °C for 5 min, followed by 25 °C for 15 min. To initiate the digestion reaction, add buffer Tris-HCl (50 mM, pH 7.5), NaCl (150 mM), and MgCl2 (50 mM), and incubate the reaction mixture at 37 °C for 12 h. After digestion, RT-qPCR was used to quantify the resulting digested fragments. Take 2 μL of the digestion product and add reverse transcription primers RT-Met-57nt (SEQ ID NO: 23) and RT-Met-51nt (SEQ ID NO: 27) for stem-loop reverse transcription. After generating cDNA, add primers q-Met-57nt-F and q-Met-57nt-R (SEQ ID NO: 24, 15) and q-Met-51nt-F and q-Met-51nt-R (SEQ ID NO: 28, 15) for real-time quantitative PCR to determine the content of the generated digested fragments.
[0117] 3. Experimental results showed that, compared with the control groups of HEK-293T cells in the WT group and the oe ALKBH3 group, the tRNA after VMC10(A20G) treatment was significantly lower. eMet It has a lower Ct value, producing more enzyme fragments. Simultaneously, it utilizes intracellular tRNA. eMet Using position 52 as an internal control, the ΔCt value of the WT group in HEK-293T cells was lower than that of the oe ALKBH3 group, indicating that the enzyme fragments produced after oe ALKBH3 were less than those in the WT group. This suggests that after overexpression of ALKBH3, the tRNA... eMet m 1 A modification level decreased ( Figure 10 ).
Claims
1. Use of a methylation-sensitive ribozyme VMC10 in the preparation of a method for detecting a tRNA modification. 1 A modified product in the manufacture of a medicament. The enzyme active sequence of the methylation-sensitive ribozyme VMC10 is shown as SEQ ID NO:
1.
2. The application of the methylsensitive nuclease VMC10 mutant in the preparation of the detection of tRNA m 1 A modified product: the 20th A in the sequence of the enzyme activity of the methylsensitive nuclease VMC10 mutant is mutated to G, and the sequence is shown as SEQ ID NO:
2.
3. The use according to claim 1 or 2, characterized in that: The product comprises reagents, a kit.
4. The use according to claim 3, characterized in that: The kit further comprises at least one of a buffer, magnesium ions, a positive control, a negative control.
5. A method of detecting tRNA modifications comprising the step of using the methylation-sensitive ribose nuclease VMC10 or a mutant thereof for detection. 1 A method of modification comprising the step of using the methylation-sensitive ribose nuclease VMC10 or a mutant thereof for detection. The enzyme active sequence of the methylation-sensitive ribozyme VMC10 is shown as SEQ ID NO:
1. The enzyme active sequence of the methylation-sensitive ribozyme VMC10 mutant is shown as SEQ ID NO: 2, wherein the A at position 20 is mutated to G. The detection of tRNA m 1 The method of A modification is used for non-disease diagnostic, therapeutic purposes.
Citation Information
Patent Citations
Application of DNAzyme and three-dimensional junction mediated isothermal amplification reaction to detection of site-specific m6A
CN113667726A