Liver fibrosis marker circRNA and application thereof

Abstract

The invention provides a hepatic fibrosis marker circRNA and application thereof, and belongs to the field of biological medicine. The circRNA is circSMAD2, and the nucleotide sequence of the circRNA is as shown in SEQ ID NO. 1. Tests find that circSMAD2 is remarkably highly expressed in human liver cancer and liver cirrhosis serum and primary hepatic stellate cells of hepatic fibrosis mice, so that circSMAD2 can be used as a basis for clinical diagnosis of hepatic fibrosis. According to the invention, circSMAD2 is further utilized to construct an adeno-associated virus AAV knock-down vector, and in-vivo verification shows that circSMAD2 can significantly improve hepatic fibrosis of mice. Therefore, the circSMAD2 can be used as a novel target and a potential medicine for clinical treatment of hepatic fibrosis, and a new direction is provided for research and development of medicines for treating hepatic fibrosis.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and in particular relates to a liver fibrosis marker circRNA and an application thereof. Background Art

[0002] Liver fibrosis is a common wound healing response to chronic liver injury and is characterized by the accumulation of excess extracellular matrix (ECM) in activated hepatic stellate cells (HSCs). Activation of HSCs into proliferating myofibroblasts has been identified as a core driver of fibrosis in experimental and human liver injury. Therefore, understanding the regulatory mechanisms of HSC activation is a prerequisite for advancing therapeutic strategies for liver fibrosis.

[0003] Aerobic glycolysis is a metabolic phenotype of activated hepatic stellate cells, and lactate is an inevitable product of the glycolytic metabolic pathway. Once hepatic stellate cells enter the activated state, lactate levels rise rapidly. Blocking the accumulation of intracellular lactate can inhibit cell proliferation, inhibit the expression of genes related to myofibroblast characteristics, and promote the transition of activated hepatic stellate cells to a static phenotype. Increasing evidence shows that inhibiting lactate accumulation is an effective strategy to reverse the phenotypic transformation of hepatic stellate cells and alleviate liver fibrosis. However, the specific role and precise mechanism of lactate produced by metabolic remodeling in regulating the phenotype and function of hepatic stellate cells remain unclear.

[0004] Circular RNA (circRNA) belongs to the family of long ncRNAs and is not easily degraded by nucleases. It can exist stably in cells for a long time and has potential application value as a target and prognostic marker for clinical diagnosis, disease prevention and treatment. Dysregulation of circular RNA has been reported in the pathophysiological processes of various diseases, including cancer, liver fibrosis, diabetes and other diseases. Although increased lactate production has been observed during hepatic stellate cell activation, the underlying mechanism of lactate-related expression profiles and biological functions of circular RNA has not been fully elucidated. Summary of the invention

[0005] The technical problem to be solved by the present invention is how to explore the role of circular RNA in the occurrence and development of liver fibrosis. The potential mechanism of the relationship between hepatic stellate cell lactate production and the expression profile and biological function of circular RNA has not been fully elucidated. The application of circular RNA as a liver fibrosis marker and therapeutic target is provided.

[0006] The present invention solves the above technical problems through the following technical means:

[0007] The first aspect of the present invention proposes the use of circRNA as a molecular marker in the preparation of a product for diagnosing, detecting, monitoring or predicting the progression of liver fibrosis, wherein the circRNA is circSMAD2; the nucleotide sequence of the circSMAD2 is shown in SEQ ID NO.1.

[0008] The second aspect of the present invention provides a viral packaging plasmid for treating liver fibrosis, wherein the viral packaging plasmid is a plasmid containing the above-mentioned circSMAD2 and packaged by adeno-associated virus AAV.

[0009] The AAV adeno-associated virus expression plasmid is AAV2 / 8-sh-circSMAD2. Adeno-associated virus AAV has the advantages of high expression titer, high safety, and mild host immune response. In recent years, it has become one of the most widely used viral vectors in the field of gene therapy.

[0010] Preferably, the viral packaging plasmid is constructed by inserting the circSMAD2 sequence into the multiple cloning site of the above-mentioned AAV adeno-associated virus expression plasmid to construct it. The constructed viral packaging plasmid sequentially contains AAV2 / 8, α-SMA hepatic stellate cell promoter, circSMAD2 sequence and LUC fluorescent label. It can effectively achieve the knockdown of circSMAD2 in hepatic stellate cells.

[0011] The third aspect of the present invention provides a liver fibrosis-related marker circular RNA (circSMAD2), the nucleotide sequence of which is shown in SEQ ID NO.1.

[0012] The fourth aspect of the present invention provides a substance for inhibiting the expression of circSMAD2 and / or reducing its activity, including RNA interference molecules, antisense oligonucleotides, small molecule inhibitors, shRNA, substances for implementing lentiviral infection or gene knockdown for inhibiting circSMAD2.

[0013] Preferably, the substance that inhibits the expression of circSMAD2 and / or reduces its activity comprises siRNA.

[0014] More preferably, the nucleic acid sequence of the siRNA is as shown in SEQ ID NO.2 or as shown in SEQ ID NO.3.

[0015] Preferably, the siRNA can exert its inhibitory function in the form of a nucleic acid fragment, in the form of a plasmid, directly linked to an AAV vector or through transfection with liposomes, or in a host cell capable of expressing siRNA.

[0016] The fifth aspect of the present invention provides a nucleic acid fragment, a recombinant vector or a host cell, wherein the nucleic acid fragment, the recombinant vector or the host cell comprises and / or expresses the siRNA shown in SEQ ID NO.2 or SEQ ID NO.3.

[0017] A sixth aspect of the present invention is an anti-liver fibrosis drug, which comprises the nucleic acid fragment, recombinant vector or host cell described above.

[0018] The seventh aspect of the present invention proposes the use of the above-mentioned viral packaging plasmid and the substance that inhibits the expression of circSMAD2 and / or reduces its activity in the preparation of a drug for treating liver fibrosis.

[0019] The beneficial effects of the present invention are:

[0020] 1. This invention reveals for the first time the structural stability of circular RNA circSMAD2 and its application in liver fibrosis, proposes the key role of circSMAD2 in the progression of liver fibrosis, provides new molecular markers for the clinical diagnosis and evaluation of liver fibrosis, and provides new targets for the development of drugs for liver fibrosis.

[0021] 2. The present invention provides a new circular RNA, named circSMAD2, which is a circular RNA molecular structure formed by reverse shearing according to the nucleotide sequence shown in SEQ ID NO. 1. The circular RNA circSMAD2 is formed by the cyclization of the 2nd and 11th exons of the host gene SMAD2, with a genomic location of chr18:76422093-76464430 and a length of 1502nt.

[0022] 3. Application of circRNA in the preparation of drugs for the treatment of liver fibrosis. CircRNA knockdown can significantly improve liver fibrosis in mice, so circRNA can be used as a potential therapeutic target for liver fibrosis. We screened and identified differentially expressed circular RNAs and found that circSMAD2 was upregulated in lactate-activated hepatic stellate cells. Silencing circSMAD2 can inhibit the activation of stellate cells and reduce liver fibrosis damage in mice.

[0023] 4. The present invention found that circSMAD2 expression was significantly upregulated in patients with liver fibrosis, suggesting that this circular RNA can be used as a new biomarker for the clinical diagnosis of liver fibrosis. Experimental verification showed that inhibiting the expression of circSMAD2 can significantly reduce the production of liver fibrosis markers, suggesting that drugs targeting this circular RNA can inhibit the level of glycolysis in liver fibrosis and can be used as anti-liver fibrosis drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1It is a diagram of the screening process of circular RNA circSMAD2 in Example 1 of the present invention, wherein A is a schematic diagram of the screening of target circular RNAs related to lactate, B is a circRNA-seq volcano diagram, C is a histogram showing differentially expressed circular RNAs (TOP5), and D is a qRT-PCR analysis of circular RNA expression in primary mouse hepatic stellate cells stimulated by lactate.

[0025] Figure 2 The figure shows the gene information, circularization pattern and Sanger sequencing results of circular RNA circSMAD2 in Example 2 of the present invention.

[0026] Figure 3 This is a diagram showing the verification results of the characteristics of circSMAD2 in Example 2 of the present invention, which proves that the stability of circSMAD2 is much higher than that of linear SMAD2.

[0027] Figure 4 This is a comparison chart of the expression of circSMAD2 in human liver fibrosis and human liver cancer serum detected by qRT-PCR technology in Example 3 of the present invention (A) and a comparison chart of the expression of circSMAD2 in three mouse liver fibrosis models of MCD, TAA, and CCL4 detected by qRT-PCR technology (B).

[0028] Figure 5 This is an analysis diagram of the therapeutic effect of knocking down circSMAD2 on mouse liver fibrosis by constructing the circSMAD2 knockdown AAV viral vector in Example 4 of the present invention, wherein A is the qRT-PCR technology detection

[0029] B is the expression graph of circSMAD2 in CCL4-induced liver tissue after AAV2 / 8-sh-circSMAD2 injection, B is the expression graph of circSMAD2 in TAA-induced liver tissue after AAV2 / 8-sh-circSMAD2 injection detected by qRT-PCR technology, C is the expression graph of circSMAD2 in MCD diet-induced liver tissue after AAV2 / 8-sh-circSMAD2 injection detected by qRT-PCR technology, and DG is the expression graph of COL1A1, α-SMA and TIMP-1 proteins detected by western blot technology.

[0030] Figure 6 This is an analysis diagram of the therapeutic effect of circSMAD2 knockdown siRNA constructed in Example 5 of the present invention to detect circSMAD2 knockdown in the TGF-β1-induced LX-2 cell model, wherein A is a diagram of the efficiency of circSMAD2 knockdown siRNA detected by qRT-PCR technology, and BC is a diagram of the expression of COL1A1, α-SMA and TIMP-1 proteins detected by western blot technology. DETAILED DESCRIPTION

[0031] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0032] Unless otherwise specified, the test materials and reagents used in the following examples can be obtained from commercial sources.

[0033] If no specific technology or conditions are specified in the examples, they can be carried out according to the technology or conditions described in the literature in the field or according to the product instructions. Unless otherwise specified, the quantitative tests in the following examples are repeated more than three times, and the results are averaged.

[0034] Embodiment 1:

[0035] CircRNA profiling was performed after lactate treatment of primary mouse hepatic stellate cells (PmHSCs)

[0036] circRNA sequencing mainly increases the enrichment of circRNA by removing rRNA from the sample and digesting linear RNA. After library construction and sequencing, circRNA identification, distribution statistics, annotation analysis, and expression calculation can be performed ( Figure 1 A). After screening for differentially expressed circRNAs, 68 upregulated circRNAs and 15 downregulated circRNAs were found between lactate-treated PmHSCs and the control group ( Figure 1 B), qRT-PCR analysis confirmed the top five upregulated circular RNAs (circBbs9, circTbcel, circSMAD2, circRasa2, and circBckdhb) ( Figure 1 C), consistent with the circular RNA-seq data. Compared with the control group, circSMAD2 was significantly upregulated in lactate-induced PmHSCs ( Figure 1 D).

[0037] Embodiment 2:

[0038] Basic characteristics and determination of circSMAD2

[0039] 1. circSMAD2 sequence

[0040] Based on the circBase and circBank databases: mmu_circ_0007523 consists of 1502 bases and is located at chr18:76422093-76464430. The circular RNA circSMAD2 is formed by the cyclization of the 2nd and 11th exons of the host gene SMAD2. In this study, it was named circSMAD2. To verify the cyclization characteristics of circSMAD2, we used the cDNA of mouse hepatic stellate cells JS-1 as a template, PCR amplified the sequence at its junction site, and performed Sanger sequencing on the product. The results showed that the junction sequence was correct, proving the presence of circSMAD2 in JS-1 cells ( Figure 2 ).

[0041] 2. Ring structure characteristics

[0042] To further verify the ring structure characteristics of circSMAD2, we used RNase R to treat circSMAD2 obtained by amplification of human hepatic stellate cells LX-2 and found that circSMAD2 had high RNase R resistance, indicating that it may have a ring structure ( Figure 3 ).

[0043] Embodiment 3:

[0044] Expression of circSMAD2 in liver fibrosis

[0045] like Figure 4 AB results showed that compared with normal liver tissue, the expression of circSMAD2 in the blood of patients with liver fibrosis was significantly upregulated. Further qRT-PCR detection of circSMAD2 in three mouse liver fibrosis models, MCD, TAA, and CCL4, as well as primary hepatic stellate cells and TGF-β1-induced LX-2 cells. This experiment found that circSMAD2 has the potential to be used as a new biomarker for clinical diagnosis of liver fibrosis.

[0046] Embodiment 4:

[0047] This embodiment provides a viral packaging plasmid for treating liver fibrosis, which is a plasmid containing circRNA packaged by adeno-associated virus AAV. The circRNA is circSMAD2; the nucleotide sequence of circSMAD2 is shown in SEQ ID NO.1. The construction method of the above-mentioned viral packaging plasmid is: inserting the sequence of circRNA into the multiple cloning site of AAV adeno-associated virus expression plasmid to construct it.

[0048] The AAV adeno-associated virus expression plasmid was AAV2 / 8-sh-circSMAD2.

[0049] In this experiment, AAV adeno-associated virus expression plasmid AAV2 / 8-sh-circSMAD2 was used for packaging, and the circSMAD2 knockdown vector AAV2 / 8-sh-circSMAD2 was designed and sent to Qingke Biotechnology Co., Ltd. for plasmid synthesis, PCR identification, sequencing, plasmid extraction, and adeno-associated virus packaging and quality inspection. The circSMAD2 sequence in the knockdown vector is shown in SEQ ID NO.1. All animal treatment procedures were approved by the Institutional Animal Experiment Ethics Committee (Hefei, China; No.: LLSC20200977). Hepatic stellate cell promoter (α-SMA)-driven hepatic stellate cell-specific expression of luciferase in mouse liver tissue AAV2 / 8-sh-circSMAD2 and AAV2 / 8-empty were designed and synthesized by Qingke Biotechnology Co., Ltd. (Nanjing, China). AAV2 / 8-sh-circSMAD2 and AAV2 / 8-empty (1×10 12 vg / mL) was diluted with normal saline and injected into the tail vein of mice. Carbon tetrachloride (CCl4) injection-induced liver fibrosis model, male mice were randomly assigned to intraperitoneal injection of olive oil and CCl4 (10% v / v dissolved in olive oil, 2mL / kg) twice a week for 6 weeks. Thioacetamide (TAA) injection-induced liver fibrosis model, male mice were randomly assigned to intraperitoneal injection of TAA (100mg / kg) twice a week for 6 weeks. Methionine-deficient and choline-deficient (MCD) diet-induced liver fibrosis model, male mice were fed normal food (NC) or MCD diet (D200421, research diet) for 6 weeks. All mice were humanely killed and samples were taken for western blot experiments 6 weeks after modeling to detect the therapeutic effect of circSMAD2 on liver fibrosis. The results are shown in Figure 5 shown.

[0050] The specific steps of qRT-PCR are as follows: the cDNA sample obtained by reverse transcription is used as a template, and the circular RNA circSMAD2 back-to-back primers in Example 1 or primers of other genes corresponding to the species are used for RT-qPCR amplification. After the program is run, the data is exported. GAPDH is used as an internal reference, and 2 -△△ct The expression of each gene in the samples was analyzed by qRT-PCR analysis. qRT-PCR analysis showed that AAV2 / 8-sh-circSMAD2 effectively knocked out the expression of circSMAD2 in liver tissue ( Figure 5 A, B, C).

[0051] Western blot was used to detect the levels of liver fibrosis markers ( Figure 5 D). The specific steps include:

[0052] Total cell protein was extracted using Western and IP lysis buffers, separated by polyacrylamide gel electrophoresis, and transferred to PVDF membranes. The membranes were blocked with 5% skim milk powder for 1 hour at room temperature, followed by incubation with primary antibodies overnight at 4°C. The membranes were then incubated with the corresponding secondary antibodies for 1 hour at room temperature. Proteins were visualized using an enhanced chemiluminescence kit and imaged using a Tanon 5200Multi chemiluminescence imaging system (Tanon, Shanghai, China).

[0053] Embodiment 5:

[0054] Silencing circSMAD2 inhibits the expression of liver fibrosis markers in LX-2 cells induced by TGF-β1

[0055] 1. Cell transfection

[0056] siRNA design and synthesis: The present invention designs siRNA for the cyclization site of circSMAD2. The sequences used are shown in SEQ ID NO.2 and SEQ ID NO.3, and are commissioned to Jima Biotechnology Co., Ltd. for synthesis.

[0057] Cell transfection: The entire process of cell transfection must strictly follow aseptic operation, and experimental items that directly contact siRNAs must use enzyme-free consumables. The specific steps are as follows:

[0058] a1. The optimal growth density of transfected cells is about 70%-80%. Add 2.5μL of liposome LipofectamineTM 3000 solution to 100μL Opti-MEM serum-free cell culture medium. Mix gently and let stand at room temperature for 5 minutes, marking as transfection working solution A. Prepare another 100μL Opti-MEM serum-free cell culture medium, add 210pmol siRNA, mix gently and let stand at room temperature for 5 minutes, marking as transfection working solution B. Mix working solutions A and B, mix gently and let stand at room temperature for 10 minutes to form a complex.

[0059] a2. After standing for 20 min, add 200 μL of the complex solution to each well of a 12-well plate, and add 800 μL of Opti-MEM serum-free cell culture medium to each well to make the system 1 mL;

[0060] a3. Aspirate the cell culture medium to remove the cell transfection solution containing liposome LipofectamineTM 2000; add 1 mL of DMEM high-glucose culture medium containing 10% serum to each well and continue culturing in a 37°C, 5% CO2 incubator; collect cell samples at the corresponding time points according to subsequent experimental requirements and extract cell RNA.

[0061] According to the detection steps described in Example 3, RT-qPCR was used to verify the transfection and silencing efficiency of circSMAD2. The results showed that compared with the si-NC blank vector control group, the expression level of circSMAD2 in the circSMAD2 silencing group was reduced, and the silencing effect was significant, indicating that circSMAD2 was successfully inhibited. The experimental results are as follows Figure 6 A. Similarly, in LX-2 cells cultured in medium containing TGF-β1 for 24 h, silencing circSMAD2 showed that inhibition of circSMAD2 reduced the expression of liver fibrosis markers ( Figure 6 B).

[0062] circSMAD2 sequence: (SEQ ID NO.1)

[0063] GGTAGATTTACCGGGCTTTTCTGAGTGTGGATTGTTACCTTTGGTAAGAAAATGT

[0064] CGTCCATCTTGCCATTCACTCCGCCAGTGGTGAAGAGACTTCTGGGATGGAAAAA

[0065] ATCAGCCGGTGGGTCTGGAGGAGCAGGTGGTGGAGAGCAGAATGGACAGGAAG

[0066] AAAAGTGGTGTGAAAAAGCAGTGAAAAGTCTGGTGAAAAAGCTAAAGAAACA

[0067] GGACGGTTAGATGAGCTTGAGAAAGCCATCACCACTCAGAATTGCAATACTAAAT

[0068] GTGTCACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACAGCAAATAC

[0069] GGTAGATCAGTGGGACACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCT

[0070] CTTGATGGCCGTCTTCAGGTTTCACACCGGAAAGGGTTGCCACATGTTATATATTG

[0071] CCGGCTCTGGCGCTGGCCGGACCTTCACAGTCATCATGAGCTCAAGGCAATCGAA

[0072] AACTGCGAATATGCTTTTAATCTGAAAAAAGATGAAGTGTGTGTAAATCCGTACC

[0073] ACTACCAGAGAGTTGAGACCCCAGTCTTGCCTCCAGTCTTAGTGCCTCGGCACAC

[0074] GGAGATTCTAACAGAACTGCCGCCCCTGGATGACTACACCCACTCCATTCCAGAA

[0075] AACACAAATTTCCCAGCAGGAATTGAGCCACAGAGTAATTACATCCCAGAAACA

[0076] CCACCACCTGGATATATCAGTGAAGATGGAGAAACAAGTGACCAACAGTTGAAC

[0077] CAAAGTATGGACACAGGCTCTCCGGCTGAACTGTCTCCTACTACTCTCTCTCCTGT

[0078] TAATCACAGCTTGGATTTGCAGCCAGTTACTTACTCGGAACCTGCATTCTGGTGTT

[0079] CAATCGCATACTATGAACTAAACCAGAGGGTTGGAGAGACCTTCCATGCGTCACA

[0080] GCCCTCGCTCACTGTAGACGGCTTCACAGACCCATCAAACTCGGAGAGGTTCTGC

[0081] TTAGGCTTGCTCTCCAACGTTAACCGAAATGCCACTGTAGAAATGACAAGAAGAC

[0082] ATATAGGAAGGGGAGTGCGCTTGTATTACATAGGTGGGGAAGTGTTTGCTGAGTG

[0083] CCTAAGTGATAGTGCAATCTTTGTGCAGAGCCCCAACTGTAACCAGAGATACGGC

[0084] TGGCACCCTGCAACAGTGTGTAAGATCCCACCAGGCTGTAACCTGAAGATCTTCA

[0085] ACAACCAAGAATTTGCTGCTCTTCTGGCTCAGTCTGTCAACCAGGGTTTTGAAGC

[0086] CGTTTATCAGCTAACCCGAATGTGCACCATAAGAATGAGTTTTGTGAAGGGCTGG

[0087] GGAGCAGAATATCGGAGGCAGACAGTAACAAGTACTCCTTGCTGGATTGAACTTC

[0088] ATCTGAATGGCCCTCTGCAGTGGCTGGACAAAGTATTAACTCAGATGGGATCCCC

[0089] TTCAGTGCGATGCTCAAGCATGTCGTAAACCCATCAAAGACTCGCTGTAACAGCT

[0090] CCTCCGTCGTAGTATTCAT

[0091] Nucleic acid sequence of siRNA:

[0092] SEQ ID NO.2:

[0093] GUCGUAGUAUUCAUGGUAGTT-CUACCAUGAAUACUACGACTT

[0094] SEQ ID NO.3:

[0095] AUUCAUGGUAGAUUUACCGTT-CGGUAAAUCUACCAUGAAUTT

[0096] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. The use of circRNA as a molecular marker in the preparation of a product for diagnosing, detecting, monitoring or predicting the progression of liver fibrosis, characterized in that: The circRNA is circSMAD2; the nucleotide sequence of circSMAD2 is shown in SEQ ID NO.

1.

2. A viral packaging plasmid for treating liver fibrosis, characterized in that: The viral packaging plasmid is a plasmid containing the above-mentioned circSMAD2 packaged by adeno-associated virus AAV.

3. The viral packaging plasmid according to claim 2, characterized in that It is constructed by inserting the circSMAD2 sequence into the multiple cloning site of the AAV adeno-associated virus expression plasmid; the constructed viral packaging plasmid contains AAV2 / 8, GFAP hepatic stellate cell promoter, circSMAD2 sequence and LUC fluorescent label in sequence.

4. A liver fibrosis-related marker circSMAD2, characterized in that: The nucleotide sequence of circSMAD2 is shown in SEQ ID NO.

1.

5. A substance that inhibits the expression of circSMAD2 and / or reduces its activity, characterized in that: These include RNA interference molecules, antisense oligonucleotides, small molecule inhibitors, shRNA, and substances for implementing lentiviral infection or gene knockdown that inhibit circSMAD2.

6. The substance according to claim 5, characterized in that Including siRNA.

7. The substance according to claim 6, characterized in that The nucleic acid sequence of the siRNA is shown as SEQ ID NO.2 or SEQ ID NO.

3.

8. A nucleic acid fragment, a recombinant vector or a host cell, characterized in that: The nucleic acid fragment, recombinant vector or host cell contains and / or expresses the siRNA shown in SEQ ID NO.2 or SEQ ID NO.

3.

9. A drug for preventing liver fibrosis, characterized in that: The drug comprises the nucleic acid fragment, recombinant vector or host cell according to claim 7.

10. Use of the virus packaging plasmid according to any one of claims 2 to 3 and the substance according to any one of claims 5 to 7 in the preparation of a drug for treating liver fibrosis.

Images