Molecular marker, specific primer and identification method for identifying takifugu obscurus, takifugu rubripes and hybrid puffer fishes

Abstract

The invention discloses a molecular marker, a specific primer and an identification method for identifying takifugu obscurus, takifugu rubripes and hybrid puffer fishes. Multiple detection results can be realized only through one-time PCR, and rapid identification of three species of takifugu obscurus, takifugu rubripes and hybrid puffer fishes can be completed at the same time. The method provides a rapid and accurate identification mode for puffer fish variety identification, solves the problems of difficulty in naked eye distinguishing, low accuracy of morphological feature distinguishing operation and the like, and has the characteristics of easiness in result judgment, high conservative type, high accuracy and the like. Technical support is provided for variety identification of the specific economic fish and parent selection of hybrid breeding, an idea is provided for further development of genetic science research of the hybrid puffer fish, and flourishing development of the breeding industry of the hybrid puffer fish is facilitated.

Description

Technical Field

[0001] The invention belongs to the field of genetic information identification of rare and endemic fish, and particularly relates to a molecular marker for identifying dusky pufferfish, redfin pufferfish and hybrid pufferfish, as well as a specific primer and an identification method. Background Art

[0002] Pufferfish belongs to the class of bony fish, order of Tetrodontiformes, family of Tetradontidae. The dark-striped pufferfish (Takifugu obscurus) is a typical migratory fish in the Yangtze River Basin of China. It is the main freshwater aquaculture pufferfish species and is known as one of the "Three Fresh Foods of the Yangtze River". The testicles of male fish are even known as "Xishi Tofu". The red-finned pufferfish (Takifugu rubripes) is the main pufferfish species aquacultured in northern China. Because of its ferociousness, large size and unique pattern, it is also called "tiger pufferfish". This species has the characteristics of fast growth, large size and strong resistance to low temperatures. In recent years, in-depth research on hybrid breeding technology has been reported (Gao FX, Lu WJ, Shi Y, et al. Transcriptome profiling revealed the growth superiority of hybrid pufferfish derived from Takifu guobscurus♀×Takifugu rubripes♂[J]. Comparative Biochemistry and Physiology Part D: Genomics and Proteomics, 2021, 40:100912. [2] Wang C, Shi Y, Gao Y, et al. Construction of a Growth Model and Screening of Growth-Related Genes for aHybrid Puffer(Takifugu obscurus♀×Takifugu rubripes♂)[J].Fishes,2024,9(10):404.) The dark-spotted pufferfish and the red-finned pufferfish can be hybridized to produce offspring hybrid pufferfish (dark-spotted pufferfish♀×red-finned pufferfish♂) with advantages such as growth advantages, rich nutrition, aquaculture in both marine and freshwater, and strong resistance to stress. At the same time, with the gradual opening of the consumer market, pufferfish have shown great market development potential.

[0003] In recent years, with the emergence of hybrid pufferfish and the expansion of the market, pufferfish are also facing the problem of germplasm security. However, the morphological characteristics of the dark-striped pufferfish and the red-finned pufferfish are similar, especially the hybrid pufferfish is difficult to distinguish from the parents with the naked eye, which has a certain impact on the conservation of aquatic species, interspecific hybrid breeding and scientific research on related species. The traditional identification method of constructing species discrimination formulas based on morphological characteristics is simple, but the error rate is high and it is not suitable for rigorous conservation work; the identification method based on high-throughput sequencing to detect the genetic genotype of species, such as single nucleotide polymorphism sites, can distinguish species, but the detection requires high sequencing costs and high-precision detection instruments, which is not suitable for large-scale germplasm identification and related scientific research. Therefore, how to construct a simple, low-cost, and high-accuracy identification method for dark-striped pufferfish, red-finned pufferfish and hybrid pufferfish to provide technical support for pufferfish breeding, conservation and related species research needs to be solved urgently.

[0004] The genomic genetic information of species is highly conservative, genetically stable, and has interspecific differences. Therefore, it is often used to analyze species evolution and species classification. However, obtaining more complete genetic information in the research process requires professionals to conduct genome sequencing analysis, which has high requirements for experimental instruments, data analysis, and interpretation. As a label of genetic information, molecular markers have the characteristics of conservatism, stability, and representativeness of genetic information. They are often widely used in related fields such as germplasm identification, genetic breeding, and population genetic analysis. The study of genetic molecular markers of dark-striped pufferfish, red-fin pufferfish, and hybrid pufferfish will not only help to understand their molecular biological characteristics and improve the understanding of the genetic information background of the three, but also provide a theoretical basis for the preservation of fine varieties and the identification of hybrids. In recent years, existing species identification technologies have mostly focused on SNP sequencing, SSR analysis, and other technologies. Among them, SNP sequencing technology is relatively expensive and the sequencing operation is relatively complicated; SSR is more commonly used because of its low cost, but SSR may have different copy numbers between different individuals of the same species, and the copy number of SSR repeat sequences in different species is relatively small. It is difficult to achieve resolution of amplified bands by ordinary agarose gel electrophoresis. When judging by the length of the amplified product alone, it is not only affected by the agarose electrophoresis results, but also the two amplified products of similar length will affect the experimenter's interpretation of the results. Therefore, constructing a PCR identification technology based on genetic information, which can achieve species identification only through specific primers and specific fusion amplification of genetic information, is of great significance for the protection of puffer fish germplasm and species identification. Summary of the invention

[0005] Purpose of the invention: In order to solve the above technical problems, the present invention aims to provide a molecular marker and specific primers for identifying dark-striped pufferfish, red-fin pufferfish and hybrid pufferfish, which can achieve multiple test results through only one PCR and complete the rapid identification of the three species of dark-striped pufferfish, red-fin pufferfish and hybrid pufferfish at the same time.

[0006] The present invention also provides an identification method for dark-striped pufferfish, red-fin pufferfish and hybrid pufferfish, which provides a rapid and accurate identification method for pufferfish species identification, solves the problems of difficulty in distinguishing by naked eye and low accuracy of distinguishing by morphological characteristics, and achieves the characteristics of easy judgment of results, high conservatism and high accuracy.

[0007] Technical solution: In order to achieve the above-mentioned purpose, the present invention provides a molecular marker for identifying dark-striped pufferfish, redfin pufferfish and hybrid pufferfish, wherein the molecular marker is an InDel marker in the species genome, and the base sequences of the InDel marker are shown as SEO ID NO.1-2 respectively.

[0008] The specific primers for identifying dark-striped pufferfish, red-finned pufferfish and hybrid pufferfish of the present invention include primer pair 1 or primer pair 2 or primer pair 1 and primer pair 2, wherein the base sequences of primer pair 1 are respectively shown in SEO ID NO.3-4, and the base sequences of primer pair 2 are respectively shown in SEO ID NO.5-6:

[0009] SEO ID NO.3: DF1 CTCCGACTTCAGGACCGTATCA;

[0010] SEO ID NO.4: DR1 GGCGACGCTGACACAAGAGA,

[0011] SEO ID NO.5: IF1 GGCAAGGCAGGAGAGCAGTA;

[0012] SEO ID NO.6: IR1 GCTTCCACAATTACAATTATTATACACA.

[0013] Further, the specific primer pair for identifying dark-striped pufferfish, red-finned pufferfish and hybrid pufferfish is preferably primer pair 1 and primer pair 2, the base sequences of primer pair 1 are respectively shown in SEO ID NO.3-4, and the base sequences of primer pair 2 are respectively shown in SEO ID NO.5-6:

[0014] SEO ID NO.3: DF1 CTCCGACTTCAGGACCGTATCA;

[0015] SEO ID NO.4: DR1 GGCGACGCTGACACAAGAGA,

[0016] SEO ID NO.5: IF1 GGCAAGGCAGGAGAGCAGTA;

[0017] SEO ID NO.6: IR1 GCTTCCACAATTACAATTATTATACACA.

[0018] The invention provides a kit for identifying dark-striped pufferfish, red-finned pufferfish and hybrid pufferfish, comprising the specific primers.

[0019] The specific molecular marker of the invention is used as an identification and detection marker in identifying dusky pufferfish, redfin pufferfish and hybrid pufferfish.

[0020] The primer pair or the kit of the present invention is used for identifying dusky pufferfish, redfin pufferfish and hybrid pufferfish.

[0021] Furthermore, the method for identifying dark-striped pufferfish, red-finned pufferfish and hybrid pufferfish is: extracting DNA of dark-striped pufferfish, red-finned pufferfish and hybrid pufferfish to be identified as templates, performing multiple PCR amplification with specific primer pair 1 and primer pair 2, and performing species identification based on the difference in the length of the obtained product fragments.

[0022] Furthermore, the multiplex PCR amplification reaction system is 2×Rapid Taq Master Mix 10 μl, specific primer 4 μl (50 ng / primer), ddH2O 5 μl, and DNA template 1 μl (50 ng / sample).

[0023] Furthermore, the multiplex PCR amplification reaction program is based on the principle of touchdown polymerase chain reaction, and a touchdown polymerization reaction with different annealing temperatures is designed for two pairs of primers, first pre-denaturation at 95°C for 5 minutes; then denaturation at 95°C for 30 seconds, annealing at 61°C for 30 seconds, and extension at 72°C for 30 seconds, and 15 amplification cycles are performed under this program; then denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 30 seconds, and 15 amplification cycles are performed under this program; finally, extension at 72°C for 5 minutes is performed to terminate the amplification program.

[0024] Furthermore, through agarose gel electrophoresis detection, after the specific primers combined with the sample for amplification, one 275bp specific amplification band appeared in the dark-striped pufferfish; two specific amplification bands of 320bp and 246bp appeared in the redfin pufferfish; and three specific amplification bands of 320bp, 275bp and 246bp appeared in the hybrid pufferfish.

[0025] According to the principle of polymerase chain reaction, species identification can be completed quickly and accurately through only two methods: the number of agarose gel electrophoresis bands or the length of the amplified fragment.

[0026] The present invention sequenced a large amount of genetic information of three species groups, and further analyzed the genetic information by computer, and located the InDel molecular marker regions that are highly conserved and different between the three species for the first time. And based on the above InDel marker information, the specific binding primers designed in combination with the polymerase chain reaction characteristics and the touchdown polymerase chain reaction principle make the specific amplification results in the three groups easier to interpret (1 product for dark pattern, 2 products for red fin, and 3 products for hybridization), and have a high degree of accuracy.

[0027] The two InDel molecular markers used in the present invention are obtained by screening the SEO ID NO.1-2 base sequences after a large amount of sequencing data analysis, assembling the genome information of the dark-striped puffer and the hybrid puffer, and selecting the highly conservative, genetically stable, and significantly different InDel markers selected for the purpose of identification, wherein the DF1 DR1 primer is located in the SEO ID NO.1 base sequence, in which the dark-striped puffer has a 34bp base deletion compared with the red-finned puffer, and the hybrid puffer is affected by hybrids and has two base types, wherein the IF1 IR1 primer is located in the SEO ID NO.2 base sequence, in which the dark-striped puffer has a 29bp base insertion compared with the red-finned puffer, and the hybrid puffer is also affected by hybrids and has two base types. Subsequently, the specific primers described above and the landing PCR reaction program that meets the specific primers are designed according to the specificity of primer binding, so that the experimental results are easier to read, have high accuracy, and the two pairs of primers also have a mutual cross-validation function.

[0028] The specific primers of the present invention are mainly designed to improve the readability of the results. According to the Deletion and Insertion site information and the PCR primer binding principle, the 3' end of the primer is mismatched, so that the specific primer DF1DR1 has different binding strengths at different types of Deletion sites when combined with the three species. In addition, in order to achieve multi-primer cross-validation, according to the existing DF1 DR1 specific primer information, a specific primer IF1 IR1 that does not bind to DF1DR1 and has a different binding annealing temperature is designed for the Insertion site, and the touchdown PCR principle is used to better reduce the competition between the multiple primers and the template, thereby improving the readability of the results. Finally, it is achieved that all primers can complete the multi-primer amplification results through a single PCR program.

[0029] In view of the fact that it is difficult to distinguish hybrid pufferfish, dark-striped pufferfish and red-finned pufferfish by existing phenotypes, and that lax screening can easily cause germplasm confusion, making it difficult to ensure germplasm safety, the purpose of the present invention is to provide an identification method for dark-striped pufferfish, red-finned pufferfish and their hybrid offspring hybrid pufferfish (dark-striped pufferfish♀×red-finned pufferfish♂). The variety identification method locks two interspecies conservative genetic sequences that can be used for species differentiation based on the differences in genetic information between the above species, and designs and constructs specific primers for accurate species identification. In order to improve the accuracy of identification and the readability of the results, two conservative genes with genetic differences, ptprn2 (SEO ID NO.1) and rnf139 (SEO ID NO.2), were designed and selected to construct a multi-primer identification method. Thus, species identification and result cross-validation can be completed simultaneously through only one multiplex PCR. While improving the accuracy of identification, problems such as inability to identify due to the lack of genetic information at a certain site of the template are avoided. The identification gene rnf139 selected in the identification process is a housekeeping gene. Its genetic sequence is highly conserved in different species and has stable genetic characteristics. It is suitable for the identification of the above species in various regions. Compared with traditional AFLP molecular markers, SNPs molecular markers and other methods, this method does not require redundant enzyme cutting, sequencing detection of SNPs, and fragment length judgment. It can achieve preliminary identification of the above species only through the number of amplification products of specific primers and DNA templates. It has the advantages of simple operation, low price, and accurate detection.

[0030] The method of the present invention is based on the genomic genetic differences of the dark-striped pufferfish, the red-finned pufferfish, and the hybrid pufferfish (dark-striped pufferfish♂×red-finned pufferfish♀), the conservative inheritance of housekeeping genes, the simple and low-cost PCR operation, the primer binding specificity and the touchdown PCR, etc. On the basis of traditional PCR amplification, primers are designed for two conservative InDel markers, and a multi-substance detection system is constructed, so that species identification and result cross-validation can be completed simultaneously through only one multiple PCR, and the detection accuracy is effectively improved while the detection cost is greatly reduced. The method includes the detection primer DF1 (SEOID NO.3) for the pt prn2 region: CTCCGACTTCAGGACCGTATCA; DR1 (SEO ID NO.4): GGCGACGCTGACACAAGAGA, and the detection primer IF1 (SEO ID NO.5) for the rnf139 region: GGCAAGGCAGGAGAGCAGTA; IR1 (SEO ID NO.6): GCTTCCAC AATTACAATTATTATACACA. According to the conservation of ptprn2 and rnf139 housekeeping genes, and the differences in conserved sequences between T. obscurus, T. rubripes and hybrid pufferfish, species identification was performed by the difference in the number of DNA fragments or the length of amplified sequences in multiple PCR amplification products after the conserved sequences were combined with specific primers. First, according to the polymerase chain reaction binding characteristics, in the pptrn2 gene, a 3bp (18-20bp) specific binding base was designed at the 3' end of the DR1 specific primer according to the InDel marker characteristics. In the genomic sequence DR1 of the T. obscurus species, a pairing error occurred, and the target genomic sequence could not be combined. The specific primer DF1 DR1 could not achieve PCR product amplification reaction in the T. obscurus species; in the T. rubripes species, DF1 DR1 had a 320bp specific amplification product; in the hybrid pufferfish species, affected by the InDel marker, only a 320bp specific amplification product was also obtained. In the rnf139 gene, according to the InDel marker characteristics, the IF1 IR1 specific primer has a 275bp specific amplification product in the dark-striped pufferfish species; the red-finned pufferfish species has a 246bp specific amplification product; the hybrid pufferfish has two types of specific amplification products of 275bp and 246bp due to the genetic influence of the parents. Then, considering the multi-primer binding efficiency, the optimal annealing difference design of the above two pairs of primers was carried out according to the touchdown polymerase chain reaction principle. The optimal annealing temperature of DF1 DR1 was designed to be 61℃, and the optimal annealing temperature of IF1 IR1 was designed to be 55℃, and the touchdown polymerase chain reaction program was designed and completed.The two pairs of primers mentioned above have a mutual cross-validation function. When the genetic information of the DNA template is incomplete or some sites are missing, they can still be tested by the other pair of primers, which greatly improves the detection rate of species identification results. The final result only requires 2-3% agarose gel analysis of the number or length of specific amplification products to quickly determine the species category of the sample, thereby quickly and accurately realizing individual identification that is difficult to distinguish with the naked eye in germplasm protection, species research, and hybrid breeding work.

[0031] The present invention designs a total of four specific amplification primers, including two specific primers inside ptprn2:

[0032] DF1(SEO ID NO.3): CTCCGACTTCAGGACCGTATCA;

[0033] DR1(SEO ID NO.4):GGCGACGCTGACACAAGAGA;

[0034] And two specific primers inside rnf139:

[0035] IF1 (SEO ID NO.5): GGCAAGGCAGGAGAGCAGTA;

[0036] IR1(SEO ID NO.6):GCTTCCACAATTACAATTATTATACACA;

[0037] According to the specific primers, the DNA of the sample to be tested is extracted, and the sample concentration can be identified at 10-100ng / μl. The multiple primer reaction system is characterized in that: a 20μl system is used, which includes 2×Rapid Taq Master Mix 10μl (purchased from Nanjing Novozyme Biotechnology Co., Ltd., item number: P222-01); DF 11μl (50ng); DR 11μl (50ng); IF 11μl (50ng); IR 11μl (50ng); ddH2O 5μl; sample genomic DNA 1μl (10-100ng). After the reaction system is premixed, the multiple primer PCR amplification reaction program is characterized by: first, pre-denaturation at 95°C for 5 minutes; then denaturation at 95°C for 30 seconds, annealing at 61°C for 30 seconds, and extension at 72°C for 30 seconds, and 15 amplification cycles are performed under this program; then denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 30 seconds, and 15 amplification cycles are performed under this program; finally, extension at 72°C for 5 minutes is performed to terminate the amplification program.

[0038] After the above multiple primer PCR amplification is completed, 3-5 μl of the product is subjected to constant pressure 120-180V, 20-40min electrophoresis analysis in 2-3% agar gel. The result of the dark-striped pufferfish species showed a 275bp specific DNA amplification band; the result of the red-finned pufferfish species showed two specific DNA amplification bands of 320bp and 246bp respectively; the result of the hybrid pufferfish species showed three specific amplification bands of 320bp, 275bp and 246bp respectively. According to the number and type of DNA amplification bands, individual species can be quickly identified.

[0039] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:

[0040] The specific primers of the present invention can achieve multiple test results through only one PCR when the phenotype cannot distinguish the species, and can simultaneously complete the rapid identification of three species, namely, dark-striped pufferfish, red-fin pufferfish and hybrid pufferfish (dark-striped pufferfish♀×red-fin pufferfish♂), greatly improving the accuracy of identification based solely on measurable traits.

[0041] The specific primers of the present invention are designed to bind to the genetic sequences of genes of different species in the conserved gene ptprn2 according to the binding characteristics of the polymerase chain reaction, and a multiple polymerase reaction program of two pairs of primers is designed according to the touchdown polymerase chain reaction and the specific primers in the housekeeping gene rnf139, thereby enhancing the readability of the agarose gel results and realizing the identification of species categories only by the number or length of DNA amplification products. The two results verify each other to improve the overall accuracy.

[0042] The invention discloses a method for identifying pufferfish varieties that realizes species identification through gel electrophoresis bands amplified by multiple PCR at one time, provides a rapid and accurate identification method for pufferfish variety identification, solves the problems of difficulty in distinguishing by naked eye and low accuracy rate of distinguishing by morphological characteristics, and realizes the characteristics of easy judgment of results, high conservatism, high accuracy rate, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 These are typical pictures of dark-striped pufferfish, red-finned pufferfish, and hybrid pufferfish. Picture A shows a dark-striped pufferfish; Picture B shows a hybrid offspring hybrid pufferfish; Picture C shows a red-finned pufferfish.

[0044] Figure 2The results of the multiple primer PCR species identification method in Example 1 are displayed, wherein Figure A is the multiple primer PCR specific amplification result of dark-striped pufferfish, with a 275bp specific amplification product; Figure B is the multiple primer PCR specific amplification result of redfin pufferfish, with two specific amplification products of 320bp and 246bp; Figure C is the multiple primer PCR specific amplification result of offspring hybrid pufferfish, with three specific amplification products of 320bp, 275bp and 246bp; Figure D is a comparison of the multiple primer PCR specific amplification results of dark-striped pufferfish, redfin pufferfish and hybrid pufferfish, dark-striped pufferfish has a 275bp specific amplification product, redfin pufferfish has two specific amplification products of 320bp and 246bp, and hybrid pufferfish has three specific amplification products of 320bp, 275bp and 246bp;

[0045] Figure 3 The results of 3% agarose electrophoresis analysis after the multiple primer PCR species identification specific amplification of the dark-striped pufferfish, hybrid pufferfish and redfin pufferfish in Example 2, wherein the far left is the Maker control band, wherein 1-72 are dark-striped pufferfish amplified bands with a 275bp specific amplification band, wherein 73-144 are hybrid pufferfish amplified bands with three specific amplification bands of 320bp, 275bp and 246bp respectively, wherein 145-152 are dark-striped pufferfish with a 275bp specific amplification product, wherein 153-160 are redfin pufferfish with two specific amplification products of 320bp and 246bp, wherein 161-168 are hybrid pufferfish with three specific amplification products of 320bp, 275bp and 246bp respectively.

[0046] Figure 4 The results of 3% agarose electrophoresis analysis after the redfin pufferfish multiple primer PCR species identification specific amplification in Example 3, wherein the leftmost band is the Maker control band, wherein 1-96 is the redfin pufferfish with two specific amplification products of 320 bp and 246 bp;

[0047] Figure 5 The results of the DF1 DR1 test in Example 4 are shown in the figure. The leftmost band is the Maker control band, 1-24 are dark-striped pufferfish with no specific product, 25-48 are red-fin pufferfish with a 320 bp specific amplification product, and 49-72 are hybrid pufferfish with a 320 bp specific amplification product.

[0048] Figure 6The results of the IF1 IR1 test in Example 4 are shown in the figure. The leftmost band is the Maker control band, and bands 1-24 are specific amplification products of 275 bp for dark-striped pufferfish, 25-48 are specific amplification products of 246 bp for red-fin pufferfish, and 49-72 are specific amplification products of 275 bp and 246 bp for hybrid pufferfish. DETAILED DESCRIPTION

[0049] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0050] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources. Experimental methods without specific conditions specified in the examples are usually carried out under conventional conditions or under conditions recommended by the manufacturer.

[0051] Example 1

[0052] The materials of this embodiment include the dark-striped pufferfish, red-fin pufferfish and hybrid pufferfish of confirmed species, all of which are from Nantong Zhongyang Seed Industry (Jiangsu) Co., Ltd.

[0053] A total of 96 samples of known species of dark-striped pufferfish, redfin pufferfish and hybrid pufferfish were randomly selected from different groups, including 32 dark-striped pufferfish, 32 hybrid pufferfish and 32 redfin pufferfish ( Figure 1). The above randomly selected individuals were subjected to DNA extraction using a commercial kit (purchased from Nanjing Novozymes Biotech Co., Ltd., catalog number: DC102-01). After the sample DNA was extracted, the sample DNA concentration was determined to be 100-300 ng / μl, and the sample DNA concentration was diluted to 50 ng / μl. 40 DNA samples of dark-striped pufferfish and hybrid pufferfish were randomly selected for genome sequencing on the Illumina platform of Guangzhou Kidio Biotechnology Co., Ltd. The sequencing results were quality controlled and assembled using FASTP (Version 0.18.0). The assembly results were analyzed using BWA (Version 0.7.12) software based on the NCBI database redfin pufferfish genome (GCA_901000725.2) for genomic information differences between species, and the difference sites were marked in combination with the reference genome. Deletion and Insertion difference sites within genetically stable and highly conserved housekeeping genes were selected from the InDel molecular markers among the three species for verification analysis. In order to improve the accuracy of identification and the readability of the results, two conservative genes with genetic differences, ptprn2 (SEO ID NO.1) and rnf139 (SEO ID NO.2), were designed and selected. Subsequently, DF1 DR1 (sequences shown in SEO ID NO.3-4) specific primers were designed based on the InDel marker characteristics of the ptprn2 gene (sequence as shown in SEO ID NO.1). The 3' end of the DR1 primer contains 3bp (18-20bp) of specific binding bases. In the genome sequence DR1 of the dark-striped pufferfish species, a pairing error occurs, and the target genome sequence cannot be bound. The specific primer DF1 DR1 cannot achieve PCR product amplification reaction in the dark-striped pufferfish species; in the redfin pufferfish species, DF1 DR1 (sequence as shown in SEO ID NO.3-4) has a 320bp specific amplification product; in the hybrid puffer species, the hybrid genetic influence only has the same 320bp specific amplification product. Subsequently, in the rnf139 gene (sequence as shown in SEO ID NO.2), IF1 IR1 (sequence as shown in SEOID NO.5-6) ​​specific primers were designed according to the InDel marker characteristics, and in the dark-striped puffer species, there is a 275bp specific amplification product; the red-finned puffer species has a 246bp specific amplification product; the hybrid puffer is affected by hybrid genetics and has two types of specific amplification products of 275bp and 246bp. Subsequently, considering the multi-primer binding efficiency, the above two pairs of primers were designed for optimal annealing differences according to the touchdown polymerase chain reaction principle.The PCR system was 20 μl, including 1 μl (50 ng / sample) of one sample DNA to be tested, 11 μl (50 ng / sample) of DF, 11 μl (50 ng) of DR, 11 μl (50 ng) of IF, 11 μl (50 ng) of IR, 5 μl of ddH2O, and 10 μl of 2×RapidTaq MasterMix (purchased from Nanjing Novogene Biotechnology Co., Ltd., catalog number: P222-01). The multiple primer PCR reaction program was then set up: 95°C pre-denaturation for 5 min; then 95°C denaturation for 30 s, 61°C annealing for 30 s, 72°C extension for 30 s, and 15 amplification cycles under this program; then 95°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 30 s, and 15 amplification cycles under this program; finally, 72°C extension for 5 min to end the amplification program. 4 μl of the above specific amplification product was subjected to electrophoresis analysis in 3% agarose gel, and the electrophoresis program was 120 v (5.5 v / cm) for 40 min. The electrophoresis results were analyzed by gel imaging, as shown in FIG. Figure 2 As shown in A, it is the result of PCR specific amplification of Takifugu obscurus using multiple primers, with a specific amplification product of 275 bp; Figure 2 B shows the specific amplification result of PCR with multiple primers for redfin pufferfish, with two specific amplification products of 320 bp and 246 bp; Figure 2 C shows the specific amplification result of multiple primer PCR of progeny hybrid pufferfish, with three specific amplification products of 320 bp, 275 bp and 246 bp; Figure 2 D shows the comparison of the specific amplification results of multiple primers PCR of dark-striped pufferfish, red-finned pufferfish, and hybrid pufferfish. Dark-striped pufferfish has a 275bp specific amplification product, red-finned pufferfish has two specific amplification products of 320bp and 246bp, and hybrid pufferfish has three specific amplification products of 320bp, 275bp, and 246bp;

[0054] This method can quickly identify the dark-striped pufferfish, red-fin pufferfish, and hybrid pufferfish species, with an identification accuracy rate of 100%.

[0055] Example 2

[0056] The materials of this embodiment include the dark-striped pufferfish, red-fin pufferfish and hybrid pufferfish of confirmed species, all of which are from Nantong Zhongyang Seed Industry (Jiangsu) Co., Ltd.

[0057] A total of 168 samples of known species of dark-striped pufferfish, red-finned pufferfish and hybrid pufferfish from different groups were randomly selected, including 80 dark-striped pufferfish, 80 hybrid pufferfish and 8 red-finned pufferfish. DNA was extracted from the randomly selected individuals using a commercial kit (purchased from Nanjing Novozymes Biotech Co., Ltd., catalog number: DC102-01). After sample DNA extraction, the sample DNA concentration was determined to be 100-300 ng / μl, and the sample DNA concentration was diluted to 50 ng / μl. The PCR system was 20 μl, including 1 μl (50 ng / sample) of one of the test DNAs, 11 μl (50 ng / sample) of DF, 11 μl (50 ng) of DR, 11 μl (50 ng) of IF, 11 μl (50 ng) of IR, 5 μl of ddH2O, and 10 μl of 2×Rapid Taq Master Mix (purchased from Nanjing Novozymes Biotech Co., Ltd., catalog number: P222-01). Then set up the multiple primer PCR reaction program: 95℃ pre-denaturation for 5min; then 95℃ denaturation for 30s, 61℃ annealing for 30s, 72℃ extension for 30s, and 15 amplification cycles under this program; then 95℃ denaturation for 30s, 55℃ annealing for 30s, 72℃ extension for 30s, and 15 amplification cycles under this program; finally 72℃ extension for 5min to end the amplification program. Take 4μl of the above specific amplification product and perform electrophoresis analysis in 3% agarose gel. The electrophoresis program is 120v (5.5v / cm) and 40min. Figure 3 As shown, the far left is the Maker control band, 1-72 is the dark-striped pufferfish amplification band with a 275bp specific amplification band, 73-144 is the hybrid pufferfish amplification band with three specific amplification bands of 320bp, 275bp and 246bp respectively, 145-152 is the dark-striped pufferfish with a 275bp specific amplification product, 153-160 is the red-finned pufferfish with two specific amplification products of 320bp and 246bp, and 161-168 is the hybrid pufferfish with three specific amplification products of 320bp, 275bp and 246bp. The gel imaging analysis results of the electrophoresis results show that among the 168 samples involved in the analysis, there are 80 dark-striped pufferfish, 80 hybrid pufferfish and 8 red-finned pufferfish, that is, the species identification rate is 100%.

[0058] Example 3

[0059] The redfin pufferfish in this example came from Dalian Tianzheng Industrial Co., Ltd., and 96 redfin pufferfish samples were randomly selected from Dalian Daheishi Modern Fishery Base (Tianzheng Industrial Co., Ltd. breeding base).

[0060] The above randomly selected individuals were subjected to DNA extraction using a commercial kit (purchased from Nanjing Novozyme Biotechnology Co., Ltd., catalog number: DC102-01). After sample DNA extraction, the sample DNA concentration was determined to be 300-500 ng / μl, and the sample DNA concentration was diluted to 50 ng / μl. The PCR system was 20 μl, including 1 μl (50 ng / sample) of one of the DNA to be tested, 11 μl (50 ng / sample) of DF, 11 μl (50 ng) of DR, 11 μl (50 ng) of IF, 11 μl (50 ng) of IR, 5 μl of ddH2O, and 10 μl of 2×RapidTaq Master Mix (purchased from Nanjing Novozyme Biotechnology Co., Ltd., catalog number: P222-01). Then set up the multiple primer PCR reaction program: 95℃ pre-denaturation for 5min; then 95℃ denaturation for 30s, 61℃ annealing for 30s, 72℃ extension for 30s, and 15 amplification cycles under this program; then 95℃ denaturation for 30s, 55℃ annealing for 30s, 72℃ extension for 30s, and 15 amplification cycles under this program; finally 72℃ extension for 5min to end the amplification program. Take 3μl of the above specific amplification product and perform electrophoresis analysis in 3% agarose gel. The electrophoresis program is 180v (8.2v / cm) and 25min. Figure 4 As shown, the leftmost is the Maker control band, and 1-96 is the red fin puffer with two specific amplification products of 320bp and 246bp. The electrophoresis results were analyzed by gel imaging and showed that all 96 samples involved in the analysis showed the analysis results of the red fin puffer amplification products, that is, the identification rate was 100%. Although the present invention has used this method to verify a large number of dark-striped puffer and hybrid puffer individuals in Examples 1 and 2, the red fin puffer population cultivated by Nantong Zhongyang Seed Industry (Jiangsu) Co., Ltd. is limited, and the number of individuals involved in the verification is small, so the red fin puffer individual verification work was added separately to verify the accuracy of the method.

[0061] Example 4

[0062] The materials of this embodiment include the dark-striped pufferfish and hybrid pufferfish of confirmed species, both of which are from Nantong Zhongyang Seed Industry (Jiangsu) Co., Ltd. The red-finned pufferfish is from Dalian Tianzheng Industrial Co., Ltd. and Dalian Daheishi Modern Fishery Base (Tianzheng Industrial Co., Ltd. breeding base).

[0063] To explain the working principle of multi-primer specific amplification involved in this method in detail, two pairs of primers (DF 1 DR 1, IF1 IR1) were used for species identification. A total of 72 samples of known species of dark-striped pufferfish, red-finned pufferfish and hybrid pufferfish were randomly selected from different groups, including 24 samples of each species. DNA was extracted from the randomly selected individuals using a commercial kit (purchased from Nanjing Novozymes Biotech Co., Ltd., catalog number: DC102-01). After sample DNA extraction, the sample DNA concentration was determined to be 200-500ng / μl, and the sample DNA concentration was diluted to 50ng / μl.

[0064] When comparing and analyzing the DF1 DR1 primers, premix the sample DNA 1μl (50ng / sample), DF1 1μl (50ng), DR1 1μl (50ng), ddH2O 7μl, and 2×Rapid Taq Master Mix 10μl (purchased from Nanjing Novozyme Biotechnology Co., Ltd., catalog number: P222-01). Then set the PCR reaction program: 95℃ pre-denaturation for 5min; then 95℃ denaturation for 30s, 61℃ annealing for 30s, 72℃ extension for 30s, and 30 amplification cycles under this program; finally, 72℃ extension for 5min to end the amplification program. When comparing and analyzing the IF1 IR1 primers, premix sample DNA 1μl (50ng / sample), IF1 1μl (50ng), IR1 1μl (50ng), ddH2O 5μl, 2×RapidTaq Master Mix 10μl (purchased from Nanjing Novozyme Biotechnology Co., Ltd., catalog number: P222-01). Then set the PCR reaction program: 95℃ pre-denaturation for 5min; then 95℃ denaturation for 30s, 55℃ annealing for 30s, 72℃ extension for 30s, 30 amplification cycles under this program; finally 72℃ extension for 5min to end the amplification program.

[0065] Then, 4 μl of the above specific amplification product was electrophoresed in 3% agarose gel at 180 v (8.2 v / cm) for 25 min. Figure 5 As shown, the leftmost is the Maker control band, 1-24 are dark-striped pufferfish without specific products, 25-48 are red-finned pufferfish with 320bp specific amplification products, and 49-72 are hybrid pufferfish with 320bp specific amplification products. The comparison results of IF1 IR1 are shown in Figure 6As shown, the far left is the Maker control band, of which 1-24 is the dark-striped pufferfish with a 275bp specific amplification product, 25-48 is the red-finned pufferfish with a 246bp specific amplification product, and 49-72 is the hybrid pufferfish with two types of specific amplification products of 275bp and 246bp. It can be seen that both primers have the ability to identify the above species to varying degrees. The multi-primer PCR system designed by this method combines two different types of specific primers well, so that species identification has the characteristics of easy judgment of results, high accuracy of mutual verification of results, simple experimental operation, and low price. It provides accurate theoretical basis and identification methods in the fields of germplasm protection, species research, hybrid breeding, etc. In summary, although the two primers can be used alone, they both have certain disadvantages: when the DF1 DR1 primer is used alone, although there is no amplification product in the dark-striped pufferfish population, the red-finned pufferfish and the hybrid pufferfish have products of the same size, which are difficult to distinguish. Secondly, the IF1 IR1 primers can be used alone to distinguish the hybrid pufferfish from the other two by the number of amplified products, but the amplified products of the dark-striped pufferfish and the red-finned pufferfish are similar in length, which can easily lead to misjudgment. Therefore, when the two primers are combined, the dark-striped pufferfish will have only one amplified product, the red-finned pufferfish will have two amplified products, and the hybrid pufferfish will have three amplified products, so that the advantages of the two primers complement each other, the results are easy to read, and the results of the two primers can verify the final results.

[0066] Example 5

[0067] The materials of this embodiment include the dark-striped pufferfish and hybrid pufferfish of confirmed species, both of which are from Nantong Zhongyang Seed Industry (Jiangsu) Co., Ltd. The red-finned pufferfish is from Dalian Tianzheng Industrial Co., Ltd. and Dalian Daheishi Modern Fishery Base (Tianzheng Industrial Co., Ltd. breeding base).

[0068] In order to better improve the specific primer binding efficiency, this method uses software to design multiple pairs of specific primers based on the primer binding amplification characteristics, and then conducts experimental screening. Finally, 6 pairs of primers were retained for further verification, including the specific primers DF1 DR1, DF2 DR2, and DF3 DR3 designed for the ptprn2 gene; the specific primers IF1 IR1, IF2 IR2, and IF3 IR3 designed for the rnf139 gene;

[0069] The specific primer sequences are as follows:

[0070] DF1:CTCCGACTTCAGGACCGTATCA;

[0071] DR1: GGCGACGCTGACACAAGAGA;

[0072] DF2:CCGACTTCAGGACCGTATCACCG;

[0073] DR2:AGTCTGGCGACGCTGACACGAG;

[0074] DF3:CCTCCGAGCATCTGTTGA;

[0075] DR3:TTCGGTGTTTCCTTCTGTCT;

[0076] IF1:GGCAAGGCAGGAGAGCAGTA;

[0077] IR1:GCTTCCACAATTACAATTATTATACACA;

[0078] IF2:AAGTGGCAAGGCAGGAGA;

[0079] IR2:CACAATTACAATTATTATACACAAGTT;

[0080] IF3:AAGTGGCAAGGCAGGAGA;

[0081] IR3:CACCGCCCGTTACAAGTC;

[0082] 24 tails of each species were randomly selected for further verification. The results showed that in the ptprn2 gene, primer DF2 DR2 had low specificity in the dark puffer at the optimal annealing temperature, and it was difficult to terminate the DNA synthesis reaction after base mispairing, and ultimately produced erroneous amplification products; primer DF3 DR3 produced specific amplification products in both dark puffer and red puffer, but the product fragment lengths were similar, which made the interpretation of the results easy to cause errors; only DF1 DR1 primer had the strongest specificity in dark puffer compared with other primers. At the optimal annealing temperature, primer DR1 in dark puffer terminated the DNA synthesis reaction due to base mispairing, making amplification difficult, making the results easy to read and quickly identifying dark puffer from the other two species. In the rnf139 gene, primer IF2 IR2 had low specificity in redfin puffer and hybrid puffer at the optimal annealing temperature, and had a large number of nonspecific amplification products after base pairing, which reduced the binding efficiency of the primers to the target site and made the results difficult to interpret; when primer IF3 IR3 was used in combination with primer DF1 DR1, the two pairs of primers were prone to primer mispairing, and the primers combined with each other, which reduced the binding efficiency of the primers to the target site and made the results difficult to interpret; only the IF1IR1 primer, compared with other primers, not only had specific products with the three species, but also had a lower binding efficiency with the DF1 DR1 primer in the multi-primer system, and the mutual influence between the two pairs of primers was low, which ultimately made the results of the multi-primer identification method easy to read and highly accurate.

Claims

1. A molecular marker for identifying dark-striped pufferfish, redfin pufferfish and hybrid pufferfish, characterized in that: The molecular markers are InDel markers in the species genome, and the base sequences of the InDel markers are shown as SEO ID NO.1-2 respectively.

2. A specific primer pair for identifying dark-striped pufferfish, red-finned pufferfish and hybrid pufferfish, characterized in that: The specific primer pair includes primer pair 1 or primer pair 2 or primer pair 1 and primer pair 2. The base sequences of primer pair 1 are shown in SEO ID NO.3-4, and the base sequences of primer pair 2 are shown in SEO ID NO.5-6: SEO ID NO.3: DF1CTCCGACTTCAGGACCGTATCA; SEO ID NO.4: DR1GGCGACGCTGACACAAGAGA, SEO ID NO.5: IF1GGCAAGGCAGGAGAGCAGTA; SEO ID NO.6: IR1GCTTCCACAATTACAATTATTATACACA.

3. The specific primer pair for identifying the dark-striped pufferfish, redfin pufferfish and hybrid pufferfish according to claim 2, characterized in that: The specific primer pair is preferably primer pair 1 and primer pair 2, the base sequences of primer pair 1 are shown in SEO ID NO.3-4, and the base sequences of primer pair 2 are shown in SEO ID NO.5-6: SEO ID NO.3: DF1CTCCGACTTCAGGACCGTATCA; SEO ID NO.4: DR1GGCGACGCTGACACAAGAGA, SEO ID NO.5: IF1GGCAAGGCAGGAGAGCAGTA; SEO ID NO.6: IR1GCTTCCACAATTACAATTATTATACACA.

4. A kit for identifying dark-striped pufferfish, red-fin pufferfish and hybrid pufferfish, characterized in that: The method comprises the specific primer according to claim 2.

5. Use of the specific molecular marker according to claim 1 as an identification and detection marker in identifying dusky pufferfish, redfin pufferfish and hybrid pufferfish.

6. Use of the primer pair according to claim 2 or the kit according to claim 3 in identifying dusky pufferfish, redfin pufferfish and hybrid pufferfish.

7. The use according to claim 5, characterized in that: The method for identifying the dark-striped pufferfish, red-finned pufferfish and hybrid pufferfish comprises: extracting DNA of the dark-striped pufferfish, red-finned pufferfish and hybrid pufferfish to be identified as templates, performing multiple PCR amplification with specific primer pair 1 or primer pair 2 or primer pair 1 and 2, and performing identification according to the difference in the number or length of the obtained product fragments.

8. The use according to claim 7, characterized in that: The multiplex PCR amplification reaction system comprises 10 μl of 2×Rapid Taq Master Mix, 4 μl of specific primers (50 ng / primer), 5 μl of ddH2O, and 1 μl of DNA template (50 ng / sample).

9. The use according to claim 6, characterized in that: The multiplex PCR amplification reaction program is 95°C pre-denaturation for 5 minutes; then 95°C denaturation for 30 seconds, 61°C annealing for 30 seconds, 72°C extension for 30 seconds, and 15 amplification cycles under this program; then 95°C denaturation for 30 seconds, 55°C annealing for 30 seconds, 72°C extension for 30 seconds, and 15 amplification cycles under this program; finally 72°C extension for 5 minutes to end the amplification program.

10. The use according to claim 6, characterized in that: Through agarose gel electrophoresis, after specific primers combined with samples for amplification, a 275bp specific amplification band appeared in the dark-striped pufferfish; There were two specific amplification bands of 320bp and 246bp in redfin pufferfish, and three specific amplification bands of 320bp, 275bp and 246bp in hybrid pufferfish.

Images