Epigenetics editing system based on CRISPR / dCas9 targeted histone citrullination modification and application
By fusing PPAD and dCas9 proteins and combining gRNA guidance, citrulline modification of histones at specific genomic loci is achieved, solving the accuracy and flexibility of gene expression regulation in the prior art, and achieving precise regulation of gene transcription level.
Patent Information
- Application Number
- CN202311731795.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-15
- Publication Date
- 2025-06-17
AI Technical Summary
The prior art is difficult to achieve precise regulation of histone citrulline modifications at specific genomic loci, which limits the accuracy and flexibility of gene expression regulation.
By fusing peptidyl arginine deiminease PPAD with the dCas9 protein that removes nuclease activity, the recombinant protein PPAD-dCas9 is constructed, and the complex is guided to target specific DNA sites using gRNA to achieve citrulline modification of histones.
Accurate citrulline modification of histones at specific genomic loci is achieved, regulating chromatin status and epigenetic structure, and ultimately affecting the mRNA transcription level of the target loci genes.
Smart Images

Figure BDA0004610456620000091 
Figure HDA0004610456630000011 
Figure HDA0004610456630000012
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and particularly relates to a coding system based on a CRISPR / dCas9 vector, and more particularly to an epigenetic editing system based on CRISPR / dCas9 targeting histone citrullination modification and its application. Background Art
[0002] Histones have many post-translational modifications that affect chromatin compaction and accessibility in different ways. These modifications include acetylation, methylation, phosphorylation, ubiquitination, sumoylation, ADP-ribosylation, and citrullination, etc., which provide a way to transiently alter nucleosome dynamics by changing histone-DNA or histone-histone interactions.
[0003] Histone citrullination modification is an emerging histone modification method that catalyzes the conversion of positively charged arginine and methylarginine residues into neutrally charged citrulline. This conversion process affects protein function and changes protein-protein and protein-nucleic acid interactions. The protein citrullination reaction is mainly catalyzed by peptidylarginine deiminase (PAD). According to existing reports, five highly conserved PAD enzymes (I-IV and VI) have been found in mammals so far, and their activities depend on Ca 2+ activation (Fuhrmann J, C.K., Thompson PR (2015 Jun 10). Chemical biology of protein arginine modifications in epigenetic regulation. Chem Rev 115, 5413-5461.). In addition, enzymes with the ability to catalyze protein citrullination modification have also been found in bacteria. For example, peptidylarginine deiminase (PPAD) found in Porphyromonas gingivalis is somewhat similar to human PAD in sequence and structure, but its catalytic mechanism is very different from that of human PAD. For example, the catalytic activity of this enzyme does not require Ca 2+Activation Montgomery, A. B., Kopec, J., Shrestha, L., Thezenas, M.-L., Burgess-Brown, N. A., Fischer, R., Yue, W. W., and Venables, P. J. (2016). Crystal structure of Porphyromonas gingivalis peptidylarginine deiminase: implications for autoimmunity in rheumatoid arthritis. Annals of the Rheumatic Diseases 75, 1255-1261.).
[0004] Citrullination modification plays important functions on both histones and non-histones, including regulating gene expression, chromatin structure, and cell signaling, as well as participating in protein interactions and cell physiological processes. However, its role in regulating gene expression and cell functions still needs to be further studied. Related studies have demonstrated the association between citrullination modification and the binding of transcription factors, chromatin structure remodeling, and the establishment of gene regulatory networks (Akhtar, A., Zhang, X., Gamble, M. J., Stadler, S., Cherrington, B. D., Causey, C. P., Thompson, P. R., Roberson, M. S., Kraus, W. L., and Coonrod, S. A. (2011). Genome-Wide Analysis Reveals PADI4 Cooperates with Elk-1 to Activate c-Fos Expression in Breast Cancer Cells. PLoS Genetics 7.). In the field of epigenetics, it is crucial to study more deeply the application of PAD enzyme-mediated gene regulation in physiology, and there will be a more comprehensive and accurate understanding of the functions and regulatory mechanisms of the PAD enzyme family in different biological processes. Therefore, studying histone citrullination modification at specific genomic loci is of great significance for revealing the epigenetic modification code of the human genome.
[0005] Cas9 is an endonuclease isolated from the type II CRISPR-Cas bacterial adaptive immune system. By introducing inactivating mutations into the RuvC and HNH domains of Cas9, inactive dCas9 can be generated. dCas9 no longer has DNA cleavage ability but retains the function of binding to DNA (Jinek M, C.K., Fonfara I, Hauer M, Doudna JA, Charpentier E (2012 Aug 17). A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 812-836.). gRNA is an engineered nucleic acid fragment composed of a customized protospacer of 18-25 nucleotides and a constant region that complexes with dCas9. dCas9 binds to the target site of DNA by guiding gRNA to locate to the target sequence.
[0006] Through the guiding function of gRNA by dCas9, the technology of targeted binding to different target DNA sites is realized, which helps to direct the aggregation of transcriptional regulators and epigenomic modifiers to any genomic site. Based on this principle, theoretically, a multi-domain recombinant protein dCas9-PPAD can be constructed by fusing the dCas9 protein with a functional protein. Under the guiding effect of gRNA, this recombinant protein can bind to the DNA of any target site, thereby directly targeting the genomic nucleosome histone at this site for citrullination modification, so as to realize the regulation of the gene transcription level at the corresponding site. This system that regulates the transcription level of corresponding genes by changing different gRNA sequences to guide the citrullination modification of histones at different gene sites by dCas9-PPAD is called the histone citrullination epigenetics editing system.
[0007] The histone citrullination editing system is a novel CRISPR / dCas9-based epigenetic modification tool, which is essentially different from the previously developed editing systems such as those based on acetylation, methylation, and phosphorylation modification enzymes, including differences in the regulatory mechanism and the selection of target genes. Therefore, developing a CRISPR / dCas9-based histone citrullination modification editing system can expand the scope of epigenetic modification regulation and provide new ideas and methods for studying the regulatory mechanisms of gene expression and epigenetic modification. Summary of the Invention
[0008] The present invention relates to an epigenetic editing system based on CRISPR / dCas9, which is specifically used for citrullination modification of histones at specific genomic loci. Specifically, by fusing the peptidylarginine deiminase PPAD with the nuclease - inactive dCas9 protein from Streptococcus pyogenes, an editing system element, namely the recombinant protein PPAD - dCas9, is created. This innovative editing system, with the guidance of the guide gRNA, binds complementarily to the DNA sequence of a specific target site in the genome, achieving precise targeting of specific genomic loci. At the target site, PPAD - dCas9 selectively realizes the citrullination modification of adjacent histones through the peptidylarginine deiminase activity of PPAD. This modification process regulates the chromatin state and epigenetic structure, ultimately achieving the regulation of the mRNA transcription level of the gene at the target site. This novel editing system shows potential application prospects in precisely controlling gene expression.
[0009] Accordingly, the present invention provides a fusion protein, which is formed by fusing peptidylarginine deiminase with the nuclease - removed dCas9 protein from Streptococcus pyogenes. Preferably, it further includes a nuclear localization sequence (constructed at the C - terminus and / or N - terminus of the fusion protein). More preferably, a linker peptide is also included between peptidylarginine deiminase and the nuclease - removed dCas9 protein from Streptococcus pyogenes.
[0010] The present invention further provides an expression cassette, which includes a promoter and the above - mentioned fusion protein operably linked thereto. Preferably, the promoter is the CMV promoter.
[0011] The present invention further provides a recombinant expression vector, which includes the above - mentioned expression cassette. Preferably, the starting vector of the recombinant expression vector is an expression vector suitable for mammalian cells.
[0012] The present invention particularly provides an epigenetic editing system for targeting histone citrullination modification based on CRISPR / dCas9, which consists of three parts: an anchoring element, a guiding element, and a modification effector element;
[0013] The anchoring element is the nuclease - inactive dCas9 protein from Streptococcus pyogenes with DNA - binding function;
[0014] The guiding element is gRNA, which contains a nucleotide sequence complementary to the target DNA sequence;
[0015] The modification effector element is the peptidylarginine deiminase effector protein PPAD of Porphyromonas gingivalis, and the modification is citrullination modification.
[0016] Specifically, the anchoring element, the guiding element, and the modifying effect element are co-constructed on a vector expressed in mammals, or the anchoring element and the modifying effect element are co-constructed in a vector expressed in mammals (preferably, it is the recombinant expression vector as described in claim 3), while the guiding element is constructed in another vector expressed in mammals for separate expression, and they are simultaneously transfected into mammalian cells during use;
[0017] Preferably, the vector expressed in mammals is a plasmid vector, more specifically, the pCDNA3.1(-) expression vector.
[0018] Preferably, the site targeted by the target DNA sequence is the promoter region. Preferably, the nucleotide sequence complementary to the target DNA sequence is 20 bp. Preferably, for the primer of the target DNA sequence, CACC- is added to the 5' end of the upstream primer, and AAAC- is added to the 3' end of the downstream primer to complete the restriction enzyme cutting site of Eco31I.
[0019] Specifically, the citrullination site is the histone H3R2 / 8 / 17 site.
[0020] The present invention provides the application of the epigenetic editing system described above in achieving histone citrullination modification at specific genomic sites in mammalian cells to regulate gene transcription.
[0021] Finally, the present invention also provides a method for achieving histone citrullination modification at specific genomic sites in mammalian cells to regulate gene transcription, which is characterized by including the following steps:
[0022] The first step: introducing the epigenetic editing system into the target mammal;
[0023] The second step: extracting RNA from the successfully transfected cells and verifying the activation effect of PPAD-dCas9 on the target gene by RT-qPCR.
[0024] Specifically, the mammalian system is HEK-293T cells; the target DNA sequence is selected from the promoter sequences of the MEP1B, SPDYA, LVRN, FAM184B, RILP, MUC13, and NCF2 genes.
[0025] The advantages of the present invention will be further clarified in the following specific embodiments. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] Figure 1A It is a schematic diagram for the construction of the PPAD-dCas9 vector;
[0027] Figure 1BPlasmid map of PPAD-dCas9;
[0028] Figure 1C Schematic diagram of the PPAD-dCas9 mutant vector;
[0029] Figure 2 Western Blot was used to verify the expression of the inactivated PPAD-dCas9 mutant;
[0030] Figure 3 Volcano plot of the differential gene distribution after HEK293T cells were transformed to express the PPAD protein. The abscissa in the figure represents the fold change in gene expression (log2FoldChange) in the treatment and control groups, and the ordinate represents the significance level of the gene expression difference (-log10padj) in the treatment and control groups. Upregulated genes are represented by red dots, and downregulated genes are represented by blue dots;
[0031] Figure 4A Schematic diagram of the original gRNA vector;
[0032] Figure 4B Plasmid map of gRNA;
[0033] Figure 5 RT-qPCR was used to verify the mRNA levels of eight upregulated genes;
[0034] Figure 6 CHIP-qPCR was used to verify the citrullination level of H3R2 / 8 / 17 at the MEP1B promoter;
[0035] Figure 7 Volcano plot of RNA-seq analysis of PPAD-dCas9 targeting the MEP1B promoter with non-targeting gRNA as a control. Detailed implementation method
[0036] The present invention is further described below in conjunction with the accompanying drawings for better understanding, but does not constitute a limitation to the invention.
[0037] Example 1. Construction of PPAD-dCas9 fusion protein and evaluation of histone citrullination ability
[0038] I. Construction of histone citrullination editing vector
[0039] Construct a fusion protein of histone citrullinase based on CRISPR / Cas9-related components, including PPAD-dCas9 and an inactivated mutant PPAD constructed by whole plasmid PCR method C351A-dCas9, and evaluate the ability of this fusion protein to citrullinate histones. The plasmids were transiently transfected into HEK-293T cells respectively, and it was verified by Western blot 48 hours after transfection that PPAD-dCas9 has the activity of citrullinating histones (H3R2 / 8 / 17).
[0040] 1. Construction of PPAD-dCas9 editing vector
[0041] 1) Cloning of PPAD gene: The PPAD gene (specifically Gene ID: 29256112 in this example) was synthesized by Genewiz (Suzhou) Inc. and ligated into the pCDNA3.1(-) vector digested with XbaI / EcoRI.
[0042] 2) Amplification of PPAD gene fragment: All plasmids constructed in this experiment were amplified for DNA fragments using the high-fidelity enzyme Phanta Super-Fidelity DNA Polymerase. The PCR reaction system was as follows: 2xPhanta Max Buffer 25 μL, dNTP Mix (10 mM each) 1 μL, each primer 2 μL, template 1 ng, Phanta Max Super-Fidelity DNA Polymerase 1 μL, and ddH2O was added up to 50 μL. The PCR reaction conditions were: first at 95°C for 3 min; then 95°C for 15 s, 58°C for 15 s, 72°C for 1 kb / 30 s, for 30 cycles; finally 72°C for 5 min.
[0043] 3) Enzyme digestion of vector and recovery and purification of products
[0044] The reaction system for preparing linearized vector by single enzyme digestion was as follows: 10xfast digest Buffer 3 μL, template (pCDNA-dCas9-T2A-EGFP) 1 μg, XhoI enzyme 1 μL, and ddH2O was added up to 30 μL. After preparation, it was incubated in a 37°C water bath for 2 h to completely linearize the vector. Then, 5 μL of the reaction product and the original plasmid were detected by 1% agarose gel electrophoresis at a constant voltage of 140 V for 20 minutes, and then identified using a gel imaging system. Then, the target fragment and the vector were purified using a DNA purification and recovery kit.
[0045] 4) Assembly of DNA fragment and vector
[0046] When the total pmol amount of the inserted fragment is three times that of the vector, the assembly efficiency can reach the optimum. The pmol number is calculated according to the length and quality of the fragment. The assembly reaction system is as follows: 0.3 pmol of DNA fragment, 0.1 pmol of vector, 10 μl of 2x Multif Seamless Assembly Mix, and ddH2O is added to 20 μl. React at 50 °C in a PCR instrument for 60 minutes. After the reaction, place it on ice and immediately transform; if transformation cannot be carried out in time, store it at -20 °C for long-term preservation.
[0047] Based on the principle of the citrullination editing system targeting the promoter, the amplified PPAD fragment of the citrullinase gene was assembled by Gibson and constructed into the plasmid vector (pCDNA-flag-NLS-dCas9-NLS-T2A-EGFP) that had been digested with XhoI alone. Nuclear localization signals (NLS) had been designed at the front and back ends of this plasmid template. In order to enable it to localize to the nucleus and more precisely locate the target site. At the same time, in order to more intuitively judge the efficiency of plasmid transfection into cells, green fluorescent protein (EGFP) was incorporated at the C-terminus and constructed with the cleavage gene T2A at its front end for separate expression in order to reduce the probability of misexpression. Therefore, a plasmid expressing the PPAD-dCas9 fusion protein was constructed, as Figure 1A shown in the schematic diagram of the construction of the PPAD-dCas9 vector, and Figure 1B the plasmid map shown.
[0048] The constructed fusion protein contains the nuclear localization amino acid sequence and the fusion protein linker XTEN80 linker sequence information as follows:
[0049] Nuclear localization peptide DNA sequence: cccaagaagaagaggaaggtg (SEQ ID NO: 1)
[0050] Nuclear localization peptide amino acid sequence: PKKKRKV (SEQ ID NO: 2)
[0051] Fusion protein linkerXTEN80 linker DNA sequence: ggagggccgagctctggcgcaccccccaccaagtggagggtctcctgccgggtccccaacatctactgaagaaggcaccagcgaatccgcaacgcccgagtcaggccctggtacctccac agaaccatctgaaggtagtgcgcctggttccccagctggaagccctacttccaccgaagaaggcacgtcaaccgaaccaagtgaaggatctgcccctgggaccagcactgaaccatctgag(SEQ ID NO: 3).
[0052] Fusion protein linker XTEN80 linker: GGPSSGAPPPSGGSPAGSPTSTEEGTSESATPESGPGTSTEPSEGSAPGSPAGSPTSTEEGTSTEPSEGSAPGTSTEPSE (SEQ ID NO: 4).
[0053] 2. Construction of PPAD-dCas9 mutation inactivation vector PPADm-dCas9 by full plasmid PCR
[0054] In order to construct a PPAD-dCas9 mutant inactive body as a control to make the experiment more rigorous, we consulted the literature and found that PPAD is mainly composed of four domains, NtSP is the signal peptide of the N segment, the catalytic domain in the middle, IgLF is the immunoglobulin domain and CTD is the cytoplasmic tail at the C terminal. The active site of PPAD is the 351st cysteine. The 351st cysteine was mutated to alanine by the whole plasmid PCR method to lose the catalytic activity of PPAD citrulline, and finally the inactive mutant editing system vector PPADm-dCas9 was obtained. Figure 1C As shown, the mutation site C351A has been highlighted.
[0055] In the mutant system constructed in this experiment, the high-fidelity enzyme Phanta Super-Fidelity DNA Polymerase was used for whole-plasmid mutagenesis. The primer pairs F: 5'-CCTGCACGCCCGCACCCACGAGGTG-3' and R: 5'-GGCGTGCAGGGCGTCGGTGCCCAGC-3' were used. The PCR reaction system and reaction conditions are as follows: The PCR reaction system was: 2xPhantaMax Buffer 25 μL, dNTP Mix (10 mM each) 1 μL, 2 μL of each primer, 30 ng of template, 1 μL of Phanta Max Super-Fidelity DNA Polymerase, and ddH2O was added to 50 μL. The PCR reaction conditions were: first at 94°C for 3 min; then 94°C for 15 s, 56°C for 15 s, 72°C at 1 kb / 30 s, for 30 cycles; finally at 72°C for 10 min. After that, DpnI was used to remove the methylated PCR template. The PCR digestion system was: 6 μL of Fast Digest DpnI enzyme, 6 μL of 10x Fast Digest buffer, 48 μL of PCR product, reacted in a 37°C water bath for 30 min, and then heated at 80°C for 20 min to inactivate the DpnI enzyme. Then, a series of operations such as purification and recovery, transformation, colony identification, and submission for sequencing were performed on the PCR product.
[0056] 3. Western Blot detection of the ability of the fusion protein to citrullinate histones
[0057] Extraction of endotoxin-free plasmid: In this experiment, the endotoxin-free plasmid small and medium-scale extraction kit (product number: DP118) from TIANGEN was used for extraction. The specific operation steps were referred to the instruction manual. Then, 1% agarose gel was used to detect the singularity of the plasmid band, and NanoDrop was used to detect the concentration and quality of the plasmid.
[0058] The culture medium for HEK293T cells is: DMEM + 10% fetal bovine serum. In addition, double antibiotics (100 μg / ml penicillin and 100 μg / ml streptomycin) are added to the culture medium. The cell culture environment is an incubator at 37°C and 5% CO2. One day (18 - 24 hours) before transfection of the HEK-293T cell line, approximately 500,000 cells per well were seeded into a six-well plate for culture so that the cell density could reach approximately 70 - 80% the next day. When observing that the cell density reached 70 - 80% on the day of transfection, the cell culture medium in the six-well plate was replaced with 2 ml of fresh culture medium (containing antibiotics but no serum). 125 μl of DMEM culture medium without antibiotics and serum, 2.5 μg of the target plasmid pCDNA-PPAD-dCas9 were added to each well, and then 4 μl of Lipo8000 was added. The mixture was gently pipetted to mix well, taking care not to vortex or centrifuge, and incubated at 37°C for 15 min. Cultured in a 37°C incubator, the transfection efficiency was observed under a microscope 48 h later, and Western Blot was used to verify downstream experiments.
[0059] To test whether the citrullination editing system successfully exerts its activity in cells, empty plasmid EV, PPAD-dCas9, and PPAD C351A -dCas9 were transfected into HEK-293T cells respectively. After transient transfection for 48 h, the expression levels of the cells were detected by Western blot. After determining the protein loading amount, 5xloading buffer was added and mixed, and heated at 98°C for 5 min in a PCR instrument, followed by SDS-PAGE gel electrophoresis, and then a series of operations such as membrane transfer were carried out. Finally, the membrane was placed in a protein gel imager for development and imaging. As Figure 2 shown, on the premise that the expression of the actin internal reference gene was consistent, both plasmids were significantly expressed in the cytoplasm, and no Flag protein was expressed relative to the empty plasmid; in the nucleus, with histone H3 as the internal reference, on the premise of consistent expression, it was found that only PPAD-dCas9 had the ability to citrullinate the H3R2 / 8 / 17 sites, while EV and the constructed mutant inactivated vector did not citrullinate this site, indicating that the mutant inactivated vector of PPAD-dCas9 was successfully constructed.
[0060] Example 2. Identification of the natural target of PPAD by RNA-seq
[0061] First, to test whether the catalytically active PPAD-dCas9 fusion protein can regulate endogenous human histone citrullination or gene expression, RNA-seq was used to identify the natural target of PPAD. PPAD and the control were transfected into HEK-293T cells respectively. The results showed that a total of 1839 up-regulated genes and 1687 down-regulated genes were identified relative to the negative control ( Figure 3)。Since no specific targeted gene was carried out, the regulation of PPAD is a random effect, and there may be direct or indirect target genes, so screening and verification are needed.
[0062] RNA-seq analysis
[0063] RNA sequencing (RNA-seq) for each experimental condition was performed two or three times. RNA was extracted from transfected cells using the AFTSpin Tissue / Cell Fast RNA Extraction Kit (ABclonal, RK30120). Using the kit Ultra TM RNA Library Prep Kit for (NEB, E7530L) to construct a cDNA library. After the library construction was completed, it was first preliminarily quantified using a Qubit 2.0 Fluorometer, and the library was diluted to 1.5 ng / ul. Subsequently, the insert size of the library was detected using an Agilent 2100 bioanalyzer. After the insert size met the expectations, qRT-PCR was used to accurately quantify the effective concentration of the library (the effective concentration of the library was higher than 1.5 nM) to ensure the library quality. After passing the library inspection, different libraries were pooled according to the requirements of the effective concentration and the target off-machine data volume and then sequenced using an Illumina NovaSeq 6000 to generate 150 bp paired-end reads. The basic principle of sequencing is Sequencing by Synthesis. HISAT2 (v2.0.5) was used to construct an index of the reference genome, and HISAT2 (v2.0.5) was used to align the paired-end clean reads with the reference genome. The DESeq2 software (1.20.0) was used for differential expression analysis between two comparison groups. DESeq2 provides statistical procedures for using a model based on the negative binomial distribution to determine differential expression in digital gene expression data. The Benjamini and Hochberg method was used to adjust the obtained P values (padj) to control the false discovery rate. padj <= 0.05 & |log2(foldchange)| >= 1 was set as the threshold for significantly differential expression.
[0064] Example 3, Design and Vector Construction of gRNA Targeting the Target Gene
[0065] In order to specifically bind to the dCas9 fusion protein and then target the target locus, it is necessary to design a gRNA sequence with a length of approximately 20 bp upstream of the promoter of the target gene. The gRNA is designed through two approaches. Part of it refers to the transcriptional activation (SAM) gRNA library purchased from GenScript Biotech Corporation, which contains a total of 70,290 gRNA sequences designed for human genes; the other part refers to the gRNA tool design website (http: / / chopchop.cbu.uib.no / ) for auxiliary design. The detailed gRNA sequences are shown in Table 1, and the reverse transcription primers are shown in Table 2. All primers were synthesized by Genewiz (Suzhou) Inc.
[0066] Table 1
[0067] Target Forward Primer(5’-3’) Reverse Primer(5’-3’) GAPDH CAATGACCCCTTCATTGACC TTGATTTTGGAGGGATCTCG MEP1B CCCATTTATGACCACCGATAATGG GCTTTTCAGCCTTTCGTGGG SPDYA GGCGATGTTGTGAGGAGGTTA CACCCCTGCTGTATGACTGG LVRN CAAGCTGTGAGTAAAAGGTATGGA CTGATCCTCTGGTGTTCCTCC FAM184B AATTGCAAGCCCAGGTCTCA GGTTCTGCTGAGTGGTCTCC RILP GAAGCAGAGAGCAGTGAGGATG GAGGATTCAGCTTTACCCCGA MUC13 GGGAACTGCCAAAAGTGTGC CTGAGAATGACAATGCCAGCG NCF2 CACTAAGCTGAGCTATCGGC CACCACAGAGTCAGGCAGTA
[0068] Table 2
[0069]
[0070] The gRNA was constructed by seamless assembly using the Golden Gate cloning technique, as Figure 4A shown by the original plasmid pcU6_3gRNA and Figure 4B the plasmid map, which contains the IIS-type restriction enzyme BsaI cleavage site. The recognition and cleavage sites are not at the same position. Based on this property, digestion and ligation can be completed in the same test tube. And the cleavage site is located before and after the ccdB lethal gene (toxic protein, DNA gyrase inhibitor). The successfully ligated product will not contain this gene, so it can be normally expressed in Escherichia coli with a high construction success rate.
[0071] Before constructing the gRNA plasmid, the gRNA-ccdB-TagRFP plasmid has been successfully constructed. After designing and obtaining the corresponding 20-nt gRNA, it is necessary to add CACC- at the 5' end of the upstream primer and AAAC- restriction enzyme site at the 5' end of the downstream primer. It should be noted that transcription starts from G at the 5' end of the U6 promoter. Therefore, if the first base of the designed primer is not G, an additional G needs to be added. The first step is the preparation of the gRNA oligonucleotide fragment. Generally, gradient annealing can achieve the effect of complementary pairing. This step needs to be slowly cooled to room temperature. Too fast cooling will lead to the formation of incorrect higher-order structures. The recommended method is to place the mixing tube in a cup of water at 95°C and let it cool naturally to room temperature. Or slow cooling can be carried out through a PCR instrument. The primer annealing system is as follows: 2 μL each of the upstream and downstream primers of gRNA (10 μM), and ddH2O up to 14 μL. The PCR reaction conditions are: first at 95°C for 5 min; then cooled to 25°C at a rate of 5°C / min. After that, the gRNA fragment is inserted into the vector using Golden Gate cloning. The PCR reaction conditions are 25 cycles of alternating reactions at 37°C and 22°C for 5 min each, digestion at 37°C, ligation with T4 Ligase at 22°C, inactivation of the enzyme by reacting at 80°C for 5 min, and preservation at 4°C. The specific reaction conditions are: 1 μL of annealed primer pair, 30 ng of gRNA plasmid backbone, 0.5 μL of 1 mg / ml BSA, 0.5 μL of 10x T4 buffer, 0.32 μL of T4 Ligase, 0.32 μL of BsaI (Eco31I) enzyme, and ddH2O is added to 12.5 μL.
[0072] Example 4. Verification of the activation ability of PPAD-dCas9 targeting endogenous genes by RT-qPCR
[0073] The plasmids of gRNAs targeting different genes designed and synthesized in Example 3 and the plasmid containing the PPAD-dCas9 editing system prepared in Example 1 were simultaneously transfected into HEK293T cells. Inside the cells, the gRNA recruits the PPAD-dCas9 fusion protein to the promoters of different target genes, thereby realizing the citrullination modification reaction of histones at the corresponding positions and further affecting gene transcription. According to the detection results of the mRNA levels of different genes by qPCR, compared with the control dCas9, PPAD-dCas9 significantly activated seven genes, namely MEP1B, SPDYA, LVRN, FAM184B, RILP, MUC13, and NCF2, with significant activation (P < 0.0001). The activation levels of these seven genes reached 14, 13, 13, 16, 6, 15, and 5 times respectively, and there was no activation at any level compared with the mutant-inactivated PPADm-dCas9 ( Figure 5 ), indicating that the enzyme activity is necessary for the activation ability at this site.
[0074] Example 5. Verification of the histone citrullination level of the responsive gene MEP1B by CHIP-qPCR
[0075] To further investigate the potential mechanism of gene activation mediated at the responsive (MEP1B) locus, we used ChIP-qPCR to measure the histone citrullination level. First was sample preparation and cross-linking: The samples were processed under appropriate conditions, cross-linked with formaldehyde at a final concentration of 1% for 10 min, and then a final concentration of 1x Glycine Solution was added and gently rotated to mix well, followed by incubation at room temperature for 5 min to terminate the above fixation reaction. Then was nuclear extraction and chromatin sonication: Cell Swelling Buffer was added to lyse the cells, and then ChIP Sonication Buffer was added for sonication (non-contact sonication). The chromatin fragmentation and concentration were then analyzed, followed by chromatin immunoprecipitation (IP). The H3R2 / 8 / 17 antibody was used to deposit the citrullination modification sites, and the DNA interacting with this site was also deposited accordingly. Subsequently, qPCR was used to quantify the target gene MEP1B, and the citrullination level at the promoter of this site was evaluated compared with the negative control. The results are as Figure 6 shown. It can be seen that, compared with the negative control, the citrullination level of PPAD-dCas9 at the promoter was significantly increased (P < 0.0001), while the histone citrullination level mediated by the inactivated mutant editing system PPADm-dCas9 did not change. The results indicate that the citrullination modification targeting the specific H3R2 / 8 / 17 site of the target gene locus is the reason for mediating gene upregulation.
[0076] Example 6. Analysis of the off-target rate of PPAD-dCas9-mediated gene activation by RNA-seq
[0077] To evaluate the specificity of PPAD-dCas9, PPAD-dCas9, and gRNAs targeting MEP1B and SPDYA and non-targeting gRNAs as controls were co-transfected into HEK293T cells for deep sequencing to detect the binding to the promoters of MEP1B and SPDYA in the whole genome, which was highly specific in the entire human genome. RNA-seq showed that ( Figure 7 ) PPAD-dCas9 targeting the promoters of MEP1B and SPAYA specifically and significantly activated the target genes (Padj of 5.46x10-9 and 1.42x10-4). This indicates that PPAD-dCas9-mediated gene activation is specific, specifically activating MEP1B by about 15-fold, while having no obvious interference with the levels of other approximately 20,000 mRNAs in the cell, thus proving that the targeting of the editing system is extremely high and there is no obvious off-target phenomenon.
Claims
1. A fusion protein, which is formed by fusing peptidylarginine deiminase with a Streptococcus pyogenes dCas9 protein with nuclease activity removed, preferably further comprising a nuclear localization sequence (constructed at the C-terminus and / or N-terminus of the fusion protein), and more preferably further comprising a linker peptide between the peptidylarginine deiminase and the Streptococcus pyogenes dCas9 protein with nuclease activity removed.
2. An expression cassette, which comprises a promoter and the fusion protein as described in claim 1 operably linked thereto, and preferably, the promoter is the CMV promoter.
3. A recombinant expression vector, which comprises the expression cassette as described in claim 2, and preferably, the starting vector of the recombinant expression vector is an expression vector applicable in mammalian cells.
4. An epigenetic editing system based on CRISPR / dCas9-targeted histone citrullination modification, characterized in that: It consists of an anchoring element, a guiding element and a modifying effector element together; The anchoring element is the dCas9 protein from Streptococcus pyogenes with DNA-binding function but endonuclease-inactivated; The guiding element is gRNA, which contains a nucleotide sequence complementary to the target DNA sequence; The modifying effector element is the peptidylarginine deiminase effector protein PPAD of Porphyromonas gingivalis, and the modification is citrullination modification.
5. The epigenetic editing system as described in claim 4, characterized in that The anchoring element, the guiding element and the modifying effector element are jointly constructed on a vector expressed in mammals, or the anchoring element and the modifying effector element are jointly constructed in a vector expressed in mammals (preferably, it is the recombinant expression vector as described in claim 3), while the guiding element is constructed in another vector expressed in mammals for separate expression, and they are simultaneously transfected into mammalian cells during use; Preferably, the vector expressed in mammals is a plasmid vector, more specifically the pCDNA3.1(-) expression vector.
6. The epigenetic editing system according to claim 4, characterized in that The site targeted by the target DNA sequence is the promoter region. Preferably, the nucleotide sequence complementary to the target DNA sequence is 20 bp. Preferably, CACC- is added to the 5' end of the upstream primer and AAAC- is added to the 3' end of the downstream primer of the target DNA sequence to complement the restriction enzyme digestion site of Eco31I.
7. The epigenetic editing system according to claim 4, characterized in that The citrullination site is the histone H3R2 / 8 / 17 site.
8. Use of the epigenetic editing system according to any one of claims 4 to 7 in achieving histone citrullination modification at a targeted genomic specific site in mammalian cells to regulate gene transcription.
9. A method for achieving histone citrullination modification at a targeted genomic specific site in mammalian cells to regulate gene transcription, characterized in that It includes the following steps: The first step: introducing the epigenetic editing system as described in any one of claims 4 to 7 into the target mammal; The second step: extracting RNA from the successfully transfected cells and verifying the activation effect of PPAD-dCas9 on the target gene by RT-qPCR.
10. The method as described in claim 9, characterized in that The mammalian system is HEK-293T cells; the target DNA sequence is selected from the promoter sequences of the MEP1B, SPDYA, LVRN, FAM184B, RILP, MUC13, and NCF2 genes.