A method for sequencing the dynamics of whole-genome nascent transcription

Abstract

The present invention discloses a sequencing method for the dynamics of whole-gene nascent transcription; the present invention uses 4sU to label nascent RNA, improves RNA fragmentation and direct connection of adapters, and an RNA extraction method without length preference, so that short RNA fragments can be retained to the greatest extent, thereby improving the integrity and accuracy of sequencing data; through optimized experimental processes and methods, the present invention can effectively display the transcription dynamics including the downstream of the transcription start point, solving the problem that the transcription dynamic process near the transcription start point in the prior art cannot be accurately reflected; thereby providing a reliable sequencing method for measuring the early dynamics of transcription. Moreover, the present method can identify genes with rapid stress response, reveal early transcription events such as early termination of transcription; it can also be used to understand the dynamic changes of gene expression in the disease process, reveal the pathogenesis of the disease, and provide tools for related targeted drug research.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene detection, and in particular relates to a sequencing method for the dynamics of whole-gene nascent transcription. Background Art

[0002] TT-seq (transient transcriptome sequencing) is a high-resolution technology that can capture newly synthesized RNA and assess the transcription elongation rate of RNA polymerase II. By labeling RNA with 4-thiouridine for a short period of time, it can provide a snapshot of nascent transcription and help researchers understand the regulatory process of gene transcription, dynamically capture the response of transcription to stimuli or stress, and can locate coding and non-coding RNA with high precision. This makes TT-seq an ideal tool for studying gene expression (Schwalb et al., 2016). However, due to the defects of its experimental method, TT-seq cannot show the dynamic process of transcription near the transcription start site, especially the early termination of transcription in this part.

[0003] Therefore, how to accurately detect the early dynamics of transcription is a technical problem that urgently needs to be solved in this field. Summary of the invention

[0004] The purpose of the first aspect of the present invention is to provide a method for constructing a sequencing library.

[0005] The second aspect of the present invention aims to provide a sequencing library.

[0006] The third aspect of the present invention aims to provide a sequencing method.

[0007] The fourth aspect of the present invention aims to provide applications of the above-mentioned construction method, sequencing library, and sequencing method.

[0008] The technical solution adopted by the present invention is:

[0009] A first aspect of the present invention provides a method for constructing a sequencing library, comprising the following steps:

[0010] S1: Add labeled nucleotides to the sample to be tested for conjugation reaction;

[0011] S2: extracting RNA from the product after the ligation reaction and then performing fragmentation treatment to obtain RNA fragments;

[0012] S3: enriching and purifying RNA fragments to obtain enriched products;

[0013] S4: ligating a 3' linker to the enriched product;

[0014] S5: 5' end enzyme treatment;

[0015] S6: After reverse transcription, PCR amplification is performed to obtain a sequencing library.

[0016] In some embodiments of the present invention, the construction method is specifically:

[0017] S1: Add labeled nucleotides to the sample to be tested for conjugation reaction;

[0018] S2: extract RNA from the sample after the ligation reaction and perform fragmentation treatment to obtain RNA fragments;

[0019] S3: adding biotin labeling reagent to obtain biotinylated RNA, and enriching it using streptavidin magnetic beads to obtain enriched products;

[0020] S4: adding a 3' linker to obtain a 3' linker ligation product, eluting with DTT, and purifying and recovering with phenol chloroform to obtain a 3' linker ligation purified product;

[0021] S5: After 5' terminal enzyme treatment, DTT was used for elution, and phenol chloroform was used for purification and recovery; then a 5' linker was added to obtain a 5' linker ligation product;

[0022] S6: Reverse transcription of the 5' adapter ligation product is followed by PCR amplification to obtain a sequencing library.

[0023] In some embodiments of the present invention, the label in step S1 includes biotin, bromine, iodine, sulfur, ethynyl. The present invention adds labeled nucleotides to a transcription system to label the newly generated RNA, which is also called transcription conjugation.

[0024] In some embodiments of the present invention, the labeled nucleotides in step S1 are nucleotide analogs.

[0025] In some embodiments of the present invention, the nucleotide analogs in step S1 include at least one of 4sU (4-thiouridine), 6sG (6-thioguanine), 5BrU (5-bromouridine), 5IU (5-iodouridine), and 5EU (5-ethynyluridine).

[0026] In some embodiments of the present invention, the working concentration of the labeled nucleotide is 0.5-5 mM.

[0027] In some embodiments of the present invention, the reaction time of the conjugation reaction is 1-10 min.

[0028] In some embodiments of the present invention, the RNA extraction is specifically carried out by RNA extraction using an extraction method without length preference such as NucleoZOL and Trizol, and DTT is added to the reagent during the extraction process to protect the thiol group.

[0029] In some embodiments of the present invention, the fragmentation treatment includes fragmentation treatment using methods such as magnesium ion high temperature fragmentation or sodium hydroxide on ice fragmentation, without special limitation.

[0030] In some embodiments of the present invention, the fragmentation treatment further includes a step of purifying and recovering RNA fragments using phenol chloroform.

[0031] In some embodiments of the present invention, the high temperature fragmentation time of magnesium ions is 3-7 minutes.

[0032] In some embodiments of the present invention, the time of the sodium hydroxide fragmentation on ice is 12-18 min.

[0033] In some embodiments of the present invention, the biotin labeling reagent includes MTSEA-biotin and / or HPDP-biotin.

[0034] In some embodiments of the present invention, the working concentration of the biotin labeling reagent is 0.1 mg / mL-1 mg / mL.

[0035] In some embodiments of the present invention, the reaction condition of the biotin labeling reagent is incubation for 25-35 minutes.

[0036] In some embodiments of the present invention, the magnetic beads include C1 magnetic beads or T1 magnetic beads.

[0037] In some embodiments of the present invention, the reaction conditions for adding the 3' linker are incubation at 20-28°C for 1-4 hours.

[0038] In some embodiments of the present invention, the working concentration of the 3' linker is 0.5-5 μM.

[0039] In some embodiments of the present invention, the sequence of the 3' linker is 5'-p-rGrArUrCrGrUrCrGrGrArCr UrGrUrArGrArArCrUrCrUrGrArArC- / inverted dT / -3', wherein r represents a ribonucleotide.

[0040] In some embodiments of the present invention, the working concentration of DTT is 0.01-0.1M.

[0041] In some embodiments of the present invention, the reaction conditions for DTT elution are incubation at 20-28° C. in the dark for 4-6 minutes.

[0042] In some embodiments of the present invention, the specific operation of phenol chloroform purification and recovery includes: adding phenol / chloroform / isoamyl alcohol and mixing them evenly, followed by centrifugation; and repeating 1-4 times.

[0043] In some embodiments of the present invention, the centrifugation conditions are 2-8°C, 10000-14000×g, and 4-8 min.

[0044] In some embodiments of the present invention, the purification and recovery in step S4 further comprises repeating step S3.

[0045] In some embodiments of the invention, 5' endase treatment is performed using RNA 5' pyrophosphohydrolase and polynucleotide kinase.

[0046] In some embodiments of the invention, the polynucleotide kinase comprises T4 polynucleotide kinase

[0047] In some embodiments of the present invention, the reaction conditions of the 5' linker are incubation at 20-28° C. in the dark for 1-4 hours.

[0048] In some embodiments of the present invention, the working concentration of the 5' linker is 0.5-5 μM.

[0049] In some embodiments of the invention, the sequence of the 5' linker is 5'-rCrCrUrUrGrGrCrArCrCrCrGrArGrArArUrUrCrCrArNrNrNrNrNrNrNrNrN-3'.

[0050] In some embodiments of the present invention, the reverse transcription primer sequence is 5'-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA-3'.

[0051] In some embodiments of the present invention, the primers for PCR amplification include 0.1-1 μM.

[0052] In some embodiments of the present invention, after PCR amplification, the PCR amplification product can be further subjected to electrophoresis detection, and the DNA fragments can be recovered.

[0053] The second aspect of the present invention provides a sequencing library prepared by the method according to the first aspect of the present invention.

[0054] The third aspect of the present invention provides a sequencing method, which comprises sequencing the sequencing library prepared by the method described in the first aspect of the present invention.

[0055] The fourth aspect of the present invention provides the application of the construction method described in the first aspect of the present invention or the sequencing library described in the second aspect of the present invention or the sequencing method described in the third aspect of the present invention, preferably in the dynamic changes of gene expression, disease mechanism research, biological genetic analysis, synthetic biology research, and drug preparation.

[0056] In some embodiments of the present invention, the gene expression is preferably gene expression in the early transcriptional stage.

[0057] The beneficial effects of the present invention are:

[0058] The present invention uses 4sU to label nascent RNA, improves RNA fragmentation and direct connection of adapters, and an RNA extraction method without length preference, so that short RNA fragments can be retained to the greatest extent, thereby improving the integrity and accuracy of sequencing data; through optimized experimental processes and methods, the method ensures that the labeled RNA is purified twice to complete library construction as quickly as possible. The present invention can effectively display the transcription dynamics including the downstream of the transcription start point, solving the problem that the transcription dynamic process near the transcription start point in the prior art cannot be accurately reflected; thereby providing a reliable sequencing method for measuring the early dynamics of transcription.

[0059] This method can identify genes with rapid stress response and reveal early transcription events such as early transcription termination. This method can be applied to understand the dynamic changes of gene expression during the disease process and reveal the pathogenesis of the disease, especially for the pathological research of complex diseases such as cancer and neurodegenerative diseases, and provide tools for related targeted drug research. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] Figure 1 : Electrophoresis diagram of the embodiment, the left side is DNA Marker, and the right side is two samples and a control (no sample in the PCR reaction solution).

[0061] Figure 2 : Figure A is the result of transient transcriptome sequencing, and Figure B is the result of sequencing of the present invention. The results show that the present invention solves the problem of signal loss downstream of the transcription start point in transient transcriptome sequencing. DETAILED DESCRIPTION

[0062] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0063] TT-seq: transient transcriptome sequencing;

[0064] 4sU: 4-thiouridine;

[0065] Run-on: Transcription conjugation, that is, by adding labeled nucleotides (such as bromine or biotin) to a transcription system (such as living cells or in vitro transcription system), the newly generated RNA is labeled.

[0066] Sequencing: Sequencing, in the present invention, specifically refers to second-generation sequencing.

[0067] The present invention uses 4sU conjugation to label the RNA position being transcribed, uses MTSEA-biotin-XX to replace the sulfhydryl group of the labeled uridine acid after fragmentation, uses streptavidin magnetic beads to enrich the labeled RNA fragments, and directly adds RNA adapters, and finally forms a library that can be used for Illumina sequencing after reverse transcription and PCR:

[0068] 1. Cell culture and conjugation: This method requires a large number of cells for the experiment, at least 1 million cells. The conjugation uses a culture medium containing 0.5-5mM (optimal 1mM) 4sU, and the conjugation time is 1-10min (optimal 4min).

[0069] 2. RNA extraction: RNA extraction can be performed using extraction methods without length preference, such as NucleoZOL and Trizol. During the extraction process, DTT is added to the reagent to protect the thiol group (this step to step 7 should be kept away from light as much as possible).

[0070] 3. RNA fragmentation: Use magnesium ion high temperature fragmentation (optimal 5 min) or sodium hydroxide on ice fragmentation (optimal 15 min), and use phenol chloroform to purify and recover RNA fragments.

[0071] 4. Use MTSEA-biotin-XX (0.2 mg / mL, incubate at room temperature for 30 min) to replace the thiol group, purify the RNA with phenol chloroform (phenol / chloroform), and then use streptavidin magnetic beads for labeling and enrichment.

[0072] 5. Add RNA connection liquid and 3' linker (p-rGrArUrCrGrUrCrGrGrArCrUrGrUrArGrArArCrUrCrUrGrArC- / inverted dT / ) (SEQ ID NO: 1) to the streptavidin magnetic beads bound with the labeled RNA for linker connection. Use high concentration DTT to elute the RNA fragment, and phenol chloroform (phenol / chloroform) to purify and recover. Wherein, in the sequence, p: phosphorylation modification, used for linker connection; r refers to ribonucleic acid, which is different from deoxyribonucleic acid; inverted dT: reverse dT, used to block the linker to prevent the linker from self-connection.

[0073] 6. Repeat step (4) to reduce nonspecific enrichment.

[0074] 7. Use RNA5' pyrophosphohydrolase and T4 polynucleotide kinase to treat the streptavidin magnetic beads bound to the labeled RNA, use high concentration DTT to elute the RNA fragments, and purify and recover them with phenol chloroform.

[0075] 8. Then, the ligation solution and 5' linker were added to add the linker (rCrCrUrUrGrGrCrArCrCrCrGrArGrArArUrUrCrCrArNrNrNrNrNrNrNrNrN (SEQ ID NO: 2)).

[0076] 9. Recover RNA and perform reverse transcription using Superscript III reverse transcriptase;

[0077] Primer 1: AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCC GA (SEQ ID NO: 3),

[0078] Primer 2: CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA (SEQ ID NO: 4);

[0079] Among them, primer 1 is used for reverse transcription and PCR and is added in the reverse transcription step; primer 2 is only used for PCR and is added in the PCR step.

[0080] PCR amplification was performed using NEBNext Ultra IIQ5.

[0081] 10. Perform electrophoresis using 8% non-denaturing PAGE gel, remove primer dimers, and extract 140 bp to 500 bp fragments for recovery.

[0082] 11. Use Illumina sequencing platform for sequencing.

[0083] Example 1

[0084] 1. Cell culture and conjugation:

[0085] Grow cells in a T175 flask until they reach 70% to 80% confluency. Transfer cells to three 150 mm culture dishes and continue culturing for one day. Then, replace the existing medium with medium preheated to 37°C containing 1 mM 4-thiouracil (4sU) and perform the conjugation reaction for 4 min.

[0086] 2. RNA extraction:

[0087] Remove the medium and cool the dishes on ice, add 5 ml of NucleoZOL to each dish, scrape the cells thoroughly and transfer the lysate from all three dishes to a 50 ml centrifuge tube, incubate at room temperature in the dark with rotation for 5 min. Add 6 ml of 0.01 M DTT to each tube, mix thoroughly, and incubate at room temperature in the dark with rotation for 15 min.

[0088] Centrifuge the sample at 8000 × g for 15 min at room temperature and carefully transfer the supernatant to a new 50 ml centrifuge tube. Add an equal amount of isopropanol to the supernatant, mix thoroughly, and incubate at room temperature in the dark for 10 min. Centrifuge at 12000 × g for 10 min and carefully remove and discard the supernatant. Dissolve the RNA precipitate in 145 μl of RNase-free water, aliquot 10 μl and store at -80°C, and transfer the remaining 135 μl to a 1.5 ml microcentrifuge tube.

[0089] 3. RNA fragmentation:

[0090] Mix 15 μl RNA fragmentation buffer with 135 μl RNA sample and incubate at 95°C for 7 min. Immediately cool the tube on ice and add 10 μl RNA fragmentation stop solution. Next, add 390 μl DEPC water and 550 μl phenol / chloroform / isoamyl alcohol (25:24:1, volume ratio) to the tube and mix thoroughly.

[0091] Transfer the mixture to a phase lock gel tube and incubate at room temperature in the dark for 2 minutes. Then centrifuge at 12,000 × g for 5 minutes at 4°C and transfer 500 μl of the upper aqueous phase containing the RNA to a new tube. Next, add 5 μl of 1M DTT, 50 μl of 5M NaCl, and 555 μl of isopropanol, mix and incubate at 4°C in the dark for 10 minutes. Centrifuge at 12,000 × g for 10 minutes and carefully remove and discard the supernatant. Wash the RNA pellet with 75% ethanol and then centrifuge at 12,000 × g for 2 minutes and remove and discard the supernatant. Finally, dissolve the RNA in 76 μl of DEPC-treated water and add 2 μl of 1M HEPES and 2 μl of 0.05M EDTA to the sample.

[0092] 4. Biotin replacement and streptavidin magnetic beads enrichment:

[0093] Add 20 μL of 2 mg / mL MTSEA-biotin-XX (dissolved in DMF) to the RNA sample to a final concentration of 0.4 mg / mL and incubate at room temperature in the dark for 30 min with rotation. Next, add 450 μL of DEPC water and 550 μL of phenol / chloroform / isoamyl alcohol (25:24:1, volume ratio) to the test tube, mix well, transfer the mixture to a phase lock gel test tube, and incubate at room temperature in the dark for 2 min.

[0094] After centrifugation at 12,000 × g for 5 min at 4°C, transfer 500 μl of the upper aqueous phase containing the RNA to a new tube. Add 50 μl of 5 M NaCl and 550 μl of isopropanol to the tube, mix thoroughly and incubate at 4°C in the dark for 10 min. Centrifuge at 12,000 × g for 10 min and carefully remove and discard the supernatant. Wash the RNA pellet with 75% ethanol and centrifuge at 12,000 × g for 2 min. Remove and discard the supernatant. Wash the RNA pellet with 75% ethanol and centrifuge at 12,000 × g for 2 min. Remove and discard the supernatant. Add 50 μl of pre-washed streptavidin beads to the tube and incubate for 30 min with rotation in the dark. Place the tube on a magnetic rack for 2 min and remove the supernatant. Wash the beads with 500 μl of 1× magnetic bead wash buffer and place the tube on a magnetic rack for 2 min. Remove the supernatant. Repeat the wash.

[0095] 5. 3' connector connection:

[0096] Add 20 μl of ligation mix to the RNA sample, including: 2 μl of VRA3 (final concentration 2 μM, SEQ ID NO: 1), 2 μl of T4 ligase buffer, 2 μl of T4 RNA ligase I (to a final concentration of 1 U / μl), 2 μl of 10 mM ATP, 4 μl of PEG, 1 μl of RNase inhibitor and 7 μl of DEPC water, and incubate at 25°C in the dark for two hours. Next, add 100 μl of 1M DTT to the test tube and incubate for 5 min. Then, add 430 μl of DEPC water and 550 μl of phenol / chloroform / isoamyl alcohol (25:24:1, volume ratio), mix well, transfer the mixture to a phase lock gel test tube, and incubate at room temperature in the dark for 2 min. Centrifuge at 12,000 × g for 5 min at 4°C, and transfer 500 μl of the upper aqueous phase containing RNA to a new test tube.

[0097] Next, add 1 μL of GlycoBlue, 50 μL of 5M NaCl, and 550 μL of isopropanol to the tube, mix thoroughly, and incubate at 4°C in the dark for 10 min. Centrifuge at 12,000×g for 10 min, and carefully remove and discard the supernatant. Wash the RNA pellet with 75% ethanol, centrifuge at 12,000×g for 2 min, and remove and discard the supernatant. Dissolve the RNA in 76 μL of DEPC-treated water, and add 2 μL of 1M HEPES and 2 μL of 0.05M EDTA to the sample. Next, add 20 μL of 2 mg / mL MTSEA-biotin-XX to the RNA sample to a final concentration of 0.4 mg / mL and incubate at room temperature with rotation for 30 min in the dark. Add 450 μL of DEPC water and 550 μL of phenol / chloroform / isoamyl alcohol (25:24:1, volume ratio) to the test tube, mix well, transfer the mixture to a phase lock gel test tube, and incubate at room temperature in the dark for 2 min. Centrifuge at 12,000 × g for 5 min at 4 °C, and transfer 500 μL of the upper aqueous phase containing RNA to a new test tube.

[0098] Next, add 1 μL of GlycoBlue, 50 μL of 5M NaCl, and 550 μL of isopropanol to the tube, mix thoroughly, and incubate at 4°C in the dark for 10 min. Centrifuge at 12,000 × g for 10 min and carefully remove and discard the supernatant. Wash the RNA pellet with 75% ethanol and centrifuge at 12,000 × g for 2 min. Remove and discard the supernatant. Add 50 μL of pre-washed streptavidin beads to the tube and incubate for 30 min with rotation in the dark. Place the tube on a magnetic rack for 2 min and remove the supernatant. Wash the beads with 500 μL of 1× Magnetic Wash Buffer and place the tube on a magnetic rack for 2 min and remove the supernatant. Repeat the wash.

[0099] 6. 5' connector connection:

[0100] Add 10 μl of RPPH (RNA 5′ pyrophosphohydrolase) mixture to the magnetic beads, including 1 μl reaction buffer, 1 μl RNase inhibitor, 1 μl RppH and 7 μl DEPC water. Incubate at 37°C in the dark for one hour. Next, add 90 μl of T4PNK (T4 polynucleotide kinase) mixture to the magnetic beads, including 9 μl PNK buffer, 3 μl RNase inhibitor, 10 μl ATP (10 mM), 3 μl T4 PNK (to a final concentration of 0.3 U / μl) and 65 μl DEPC water. Incubate at 37°C in the dark for one hour. Then add 450 μl 1M DTT to the test tube and incubate for 5 min. Add 550 μl phenol / chloroform / isoamyl alcohol (25:24:1, volume ratio), mix well, and place the test tube on the magnetic stand for 2 min. Transfer the liquid to the phase lock gel test tube and incubate at room temperature in the dark for 2 min. Centrifuge at 12,000 × g for 5 min at 4°C and transfer 500 μl of the upper aqueous phase containing the RNA to a new tube. Add 1 μl of GlycoBlue, 50 μl of 5M NaCl, and 550 μl of isopropanol, mix thoroughly, and incubate at 4°C in the dark for 10 min. Centrifuge at 12,000 × g for 10 min and carefully remove and discard the supernatant. Wash the RNA pellet with 75% ethanol and centrifuge at 12,000 × g for 2 min. Remove and discard the supernatant.

[0101] 20 μl of ligation mixture was added to the RNA sample, including 2 μl of VRA5 (final concentration 2 μM, as 5' RNA linker, nucleotide sequence: 5'-CCUUGGCACCCGAGAAUUCCA-3' (SEQ ID NO: 5)), 2 μl of T4 ligase buffer, 2 μl of T4 RNA ligase I, 2 μl of 10 mM ATP, 4 μl of PEG, 1 μl of RNase inhibitor and 7 μl of DEPC water, and incubated at 25°C for two hours. Next, 530 μl of DEPC water and 500 μl of phenol / chloroform / isoamyl alcohol (25:24:1, volume ratio) were added, mixed thoroughly, and the liquid was transferred to a phase lock gel tube and incubated at room temperature for 2 min. 550 μl of phenol / chloroform / isoamyl alcohol (25:24:1, volume ratio) was added, mixed thoroughly, and the tube was placed on a magnetic stand for 2 min. The liquid was transferred to a phase lock gel tube and incubated at room temperature in the dark for 2 min. Centrifuge at 12,000 × g for 5 min at 4°C and transfer 500 μl of the upper aqueous phase containing the RNA to a new tube. Add 1 μl of GlycoBlue, 50 μl of 5M NaCl, and 550 μl of isopropanol, mix thoroughly, and incubate at 4°C in the dark for 10 min. Centrifuge at 12,000 × g for 10 min and carefully remove and discard the supernatant. Finally, wash the RNA pellet with 75% ethanol, centrifuge at 12,000 × g for 2 min, and remove and discard the supernatant.

[0102] 7. Reverse transcription:

[0103] Dissolve 10.5 μl of DEPC water, 1 μl of 12.5 mM dNTP mixture, 1 μl of 25 μM RP1 primer (SEQ ID NO: 3) and add to the blue precipitate. Incubate on a 70°C heating block for 2 min to denature, then cool on ice. Next, add 7.5 μl of reverse transcriptase mix to each tube, including 4 μl of first-strand buffer, 1 μl of RNase inhibitor, 1 μl of 0.1 M DTT and 1.5 μl of Superscript III reverse transcriptase. Transfer the mixture to a 200 μl PCR tube and perform a temperature gradient in a PCR machine according to the following program: 37°C for 5 min, 45°C for 15 min, 50°C for 40 min, 55°C for 10 min, 70°C for 15 min, and finally keep at 4°C.

[0104] 8. PCR amplification:

[0105] 1 μl of 25 μM R1-D70N primer (SEQ ID NO: 4), 4 μl of DEPC water and 25 μl of NEBNext UltraIIQ5 premix were added to each test tube, mixed and centrifuged for 10 seconds. Then PCR was performed according to the following conditions: 95°C for 2 minutes, followed by 5 cycles (95°C for 30 seconds, 56°C for 30 seconds, 72°C for 30 seconds), 10 cycles (95°C for 30 seconds, 65°C for 30 seconds, 72°C for 30 seconds), and finally extended at 72°C for 10 minutes, and kept constant at 4°C. The PCR product was transferred to a 1.5 ml test tube. Then 1 ml of purification mixture containing 750 μl of ethanol, 231 μl of DEPC water, 18 μl of 5M NaCl and 1 μl of GlycoBlue was added. The sample was mixed well and then centrifuged at 14,000g for 30 minutes at 4°C.

[0106] 9. Library purification:

[0107] Dissolve the DNA pellet in 10 μl of water and 2 μl of 6x Orange G loading buffer, then load the sample onto an 8% polyacrylamide gel and run at 70 V for 10 min, then at 100 V for about 30 min until the dye reaches the end of the gel. Repeat twice as different samples. The results are shown in Figure 1 Cut off the DNA portion above 140 bp and place it in a 0.5 ml test tube with a hole at the bottom, then place it in a 2 ml test tube and centrifuge at 8,000 g for 2 min. Add 200 μl of freshly prepared gel elution buffer (configured with 1M NH 4 Ac, 0.5M EDTA, 1M Tris-HCl pH8.0, 1M MgAc 2 and 10% SDS buffer, DEPC water to 50 ml), incubate at 37°C for 1 hour. Then add the buffer of the DNA recovery kit and filter at 6,000g with a 0.22-micron filter. Add an equal amount of buffered phenol:chloroform mixture, shake well to mix, then centrifuge at 14,000g for 5 minutes at 4°C, and collect the aqueous phase into a clean test tube. Add 2.5 volumes of ethanol and 1 microliter of GlycoBlue, shake well, incubate at -80°C for 30 minutes, and then centrifuge at 14,000g for 20 minutes at 4°C. Discard the liquid, wash the DNA precipitate once with 75% ethanol, and redissolve the precipitate in 20 microliters of DEPC water.

[0108] 10. Sequencing:

[0109] Illumina PE150 was used for sequencing; transient transcriptome sequencing was used as a control;

[0110] Results Figure 2 , Figure 2 Figure A in the middle shows the results of transient transcriptome sequencing. Figure 2 Figure B in the middle is the sequencing result of this Example 1. The results show that the present invention solves the problem of signal loss downstream of the transcription start point in transient transcriptome sequencing.

[0111] The above specific implementations have been described in detail for the present invention, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

[0112] References:

[0113] Schwalb Michel Margaux, Zacher Benedikt, Frühauf Katja, Demel Carina, Tresch Achim, Gagneur Julien, Cramer Patrick, 2016. TT-seq maps the humantransient transcriptome. Science 352, 1225–1228. https: / / doi.org / 10.1126 / science.aad9841.

Claims

1. A method for constructing a sequencing library, comprising the following steps: S1: Add labeled nucleotides to the sample to be tested for conjugation reaction; S2: extracting RNA from the product after the ligation reaction and then performing fragmentation treatment to obtain RNA fragments; S3: enriching and purifying RNA fragments to obtain enriched products; S4: ligating a 3' linker to the enriched product; S5: 5' end enzyme treatment; S6: After reverse transcription, PCR amplification is performed to obtain a sequencing library.

2. The construction method according to claim 1, characterized in that: The label in step S1 includes bromine, iodine, sulfur, and ethynyl; Preferably, the labeled nucleotide in step S1 is a nucleotide analog; Preferably, the nucleotide analogs include at least one of 4sU, 6sG, 5BrU, 5IU, and 5EU.

3. The construction method according to claim 1, characterized in that: The working concentration of the labeled nucleotide is 0.5-5 mM; Preferably, the reaction time of the conjugation reaction is 1-10 min.

4. The construction method according to claim 1, characterized in that: In step S3, biotin-avidin is used for enrichment and purification, wherein the biotin includes a biotin labeling reagent including MTSEA-biotin and / or HPDP-biotin; Preferably, the working concentration of the biotin labeling reagent is 0.1 mg / mL-1 mg / mL; Preferably, the reaction condition of the biotin labeling reagent is incubation in the dark for 25-35 minutes.

5. The construction method according to claim 1, characterized in that: The reaction conditions for the ligation in step S4 are incubation at 20-28°C in the dark for 1-4 hours; Preferably, the working concentration of the 3' linker is 0.5-5 μM; Preferably, step S4 further comprises purifying and recovering the product after connecting the connector and then repeating step S3.

6. The construction method according to claim 1, characterized in that: The working concentration of DTT is 0.01-0.1M; Preferably, the reaction conditions for DTT elution are incubation at 20-28°C in the dark for 4-6 minutes; Preferably, the specific operation of phenol chloroform purification and recovery includes: adding phenol / chloroform / isoamyl alcohol and mixing evenly, and then centrifuging; repeating 1-4 times; Preferably, the centrifugation condition is 2-8°C, 10000-14000×g, 4-8 min.

7. The construction method according to claim 1, characterized in that: The reaction conditions of the 5' linker are incubated at 20-28°C in the dark for 1-4h; Preferably, the working concentration of the 5' linker is 0.5-5 μM.

8. A sequencing library prepared according to the method according to any one of claims 1 to 7.

9. A sequencing method, comprising sequencing the sequencing library according to claim 8.

10. Application of the construction method according to any one of claims 1 to 7, the sequencing library according to claim 8, or the sequencing method according to claim 9; preferably in the dynamic changes of gene expression, disease mechanism research, biological genetic analysis, synthetic biology research, and drug preparation.

Images