A molecular marker K678 associated with growth traits of the swimming crab and its application

Abstract

This invention discloses a molecular marker K678 associated with the growth traits of the swimming crab *Portunus trituberculatus* and its applications. The nucleotide sequence of the molecular marker K678 is shown in SEQ ID No. 1, and the nucleotide sequences of the primer pairs used to detect this molecular marker K678 are shown in SEQ ID No. 2 and SEQ ID No. 3. The molecular marker K678 is an SNP marker, and its dominant growth genotype is the TT genotype. The molecular marker K678 provided by this invention can be used to accelerate the selection of superior strains of *Portunus trituberculatus* with excellent growth traits, promote the breeding process of superior *Portunus trituberculatus* varieties, and is of great significance in improving the growth performance and breeding efficiency of offspring crabs, increasing aquaculture yield and income.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker-assisted breeding technology for aquatic animals, specifically relating to a molecular marker K678 related to the growth traits of the swimming crab and its application. Background Technology

[0002] Three-spotted swimming crab ( Portunus trituberculatus The swimming crab (Portunus trituberculatus), belonging to the class Malacostraca, order Decapoda, family Portunidae, and genus Portunus, is a large marine economic crab species in my country. Swimming crabs are renowned both domestically and internationally for their short reproductive cycle, rapid growth, and strong adaptability. They are highly prized for their delicious and nutritious meat and are very popular with consumers. However, in the farming of swimming crabs, inconsistencies in individual size are common. These crabs exhibit strong cannibalistic behavior, with larger individuals preying on smaller or newly molted individuals, leading to significant economic losses. Furthermore, even under identical feeding and water quality conditions, significant differences in growth can occur within the same batch of crab larvae. Growth traits are crucial for the selective breeding of swimming crabs and are essential for increasing yield. Traditional breeding methods have resulted in slow genetic progress, necessitating the use of advanced molecular marker-assisted breeding technology to accelerate the breeding process. The identification and innovative application of molecular markers for growth traits are necessary prerequisites and pathways for conducting molecular marker-assisted breeding.

[0003] Molecular markers are genetic markers based on variations in the nucleotide sequence of genetic material among individuals, directly reflecting genetic polymorphism at the DNA level. Molecular markers offer significant advantages: most are co-dominant, facilitating selection for recessive traits; genomic variation is extremely rich, meaning the number of molecular markers is virtually unlimited; DNA from different stages of biological development and different tissues can be used for marker analysis; and molecular marker detection methods are simple and rapid. Currently, there are few reports on molecular markers for growth traits in the swimming crab *Portunus trituberculatus*. Therefore, developing molecular markers for growth traits is of great significance for the healthy aquaculture and breeding of *Portunus trituberculatus*. Summary of the Invention

[0004] This invention provides a molecular marker K678 related to the growth traits of the swimming crab *Portunus trituberculatus* and its application. This invention utilizes polymorphic sites in sequencing data for filtering and alignment analysis to obtain SNPs, and then performs stepwise screening of markers to finally obtain a new molecular marker K678 related to the growth traits of *Portunus trituberculatus*. Using this molecular marker is beneficial for the screening and breeding of growth traits in *Portunus trituberculatus*.

[0005] To achieve the above-mentioned objectives, the present invention employs the following technical solution:

[0006] This invention provides a molecular marker K678 related to the growth traits of the swimming crab, and the nucleotide sequence of the molecular marker K678 is shown in SEQ ID No. 1.

[0007] Furthermore, the molecular marker K678 is an SNP marker.

[0008] Furthermore, the genotype TT at the 117th base of the molecular marker K678 is the genotype for the growth-advantageous trait.

[0009] The present invention also provides a primer pair for detecting the molecular marker K678 of claim 1, characterized in that the nucleotide sequence of the forward primer is as shown in SEQ ID No. 2 and the nucleotide sequence of the reverse primer is as shown in SEQ ID No. 3.

[0010] This invention also provides the application of the molecular marker K678 in screening for varieties of swimming crab with dominant growth traits.

[0011] Further, the steps for screening varieties of swimming crabs with dominant growth traits are as follows: DNA is extracted from the swimming crab sample to be tested and used as a template. PCR amplification is performed using primers for the molecular marker K678. The PCR product is sequenced. If the genotype of the 117th base of K678 in the sequencing result is TT, then the sequencing sample is selected as the parent for breeding fast-growing varieties of swimming crabs.

[0012] Furthermore, the PCR amplification system is as follows: 2 μl template, 0.8 μl forward primer, 0.8 μl reverse primer, 10 μl 2×Rapid Taq Master Mix, and 6.4 μl ddH2O.

[0013] Furthermore, the PCR amplification procedure is as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 40 s, repeated for a total of 35 cycles; and final extension at 72°C for 5 min.

[0014] The present invention also provides a kit for breeding fast-growing varieties of swimming crabs, the kit containing the molecular marker K678 as described in claim 1 and / or the amplification primers as described in claim 4.

[0015] This invention also provides the application of the molecular marker K678 in the genetic diversity analysis, germplasm identification and genetic map construction of the swimming crab *Portunus trituberculatus*.

[0016] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0017] 1. The molecular marker K678 related to the growth traits of the swimming crab provided by this invention can be used for early selection and breeding of swimming crab seedlings of swimming crab ...

[0018] 2. The molecular marker-assisted selection breeding method of this invention uses alleles or genotypes closely related to the target trait to perform association analysis on the target trait, which improves the accuracy of selection, shortens the breeding cycle, reduces the breeding cost, and can be widely applied in the breeding process of aquatic animals. Attached Figure Description

[0019] Figure 1 This is a sequencing result of the K678 marker, which is related to the growth traits of the swimming crab *Portunus trituberculatus*, as presented in this invention. Detailed Implementation

[0020] The technical solution of the present invention will be further described in detail below with reference to specific embodiments.

[0021] The three-spined swimming crabs used in this invention were all from the experimental base of Changyi Haifeng Aquatic Products Co., Ltd., Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences. Healthy three-spined swimming crabs were randomly obtained from ponds by trawling, briefly placed in net baskets covered with a layer of aquatic plants to prevent crab fighting, and ultimately 298 three-spined swimming crabs were obtained. The muscle tissue from the swimming legs was dissected and placed in anhydrous ethanol, and then immediately frozen in liquid nitrogen.

[0022] Example 1

[0023] I. Screening of candidate molecular markers related to growth traits

[0024] 1. Sequencing data filtering and alignment

[0025] Genomic DNA was extracted using the traditional phenol-chloroform method. First, a mortar and pestle were pre-chilled with liquid nitrogen. The sample was thoroughly ground, and the ground sample was transferred to a 50ml centrifuge tube containing 20ml of GP1 lysis buffer and 500ul of mercaptoethanol lysis buffer using a pre-chilled liquid nitrogen spatula. The mixture was inverted to mix and incubated at 55°C for 60 minutes, with frequent shaking to aid complete lysis. Then, the mixture was centrifuged at 12500rpm for 8 minutes in a high-speed, low-temperature refrigerated centrifuge (Eppendorf 5804R), and the supernatant was transferred to a new 50ml centrifuge tube. An equal volume of saturated phenol / chloroform / isoamyl alcohol (25:24:1) was added, and the mixture was inverted to mix for 5 minutes. The tube was centrifuged at 12500rpm for 8 minutes, and the supernatant was carefully transferred to a new tube (it's better to take less than necessary, and the pipette tip should not touch the separation point). An equal volume of chloroform / isoamyl alcohol was added, and the mixture was vortexed to mix and centrifuged at 12500rpm for 8 minutes. Then, transfer the supernatant to a new 50ml centrifuge tube, add 3 / 4 volume of isopropanol, mix well, and incubate at -20℃ for 20 min (or -80℃ for 10 min), then centrifuge at 12000 rpm for 10 min. Discard the liquid, being careful not to discard the precipitate. Wash twice with 5ml of 75% ethanol. The remaining small amount of liquid can be collected by centrifugation again and then aspirated with a pipette tip. Then, air dry in a clean bench or at room temperature (the DNA sample should not be too dry, otherwise it will be difficult to dissolve). Add 100ul of EB to dissolve the DNA sample. Then, add 2ul of RNase A, mix by inversion, and incubate at 37℃ for 15 min. Analyze the purity and integrity of the DNA by agarose gel electrophoresis; detect the DNA purity (OD260 / 280 ratio) using Nanodrop, and accurately quantify the DNA concentration using Qubit.

[0026] DNA samples that passed the initial screening were randomly fragmented into 350 bp fragments using a Covaris shredder. Library construction was performed using the NEBNext® Ultra™ II DNA Library Prep Kit. The DNA fragments underwent end repair, polyA tailing, sequencing adapter addition, purification, and PCR amplification to complete the entire library preparation process. The constructed Russian libraries were tested using Qubit 2.0, Agilent 5300, and Q-PCR methods. After passing the library test, each library was sequenced using an Illumina Novaseq™ PE150 at Novogene Technology Co. (Tianjin, China). After rigorous filtering of the sequencing data, high-quality data was obtained for subsequent analysis. The sequencing data results are shown in Table 1.

[0027] Table 1 Summary of Sequencing Data Quality

[0028]

[0029] The filtered valid data were aligned to the *Portunus trituberculatus* reference genome using the Burrows-Wheeler alignment tool (BWA) software (parameter: mem-t4-k32-M). Duplications were removed from the alignment results using SAMTOOLS (parameter: rmdup). The alignment results showed an average alignment rate of 98.3% ± 1.7% and an average sequencing depth of 15.91 ± 3.49X for all samples, suitable for subsequent analysis.

[0030] 2. Marker detection and annotation

[0031] SNPs were detected using software such as VCFTOOLS to ensure that the detected SNPs met the following principles: (1) sequencing coverage depth not less than 6; (2) deletion ratio of a single site less than 0.1; (3) MAF (minimum allele frequency) greater than 0.05; (4) chi-square test to determine whether the marker genotype conformed to Hardy-Weinberg equilibrium (HWE) (P ≥ 1 × 10-6). The 38,735,045 obtained SNP markers were filtered to obtain 4,541,126 high-quality SNP markers.

[0032] 3. Genome-wide association study (GWAS)

[0033] Using the individual weight data from the experiment, a trait association analysis was conducted using GEMMA software and a mixed linear model (MLM). The first three principal components of the PCA were used as fixed effects, and gender was added as a covariate, while individual kinship was used as a random effect to correct for the influence of population structure and individual kinship.

[0034] y = Xα + Zβ + Wμ + e

[0035] y represents the phenotypic trait, X represents the indicator matrix of the fixed effects, α represents the estimated parameters of the fixed effects, Z represents the indicator matrix of the SNP, β represents the effect of the SNP, W represents the indicator matrix of the random effects, μ represents the predicted random individuals, and e represents the random residuals, which follow the pattern e ~ (0, δe²).

[0036] The SNP GWAS threshold is set to P<10. -5 A total of 47 SNP markers significantly associated with body weight were detected. The statistical results of the candidate SNPs are shown in Table 2.

[0037] Table 2. Statistical results of SNP marker detection and annotation

[0038]

[0039] II. Validation of Molecular Markers Related to Growth Traits

[0040] Candidate molecular markers for growth traits were validated in both large and small body weight individuals using PCR product sequencing.

[0041] (1) First, primers are designed on the flanking sequences of the marker site;

[0042] (2) Using the designed primers, PCR amplification was performed using DNA materials from 15 large-weight individuals and 16 small-weight individuals as templates, and the successfully amplified PCR products were sequenced. The sequencing primers were selected to be far from the labeling site.

[0043] (3) Use SnapGene software to analyze the sequencing peak diagram and count the genotype of each individual based on the sequencing results.

[0044] The specific steps are as follows:

[0045] 1. PCR amplification

[0046] The PCR system in this invention is as follows: 2 μl template, 0.8 μl forward primer (10 μM), 0.8 μl reverse primer (10 μM), 10 μl 2×Rapid Taq Master Mix (Novizan), and 6.4 μl ddH2O.

[0047] After adding the sample according to the above system, PCR amplification was performed under the following reaction conditions: pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 15 s, annealing at 58℃ for 15 s, extension at 72℃ for 40 s, for a total of 35 cycles; final extension at 72℃ for 5 min; storage at 4℃.

[0048] 2. Electrophoresis detection

[0049] Prepare a 1% agarose gel by mixing a certain amount of agarose and TAE in a microwave oven until dissolved into a colorless and transparent liquid. Pour the mixture into a gel mold, insert a comb, and let it stand for 20 minutes to solidify. Remove the comb and place the prepared agarose gel into a horizontal electrophoresis tank with the sample wells at the negative electrode. Use 1× TAE as buffer and Genegreen as nucleic acid staining agent. Use a pipette to pipette 6 μl of the PCR product mixed with the template into the sample wells. Then, adjust the voltage and current to 120V and 60mA, respectively, and set the time to 30 minutes for gel electrophoresis. Stop the electrophoresis when the stained bands reach 2 / 3 of the gel. After electrophoresis, observe and photograph the gel using a gel imaging system. Select samples with bright and single bands and send them to a bioengineering lab for DNA sequencing. Perform data and image analysis on the returned sequencing results.

[0050] 3. Statistical Analysis

[0051] The sequencing results of the returned large and small weight individuals were observed using SnapGene software, and the genotype information was statistically analyzed to determine the average weight of the TT and CC genotypes.

[0052] As shown in Table 3, when the genotype at locus 46:1809915 (K678) of the collected *Portunus trituberculatus* samples was TT, the average weight was 149.97 kg; when the genotype was CC, the average weight was 85.77 kg. Therefore, the average weight of *Portunus trituberculatus* with the K678 marker genotype being TT was significantly higher than that of the CC genotype. The nucleotide sequence of the K678 molecular marker is shown in SEQ ID No. 1, and the amplification primers used to develop this molecular marker are shown in SEQ ID No. 2 and SEQ ID No. 3.

[0053] SEQ ID No. 1:

[0054] Tcttcctcttcttgtgacttaatagggcacttcacttattttgaggccagtttccttttactttcgtcttttttacttcctatgcattatttt ccttatggagtatgtatttctagttatttttttttccctacaaaaaagtaacgttgttttaccccggcggcggtttattctgggtatgcttag.

[0055] Table 3 Genotyping results of K678 molecular markers

[0056]

[0057] Table 4. Amplification primers for the K678 molecular marker

[0058] .

[0059] Example 2

[0060] The molecular marker K678 obtained in this invention can be used to assist in the breeding of superior varieties of *Portunus trituberculatus*. The application steps are simplified as follows: DNA is extracted from a *Portunus trituberculatus* test sample and used as a template. PCR amplification is performed using primers K678-F and K678-R for the molecular marker K678. The PCR product is then sequenced. If the genotype at position 117 of K678 in the sequencing results is TT, the test sample can be selected as a parent for breeding superior varieties of *Portunus trituberculatus*. Furthermore, the molecular marker K678 can also be used to analyze the genetic diversity and germplasm identification of *Portunus trituberculatus*.

[0061] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions claimed by the present invention.

Claims

1. A molecular marker K678 associated with the growth traits of the swimming crab *Portunus trituberculatus*, characterized in that, The nucleotide sequence of the molecular marker K678 is shown in SEQ ID No. 1; the 117th base of the molecular marker K678 is T or C; the genotype TT of the 117th base of the molecular marker K678 is the genotype of the growth dominant trait.

2. The application of the molecular marker K678 as described in claim 1 in screening for varieties of swimming crabs with dominant growth traits.

3. The application according to claim 2, characterized in that, The steps for screening varieties of swimming crabs with superior growth traits are as follows: extract DNA from the swimming crab sample to be tested and use it as a template; perform PCR amplification using primers for the molecular marker K678; sequence the PCR product; if the genotype of the 117th base of K678 in the sequencing result is TT, then select the sequencing sample as the parent for breeding fast-growing varieties of swimming crabs.

4. The application according to claim 3, characterized in that, The PCR amplification system consisted of: 2 μl template, 0.8 μl forward primer, 0.8 μl reverse primer, 10 μl 2×Rapid Taq Master Mix, and 6.4 μl ddH2O.

5. The application according to claim 3, characterized in that, The PCR amplification procedure was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 40 s, repeated for a total of 35 cycles; and final extension at 72°C for 5 min.

Images