A detection kit and detection method for Streptococcus pyogenes

Abstract

The present invention relates to the technical field of rapid molecular detection, and provides a detection kit and a detection method for Streptococcus pyogenes. The detection method provided by the present invention comprises using a multiple cross-displacement amplification method, using MCDA primers to perform an amplification reaction on the DNA of a sample to be tested, and preparing an amplification product; a restriction endonuclease recognizes and cuts the restriction endonuclease recognition sequence, releases a fluorescent quenching group, and emits a fluorescent signal; and the fluorescent signal is detected to detect the Streptococcus pyogenes. The detection method provided by the present invention is rapid, highly sensitive, and highly specific, can reduce dependence on precision instruments, is easy to operate, and the results can be read intuitively, is not limited by the site, and can improve the early detection rate of GAS.

Description

Technical Field

[0001] The present invention relates to the technical field of rapid molecular detection, and in particular to a detection kit and a detection method for Streptococcus pyogenes. Background Art

[0002] Streptococcus pyogenes, also known as Group A Streptococcus (GAS), is the most common bacterial cause of acute pharyngitis, accounting for about 20-30% of pediatric pharyngitis cases and 5-15% of adult pharyngitis cases. In addition, GAS pharyngitis may lead to suppurative complications, including otitis media, peritonsillar abscess, skin infection, etc., and may also develop into more serious invasive infections (iGAS), such as pneumonia, streptococcal toxic shock syndrome (STSS) and necrotizing fasciitis. GAS pharyngitis may also lead to post-infection sequelae, including acute post-streptococcal glomerulonephritis, acute rheumatic fever and rheumatic heart disease (RHD). People of all ages are generally susceptible to GAS, especially children, as well as pregnant women and the elderly. The Infectious Diseases Society of America (IDSA) pointed out that GAS pharyngitis is the only common acute pharyngitis with clear indications for antimicrobial treatment. Since GAS pharyngitis is similar to viral pharyngitis and pharyngitis caused by other causes in terms of symptoms and signs, GAS pharyngitis cannot be accurately diagnosed based on symptoms and signs alone, which may lead to unnecessary clinical testing and excessive use of antibiotics, resulting in an increased risk of drug resistance, worsening patient prognosis, and waste of medical resources. Therefore, timely, rapid, and accurate diagnosis of GAS pharyngitis is of great significance for its clinical treatment, follow-up management, rational use of antibiotics, and control of bacterial resistance.

[0003] Currently, the traditional culture diagnosis method remains the gold standard for laboratory diagnosis of S. pyogenes. However, it is time-consuming (24-48 hours waiting period) and complicated to operate. Rapid antigen detection test (RADT) provides a method for rapid identification of S. pyogenes, but its relatively low sensitivity (70-90%) and the requirement to confirm negative results by culture test limit its application. Although the traditional PCR method has high sensitivity and specificity, it is highly dependent on complex thermal cycling equipment and cumbersome procedures, which limits its widespread application.

[0004] Therefore, a rapid, highly sensitive, and easy-to-use diagnostic method is needed to detect S. pyogenes. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides a detection kit and a detection method for Streptococcus pyogenes.

[0006] In a first aspect, the present invention provides a detection kit for Streptococcus pyogenes, the detection kit comprising: MCDA primers and restriction enzymes; The MCDA primers include a displacement primer pair, a cross primer pair, a first amplification primer pair, a second amplification primer pair, and a third amplification primer pair; in: The replacement primer pair includes a forward replacement primer F1 whose sequence is shown as SEQ ID NO.1 and a reverse replacement primer F2 whose sequence is shown as SEQ ID NO.2; The cross primer pair includes a forward cross primer CP1 whose sequence is shown in SEQ ID NO.3 and a reverse cross primer CP2 whose sequence is shown in SEQ ID NO.4; The first amplification primer pair includes a first reverse amplification primer D1 having a sequence as shown in SEQ ID NO.5 and a first forward amplification primer D2 having a sequence as shown in SEQ ID NO.6, and a restriction endonuclease recognition sequence and a fluorescence quenching group labeled with a fluorescent group are linked to the 5' end of the first reverse amplification primer D1; The second amplification primer pair includes a second reverse amplification primer C1 whose sequence is shown in SEQ ID NO.7 and a second forward amplification primer C2 whose sequence is shown in SEQ ID NO.8; The third amplification primer pair includes a third reverse amplification primer R1 whose sequence is shown as SEQ ID NO.9 and a third forward amplification primer R2 whose sequence is shown as SEQ ID NO.10.

[0007] As a preferred technical solution of the present invention, the detection kit further comprises: 2× reaction buffer, Bst 2.0 DNA polymerase, and double-distilled water; The reaction buffer is tris(hydroxymethyl)aminomethane hydrochloride, KCl, MgSO 4 NH 4 ) 2 SO 4 , a mixture of polyoxyethylene sorbitan monolaurate, (carboxymethyl) trimethylamine inner salt and deoxyribonucleotides.

[0008] As a preferred technical solution of the present invention, the restriction endonuclease recognition sequence is TGCAATG.

[0009] As a preferred technical solution of the present invention, the fluorescent group is FAM, and the fluorescence quenching group is BHQ1.

[0010] As a preferred technical solution of the present invention, the kit consists of the following components: (1) McdA primer; (2) Nb. Bsr DI restriction enzyme; (3) 2× reaction buffer; (4) Bst 2.0 DNA polymerase; (5) Double distilled water.

[0011] In a second aspect, the present invention provides a method for detecting Streptococcus pyogenes using the kit described in the first aspect, the detection method comprising the following steps: The multiple cross-displacement amplification method is used to amplify the DNA of the sample to be tested using MCDA primers to prepare an amplification product; The restriction endonuclease recognizes and cuts the restriction endonuclease recognition sequence, releasing the fluorescent quenching group and emitting a fluorescent signal; The fluorescent signal is detected to detect the Streptococcus pyogenes.

[0012] As a preferred technical solution of the present invention, the detection method comprises: DNA of the sample to be tested, MCDA primers, Nb. Bsr A mixture of DI restriction endonuclease, 2× reaction buffer, Bst 2.0 DNA polymerase and double distilled water was reacted at 59-68°C.

[0013] As a preferred technical solution of the present invention, the mixed solution is reacted at 63° C. for 40 min.

[0014] As a preferred technical solution of the present invention, the method for detecting fluorescence signals includes: using a real-time fluorescence system to detect fluorescence values, and setting the real-time fluorescence system to detect and record once every 0.5-2 minutes.

[0015] As a preferred technical solution of the present invention, the detection of the Streptococcus pyogenes by detecting the fluorescent signal includes: The real-time fluorescence system is used to record the fluorescence value once a minute and form an amplification curve to detect Streptococcus pyogenes.

[0016] The technical solution provided by the embodiment of the present invention has the following advantages compared with the prior art: In the present invention, the MCDA amplification technology is combined with the real-time fluorescence detection technology, that is, the present invention introduces fluorescent markers during the MCDA amplification process, and realizes dynamic monitoring of the target nucleic acid by accumulating the intensity of the fluorescence signal. The detection kit and detection method provided by the present invention only need to be fed once at the initial stage of the detection to realize the detection of the sample to be tested. During the reaction process, there is no need to open the reaction tube, which reduces the risk of contamination of the product. At the same time, the real-time fluorescence detection technology is used to avoid human errors in visual detection. In addition, the detection time of the kit and detection method provided by the present invention is short. The detection kit and detection method provided by the present invention can realize dynamic monitoring of the target nucleic acid by accumulating the intensity of the fluorescence signal, and have the advantages of high sensitivity, high specificity, strong objectivity and easy operation. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the invention and, together with the description, serve to explain the principles of the invention.

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, for ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative labor.

[0019] Figure 1 This is a schematic diagram of the principle of the detection method described in an embodiment of the present invention; Figure 2 A simplified schematic diagram of the detection method according to an embodiment of the present invention; Figure 3 This is a schematic diagram of the location of the MCDA primer binding site in the target gene SpeB of Streptococcus pyogenes described in an embodiment of the present invention; Figure 4 is a curve diagram showing the change of turbidity over time in MCDA amplification using D1 as the first reverse amplification primer; Figure 5 This is a graph showing the experimental results of optimizing reaction conditions in performance testing; Figure 6 This is a sensitivity evaluation diagram for the detection method in the performance test; Figure 7 A test result diagram for evaluating the specificity of the test method in performance testing; Figure 8 This is a graph showing the experimental results of using the detection kit and detection method provided by the present invention for clinical sample verification. DETAILED DESCRIPTION

[0020] In order to more clearly understand the above-mentioned objectives, features and advantages of the present invention, the scheme of the present invention will be further described below. It should be noted that the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

[0021] In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention may also be implemented in other ways different from those described herein; it is obvious that the embodiments in the specification are only part of the embodiments of the present invention, rather than all of the embodiments.

[0022] Patent CN104946744A discloses an isothermal nucleic acid amplification technology named multiple cross displacement amplification (MCDA). MCDA amplification technology can be carried out at a constant temperature by simple equipment such as a water bath, without the need for complex and expensive equipment such as a thermal cycler. The amplification system only requires a constant temperature displacement enzyme, and nucleic acid amplification can be achieved within 40 minutes. It has the advantages of fast and efficient amplification reaction, high sensitivity, high specificity and low cost. In the MCDA system, there are 10 primers to identify the target sequence, including a pair of cross primers (CP1 and CP2), a pair of displacement primers (F1 and F2) and 3 pairs of amplification primers (D1, C1, R1, D2, C2 and R2), which can accurately hybridize the target sequence and provide high specificity. Conventional methods for detecting MCDA amplification products mainly include visualization methods such as lateral flow biosensors (LFB) or visual detection reagents (VDR), which have the advantages of simple operation and intuitive results. However, visualization methods require the use of naked eye to observe color changes for judgment, and cannot be completely objective in evaluation and detection. At the same time, the LFB test requires opening the reaction tube after the MCDA amplification reaction for detection, which is easy to introduce aerogel contamination of the product, thereby affecting the accuracy of the detection.

[0023] In the present invention, MCDA amplification technology is combined with real-time fluorescence detection technology to construct a highly sensitive and highly specific detection method for GAS, that is, the present invention introduces fluorescent markers during the MCDA amplification process to achieve dynamic monitoring of target nucleic acids through the accumulation of fluorescence signal intensity. The detection method and detection kit provided by the present invention not only retain the high efficiency of MCDA amplification, but also overcome the limitations of traditional detection methods such as MCDA-LFB in terms of objectivity, operational complexity and contamination risks. The detection method provided by the present invention is simple, fast and efficient, and provides a better solution for the detection of GAS, and is expected to become a real-time diagnostic method for GAS detection.

[0024] The detection kit and detection method provided by the present invention only need to be kept at a constant temperature to complete the reaction, without relying on expensive and complex thermal cycle instruments; and only one feeding is required at the initial stage of the detection to realize the detection of the sample to be tested. During the reaction process, the reaction tube does not need to be opened, which reduces the exposure to the product, reduces the risk of contamination, improves the repeatability of the experiment and the safety of operation, and the one-step detection method is simple to operate and suitable for promotion; at the same time, the real-time fluorescence detection technology is used to monitor the fluorescence signal in the amplification process in real time, improves the detection accuracy, and avoids the human error of visual detection; and the detection time of the kit and detection method provided by the present invention is short, and the detection kit and detection method provided by the present invention can realize the dynamic monitoring of the target nucleic acid by the accumulation of the fluorescence signal intensity, and has the advantages of high sensitivity, high specificity, strong objectivity and simple operation, specifically: The present invention combines MCDA amplification technology with real-time fluorescence detection technology to provide a detection method for Streptococcus pyogenes, which can be used for rapid detection of Streptococcus pyogenes. The principle schematic diagram of the detection method is shown in Figure 1 , which is achieved through the following steps, the flowchart of the steps is shown in Figure 2 : The speB gene (encoding exotoxin B of cysteine ​​protease) of GAS was amplified using MCDA amplification technology to obtain the target gene product; Restriction endonucleases (Nb. Bsr DI) recognizes and cuts the restriction endonuclease recognition sequence, releases the fluorescence quenching group, and emits a fluorescent signal; The detection of the Streptococcus pyogenes is achieved by reporting the fluorescence signal through a real-time fluorescence detection system.

[0025] In the detection method provided by the present invention, a set of MCDA amplification primers is designed for the speB gene of GAS, and through certain reaction conditions, efficient, sensitive and specific detection of GAS is achieved. Compared with the existing VDR, LFB and other detection methods, the present invention uses real-time fluorescence detection technology, without the need for post-amplification processing, that is, a one-step operation to achieve detection of target DNA, which can reduce the risk of contamination and improve detection efficiency.

[0026] The detection method provided by the present invention uses the detection kit for Streptococcus pyogenes provided by the present invention, and the detection kit comprises: (1) McdA primer; (2) Nb. Bsr DI restriction enzyme; (3) 2× reaction buffer; (4) Bst 2.0 DNA polymerase; (5) Double distilled water.

[0027] For (1) MCDA primer, the schematic diagram of the location of the MCDA primer binding site in the target gene SpeB of Streptococcus pyogenes is shown in Figure 3 : The MCDA primers include a displacement primer pair, a cross primer pair, a first amplification primer pair, a second amplification primer pair and a third amplification primer pair; in: The replacement primer pair includes a forward replacement primer F1 whose sequence is shown as SEQ ID NO.1 and a reverse replacement primer F2 whose sequence is shown as SEQ ID NO.2; The cross primer pair includes a forward cross primer CP1 whose sequence is shown in SEQ ID NO.3 and a reverse cross primer CP2 whose sequence is shown in SEQ ID NO.4; The first amplification primer pair includes a first reverse amplification primer D1 having a sequence as shown in SEQ ID NO.5 and a first forward amplification primer D2 having a sequence as shown in SEQ ID NO.6, and a restriction endonuclease recognition sequence and a fluorescence quenching group (denoted as D1') labeled with a fluorescent group are linked to the 5' end of the first reverse amplification primer D1; The second amplification primer pair includes a second reverse amplification primer C1 whose sequence is shown in SEQ ID NO.7 and a second forward amplification primer C2 whose sequence is shown in SEQ ID NO.8; The third amplification primer pair includes a third reverse amplification primer R1 whose sequence is shown as SEQ ID NO.9 and a third forward amplification primer R2 whose sequence is shown as SEQ ID NO.10.

[0028] As a preferred technical solution of the present invention, the restriction endonuclease recognition sequence is TGCAATG.

[0029] As a preferred technical solution of the present invention, the fluorescent group is FAM, and the fluorescence quenching group is BHQ1.

[0030] In the kit defined in the present invention, the first reverse primer sequence in the MCDA primer is actually D1' in order to meet the subsequent real-time monitoring requirements using fluorescence detection technology; D1' is D1 with a restriction endonuclease recognition sequence introduced at its 5' end, and a fluorescent group is labeled at the 5' end of the sequence, and a fluorescent quenching group is labeled in the middle of the sequence.

[0031] The sequence of the MCDA primer is specifically shown in Table 1: Table 1

[0032] As a preferred technical solution provided by the present invention, in the detection kit, the concentrations of MCDA primers for the speB gene are: 0.4 μM for F1 and F2, 1.6 μM for CP1 and CP2, and 0.8 μM for D1', D2, C1, C2, R1, and R2.

[0033] For (2) Nb. Bsr DI restriction enzyme: As a preferred technical solution provided by the present invention, in the detection kit, the restriction endonuclease (Nb. Bsr The concentration of DI is 1.0 μL.

[0034] Restriction endonucleases (Nb. Bsr DI) can recognize and cut the restriction endonuclease sequence between the fluorescent group and the fluorescent quencher group, release the quencher group, and obtain the fluorescent signal.

[0035] When the sample DNA is amplified using the MCDA amplification technology, a large number of amplicons containing restriction endonuclease recognition sequences will be generated while the target DNA is amplified. The restriction endonuclease (Nb. Bsr DI) then cuts the resulting amplicon, causing the quencher group BHQ1 to be released. The fluorescence signal will increase with the increase of the amplified product. The fluorescence signal can be monitored in real time by a fluorescence detector to obtain an amplification curve, thereby realizing the detection and analysis of the target sequence.

[0036] For (3) 2× reaction buffer: the reaction buffer is tris(hydroxymethyl)aminomethane hydrochloride, KCl, MgSO 4 NH 4 ) 2 SO 4 , a mixture of polyoxyethylene sorbitan monolaurate, (carboxymethyl) trimethylamine inner salt and deoxyribonucleotides.

[0037] As a preferred technical solution of the present invention, the composition of the 2× reaction buffer is: 40 mM Tris-HCl (pH 8.8), 20 mM KCl, 16 mM MgSO 4 , 20 mM (NH 4 ) 2 SO 4 , 0.2% polyoxyethylene sorbitan monolaurate (Tween-20), 1.6 M (carboxymethyl) trimethylamine salt (Betaine), 2.8 mM / each deoxyribonucleotide (dNTPs).

[0038] As a preferred technical solution provided by the present invention, in the detection kit, the concentration of 2× reaction buffer is 12.5 μL.

[0039] As a preferred technical solution provided by the present invention, in the detection kit, the concentration of Bst 2.0 DNA polymerase is 1.0 μL.

[0040] As a preferred technical solution provided by the present invention, the detection kit system is 25 μL.

[0041] As a preferred technical solution provided by the present invention, when using the detection kit, the concentration of the sample to be tested is 1.0 μL.

[0042] The detection kit provided by the present invention can help to quickly and accurately identify GAS pharyngitis, thereby timely guiding the rational application of antibiotic treatment and avoiding the use of antibiotics for patients with non-streptococcal pharyngitis.

[0043] As a preferred technical solution of the present invention, the detection method is carried out using the detection kit, and the detection method comprises: DNA of the sample to be tested, MCDA primers, Nb. Bsr A mixture of DI restriction endonuclease, 2× reaction buffer, Bst 2.0 DNA polymerase and double distilled water was reacted at 59-68°C.

[0044] As a preferred technical solution of the present invention, the mixed solution is reacted at 63° C. for 40 min.

[0045] As a preferred technical solution of the present invention, the method for detecting fluorescence signals includes: using a real-time fluorescence system to detect fluorescence values, and setting the real-time fluorescence system to detect and record once every 0.5-2 minutes.

[0046] As a preferred technical solution of the present invention, the detection of the Streptococcus pyogenes by detecting the fluorescent signal includes: The real-time fluorescence system is used to record the fluorescence value once a minute and form an amplification curve to detect Streptococcus pyogenes.

[0047] When the mixture is reacted at a certain temperature, on the one hand, the MCDA amplification technology amplifies the target product to generate a large number of amplicons containing restriction endonuclease recognition sequences, and at the same time, the restriction endonuclease (Nb. Bsr DI) recognizes a specific sequence (restriction endonuclease recognition sequence) to cut the amplicon, which can release a fluorescent signal. As the amplification reaction proceeds, the fluorescent signal begins to accumulate. By regularly detecting the fluorescent signal, the amplification curve can be obtained, thereby realizing the detection of Streptococcus pyogenes.

[0048] If the target product is present in the analyte, the restriction endonuclease (Nb. Bsr DI) recognizes specific sequences and emits a fluorescent signal that is monitored by a real-time fluorescence detection system; if the target product does not exist in the analyte, the restriction endonuclease (Nb. Bsr DI) has no specific identifiable sequence and cannot be cut, i.e. no fluorescent signal is released.

[0049] The detection method and detection kit provided by the present invention can solve the shortcomings of existing detection technologies, have rapidity, high sensitivity and high specificity, can reduce the dependence on precision instruments, are easy to operate, the results can be read intuitively, are not restricted by the site, and can improve the early detection rate of GAS. The detection method provided by the present invention is easy to use and has broad application prospects.

[0050] Example 1 This example provides a MCDA primer for amplifying genomic DNA of Streptococcus pyogenes.

[0051] MCDA primers include a replacement primer pair F1 and F2, a cross primer pair CP1 and CP2, a first amplification primer pair D1 and D2, a second amplification primer pair C1 and C2, and a third amplification primer pair R1 and R2. The specific sequences are shown in Table 1.

[0052] Performance testing: evaluation of the effectiveness of MCDA primers and optimization of reaction conditions Streptococcus pyogenes The standard strain of Streptococcus pyogenes was cultured in a blood agar dish for 18-24 hours, and the culture conditions were observed and the colonies were identified. The cultured colonies were used to extract the GAS genomic DNA. The concentration and purity of the genomic DNA were determined using an ultraviolet spectrophotometer. The genomic DNA of GAS was diluted continuously (1 ng, 100 pg, 10 pg, 1 pg, 100 fg, 50 fg, 25 fg). Small amounts were aliquoted and stored at -20°C for later use in performance analysis.

[0053] (1) Effectiveness evaluation: Actual composition of the McdA amplification reaction: 25 μL reaction system: MCDA primers F1 and F2 are 0.4 μM each, CP1 and CP2 are 1.6 μM each, D1, D2, C1, C2, R1, R2 are 0.8 μM each; 12.5 μL 2× reaction buffer; 1.0 μL Bst 2.0 DNA polymerase; 8.3 μL double distilled water and 1.0 μL nucleic acid sample to be tested; Positive control: GAS genomic DNA; Negative control: double distilled water; Reaction conditions: reaction at 63°C; Detection instrument: Use turbidimeter (LA-320C) to analyze the turbidity curve of the kinetic changes of the amplification reaction; The results are as follows: Figure 4 It is a curve diagram of the turbidity change of MCDA amplification over time; it can be seen from the figure that the MCDA primers provided by the present invention are used for MCDA amplification at a fast speed and excellent amplification efficiency, that is, the MCDA primers provided by the present invention can be used for efficient amplification of the reaction.

[0054] (2) Optimization of amplification reaction temperature: This experiment set 8 constant temperatures ranging from 60-67°C with an interval of 1°C. The MCDA reaction system was evaluated for effectiveness. The DNA template concentration used was 10 pg. Double distilled water was used as a blank control. A turbidity curve analysis of the kinetic changes of the amplification reaction was performed using a turbidity meter (LA-320C). The results are as follows: Figure 5 This is the experimental result diagram of the optimization of reaction conditions in the performance test. It can be seen from the figure that when the temperature is 63°C, the amplification efficiency is better than other temperatures.

[0055] Example 2 This embodiment provides a detection kit and a detection method for Streptococcus pyogenes.

[0056] The detection kit consists of MCDA primers F1 and F2 at 0.4 μM each, CP1 and CP2 at 1.6 μM each, D1', D2, C1, C2, R1, R2 at 0.8 μM each; 1.0 μL Nb. Bsr DI restriction endonuclease; 12.5 μL 2× reaction buffer; 1.0 μL Bst2.0 DNA polymerase; 7.3 μL double distilled water. During the test, 1.0 μL of the nucleic acid sample to be tested was added, and the total reaction system was 25 μL.

[0057] Detection methods include: (1) Extraction of genomic DNA and preparation of clinical samples Genomic DNA was extracted using the EasyPure Bacterial Genomic DNA Kit (Enzymatic Hydrolysis) DNA Extraction Kit according to the instructions.

[0058] (2) McdA amplification reaction The reaction system was reacted at 63 °C for 40 min; (3) Detection The ABI 7500 real-time fluorescence system was set to detect and record the fluorescence value of the reaction system once every minute.

[0059] Performance testing: sensitivity, specificity, and clinical sample validation (1) Sensitivity Streptococcus pyogenes The standard strain of Streptococcus pyogenes was cultured in a blood agar dish for 18-24 hours, and the culture conditions were observed and the colonies were identified. The cultured colonies were used to extract the GAS genomic DNA. The concentration and purity of the genomic DNA were determined using an ultraviolet spectrophotometer. The genomic DNA of GAS was diluted continuously (1 ng, 100 pg, 10 pg, 1 pg, 100 fg, 50 fg, 25 fg). The samples were aliquoted in small amounts and stored at -20°C for later use.

[0060] During the sensitivity evaluation process, D1'' was used for LFB reaction, and D1'' was linked to FAM at the 5' end of D1: 5'-FAM-TACCAACATCAGCCATCA.

[0061] The genomic DNA template was diluted serially to concentrations of 1 ng, 100 pg, 10 pg, 1 pg, 100 fg, 50 fg, and 25 fg. 1 µL of each diluted template was added to the reaction system, and distilled water was set as a blank control. The experimental results were determined by a real-time fluorescence instrument. The results are as follows: Figure 6 : This is a sensitivity evaluation graph for the detection method. It can be seen from the figure that when the concentration of the reaction tube is 50 fg and above, obvious fluorescence signals can be detected, and no fluorescence signals are detected in the 25 fg and blank control groups, that is, the detection method provided by the present invention can detect genomic DNA of pure cultured GAS as low as 50 fg; the concentrations of the DNA templates 1-7 in the figure are represented as 1 ng, 100 pg, 10 pg, 1 pg, 100 fg, 50 fg, and 25 fg, respectively, and curve 8 is a negative control.

[0062] (2) Using DNA templates of common pathogens and other pathogens of conditional pathogens to evaluate the specificity of the detection method Using the detection method provided by the present invention, nucleic acid detection was performed on 3 GAS samples and 29 non-GAS extracted nucleic acid templates. The pathogen information used is shown in Table 2: Table 2

[0063] Note: CIP: Capital Institute of Pediatrics; ICDC: Chinese Center for Disease Control and Prevention.

[0064] The test results are as follows: Figure 7This is a test result diagram for evaluating the specificity of the detection method. It can be seen from the figure that positive results can only be observed in the test tube containing GAS genomic DNA, while negative results always appear in the reaction tubes other than GAS; this result shows that the detection method provided by the present invention performs well in the specific detection of GAS and meets the standards and requirements of practical applications.

[0065] (3) Evaluation of the practicality of the detection method in clinical sample testing using 56 throat swab samples from patients with clinically suspected bacterial pharyngitis 56 pharyngeal swabs of suspected bacterial pharyngitis were collected from the Children's Hospital affiliated to Capital Institute of Pediatrics. The collected samples were first extracted with nucleic acid using the EasyPure Bacterial Genomic DNA Kit (Enzymatic Hydrolysis) DNA Extraction Kit, and then tested using the detection kit and detection method provided in the embodiment; at the same time, in order to verify the accuracy of the method, these clinical samples were tested using the LFB method and the traditional PCR method, and the results were compared with the results of the detection method provided by the present invention, wherein: The upstream and downstream primer sequences and fluorescent probe sequences of PCR are as follows: speB-F: CGCACTAAACCCTTCAGCTCTT (SEQ ID NO. 11); speB-R: ACAGCACTTTGGTAACCGTTGA (SEQ ID NO. 12); speB-Probe: FAM-GCCTGCGCCGCCACCAGTA-BHQ1 (SEQ ID NO. 13).

[0066] The results of LFB and PCR are shown in Table 3: Table 3

[0067] The experimental results of the detection kit and detection method provided by the present invention for clinical sample verification are shown in FIG. Figure 8 ,Depend on Figure 8 It can be seen that a total of 28 positive and 28 negative samples were detected, and the results were completely consistent with the detection results of LFB and PCR. Therefore, the detection method and detection kit provided by the present invention can accurately reflect the infection status of clinical samples.

[0068] It can be seen from the examples and performance tests that the detection kit and detection method provided by the present invention have high accuracy, the lower limit of GAS that can be detected is 50 fg, the specificity reaches 100%, and the detection time is short. The entire detection process including MCDA amplification and real-time fluorescence result interpretation can be completed within 40 min, which can quickly help make a judgment on suspected GAS.

[0069] It should be noted that, in this article, relational terms such as "first" and "second" are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Moreover, the terms "include", "comprise" or any other variants thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device. In the absence of further restrictions, the elements defined by the sentence "comprise a ..." do not exclude the existence of other identical elements in the process, method, article or device including the elements.

[0070] The above description is only a specific embodiment of the present invention, so that those skilled in the art can understand or implement the present invention. Various modifications to these embodiments will be apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments described herein, but should conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A detection kit for Streptococcus pyogenes, characterized in that, The detection kit comprises: MCDA primers and restriction enzymes; The MCDA primers include a displacement primer pair, a cross primer pair, a first amplification primer pair, a second amplification primer pair, and a third amplification primer pair; in: The replacement primer pair includes a forward replacement primer F1 whose sequence is shown as SEQ ID NO.1 and a reverse replacement primer F2 whose sequence is shown as SEQ ID NO.2; The cross primer pair includes a forward cross primer CP1 whose sequence is shown in SEQ ID NO.3 and a reverse cross primer CP2 whose sequence is shown in SEQ ID NO.4; The first amplification primer pair includes a first reverse amplification primer D1 having a sequence as shown in SEQ ID NO.5 and a first forward amplification primer D2 having a sequence as shown in SEQ ID NO.6, and a restriction endonuclease recognition sequence and a fluorescence quenching group labeled with a fluorescent group are linked to the 5' end of the first reverse amplification primer D1; The second amplification primer pair includes a second reverse amplification primer C1 whose sequence is shown in SEQ ID NO.7 and a second forward amplification primer C2 whose sequence is shown in SEQ ID NO.8; The third amplification primer pair includes a third reverse amplification primer R1 whose sequence is shown as SEQ ID NO.9 and a third forward amplification primer R2 whose sequence is shown as SEQ ID NO.

10.

2. The detection kit according to claim 1, characterized in that The detection kit also includes: 2× reaction buffer, Bst 2.0 DNA polymerase, and double-distilled water; The reaction buffer is a mixture of tris(hydroxymethyl)aminomethane hydrochloride, KCl, MgSO4, (NH4)2SO4, polyoxyethylene sorbitan monolaurate, (carboxymethyl)trimethylamine inner salt and deoxyribonucleotide.

3. The detection kit according to claim 2, characterized in that The restriction endonuclease recognition sequence is TGCAATG; And / or, the fluorescent group is FAM, and the fluorescence quenching group is BHQ1.

4. The detection kit according to any one of claims 1 to 3, characterized in that The detection kit is composed of the following components: (1) McdA primer; (2) Nb. Bsr DI restriction enzyme; (3) 2× reaction buffer; (4) Bst 2.0 DNA polymerase; (5) Double distilled water.

5. A method for detecting Streptococcus pyogenes using the detection kit according to any one of claims 1 to 4, characterized in that: The detection method comprises the following steps: The multiple cross-displacement amplification method is used to amplify the DNA of the sample to be tested using MCDA primers to prepare an amplification product; The restriction endonuclease recognizes and cuts the restriction endonuclease recognition sequence, releasing the fluorescent quenching group and emitting a fluorescent signal; The fluorescent signal is detected to detect the Streptococcus pyogenes.

6. The detection method according to claim 5, characterized in that: The detection method comprises: DNA of the sample to be tested, MCDA primers, Nb. Bsr A mixture of DI restriction endonuclease, 2× reaction buffer, Bst 2.0 DNA polymerase and double distilled water was reacted at 59-68°C.

7. The detection method according to claim 6, characterized in that: The mixture was reacted at 63°C for 40 min.

8. The detection method according to claim 5, characterized in that: The method for detecting the fluorescence signal includes: using a real-time fluorescence system to detect the fluorescence value, and setting the real-time fluorescence system to detect and record once every 0.5-2 minutes.

9. The detection method according to claim 8, characterized in that: The detecting of the fluorescent signal to detect the Streptococcus pyogenes comprises: The real-time fluorescence system is used to record the fluorescence value once a minute and form an amplification curve to detect Streptococcus pyogenes.

Images