Molecular markers located on chromosome 3 associated with yield traits in arrowhead pea and their applications

Abstract

This invention discloses a molecular marker located on chromosome 3 associated with the yield trait of *Vitis pulcherrima* and its application, belonging to the field of biotechnology. The molecular marker is named Vs_Chr3_168325060, and the nucleotide sequence of its inserted or deleted fragment is shown in SEQ ID NO. 3. The nucleotide sequences of the primer pairs used to amplify the InDel molecular marker Vs_Chr3_168325060 are shown in SEQ ID NO. 1-2. This molecular marker can significantly improve breeding efficiency and enable rapid molecular-level screening of high-yielding *Vitis pulcherrima* materials.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to molecular markers located on chromosome 3 that are associated with yield traits in arrowhead peas and their applications. Background Technology

[0002] With the rapid development of breeding technology, current breeding methods mainly include two categories: traditional breeding and molecular breeding. In the breeding process, the selection of target traits primarily relies on the expression of genotype and phenotype. Molecular marker-assisted breeding utilizes the close linkage between molecular markers and genes associated with the target trait. By detecting molecular markers, the presence of target genes can be indirectly determined, thereby achieving precise selection of the target trait. This method has significant advantages such as speed, high accuracy, and no environmental limitations. Screening for target trait genotypes through molecular markers significantly shortens the breeding cycle, accelerates breeding efficiency, and overcomes many challenges faced by traditional breeding methods. Currently, the development and application of molecular marker technology based on genome-wide association studies (GWAS) has become a research hotspot and a competitive frontier in the field of breeding.

[0003] Arrowhead pea (Vicia sativa L.) is an important self-pollinating annual forage legume, rich in minerals and vitamins, and highly digestible, making it suitable for livestock consumption. It is considered one of the most economically valuable annual legumes globally. As a multifunctional crop, arrowhead pea plays a vital role in both human diets and animal feed. Its seeds provide humans with abundant starch and protein, while its nutrient-rich stems and leaves are high-quality livestock feed, effectively improving livestock productivity. Furthermore, due to its symbiotic relationship with rhizobia in the soil, it can fix atmospheric nitrogen into the soil, significantly reducing the use of chemical fertilizers, making it an important high-quality green manure. With its low cost, high nutritional value, wide range of uses, and strong adaptability, arrowhead pea is now widely cultivated in many parts of the world. Despite its numerous advantages, improving its yield traits remains a challenge. Traditional breeding methods are time-consuming and inefficient, unable to meet the rapidly growing market demand. To accelerate the breeding process of arrowhead pea and improve its yield and economic benefits, this invention combines genome-wide association analysis (GWAS) and third-generation molecular marker technology to develop InDel molecular markers associated with yield traits. This technology can accurately and efficiently locate gene loci related to yield, providing a scientific basis and technical support for the breeding of high-yielding arrowhead peas. Summary of the Invention

[0004] One of the objectives of this invention is to provide a molecular marker associated with yield traits in arrowhead peas.

[0005] The second objective of this invention is to provide the application of the aforementioned molecular markers related to the yield traits of arrowhead pea.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] This invention discloses a pair of molecular markers related to the yield trait of pea shoots, located on chromosome 3 of pea shoots, and the molecular markers are named Vs_Chr3_168325060.

[0008] The molecular marker Vs_Chr3_168325060 is an insertion / deletion fragment on chromosome 3 of the arrowhead pea reference genome.

[0009]

[0010] Primer pairs for amplifying molecular markers associated with yield traits in arrowhead peas were used. The primer pair sequence corresponding to the molecular marker Vs_Chr3_168325060 is as follows:

[0011] Vs_Chr3_168325060-F: CAAGTGTGAGTAAGTGGGGAAA (as shown in SEQ ID NO.1);

[0012] Vs_Chr3_168325060-R: ACTTCTTGGGTGCATTCAATAC (shown as SEQ ID NO.2).

[0013] This invention also discloses the application of the aforementioned molecular marker primer pairs in marker-assisted breeding for yield-lowering traits in *Vaccaria buergeriana*. Specifically, the molecular markers of this invention can be used in future marker-assisted breeding. By extracting DNA from leaves during the seedling stage, the presence of the molecular markers of this invention can be detected, thereby identifying the yield-lowering traits of *Vaccaria buergeriana*. The detection can be performed using PCR, specifically using the aforementioned molecular marker primer pairs, or it can be performed using sequencing methods.

[0014] This invention also discloses the application of the above-mentioned molecular markers in identifying the yield trait of arrowhead pea, especially in the screening and identification of high-yielding arrowhead pea. The specific steps for identifying whether arrowhead pea has a high-yielding trait are as follows:

[0015] (1) Using the DNA of the tested germplasm as the template for PCR amplification, and the primer pair corresponding to the label Vs_Chr3_168325060 as the primers, the PCR amplification reaction system is shown in Table 1:

[0016] Table 1. Reaction system for PCR amplification

[0017]

[0018]

[0019] PCR amplification program: 98℃ pre-denaturation for 30s; 98℃ denaturation for 10s, 55℃ annealing for 5s, 72℃ extension for 5s, 35 cycles; 72℃ extension for 5min; store at 4℃.

[0020] (2) PCR products were detected by agarose gel electrophoresis, and the yield of arrowhead peas was determined based on the results:

[0021] If the PCR amplification product is a characteristic band of 354 bp as shown in SEQ ID NO.4, then *Vaccaria buergeriana* is a low-yielding type; if the PCR amplification product is a characteristic band of 250 bp as shown in SEQ ID NO.5, then *Vaccaria buergeriana* is a high-yielding type.

[0022] Additionally, reagent kits containing the aforementioned molecular marker primer pairs can be prepared to identify yield traits in *Viburnum sarmentosum* materials. Furthermore, these kits can be used to identify or assist in identifying the genotype of *Viburnum sarmentosum*. Specific identification methods include:

[0023] (1) Extract genomic DNA from the arrowhead pea plant to be tested;

[0024] (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair of the molecular marker described in claim 1, and perform electrophoresis detection and / or sequencing on the PCR amplification products;

[0025] (3) Electrophoresis and / or sequencing of the PCR amplification products: If the PCR amplification product is a characteristic band of 354 bp as shown in SEQ ID NO.4, then *Vitis pulcherrima* is a low-yielding genotype; if the PCR amplification product is a characteristic band of 250 bp as shown in SEQ ID NO.5, then *Vitis pulcherrima* is a high-yielding genotype. This invention has the following advantages:

[0026] (1) The molecular markers in this invention are closely related to the yield trait of arrow-shaped peas and can be applied to molecular marker-assisted breeding of arrow-shaped pea yield traits, to the screening of germplasm resources of high-yielding arrow-shaped peas, and to the genetic improvement of arrow-shaped peas.

[0027] (2) The molecular markers of the present invention have the characteristics of convenient detection, stable amplification products and high specificity, and can be applied rapidly and in high throughput to the breeding practice of arrowhead pea. Attached Figure Description

[0028] Figure 1The results of the genome-wide association analysis of the dry weight trait of arrowhead pea are based on the Manhattan diagram obtained by EMMAX software. The red sites shown are the InDel positions associated in this invention.

[0029] Figure 2 The DW (dry weight) box plots for different genotypes at locus Vs_Chr3_168325060 in a genome-wide association analysis (GWAS) population. 0 / 0 indicates a low-yielding genotype at locus Vs_Chr3_168325060, and 1 / 1 indicates a high-yielding genotype. The dots represent extreme values, and the values ​​above them are the p-values ​​for testing statistical differences.

[0030] Figure 3 The sequence differences between the 0 / 0 genotype and the 1 / 1 genotype within the molecular marker Vs_Chr3_168325060 region are shown. Figure 4 This is an electrophoresis image of molecular markers amplified from some *Vaccinium bracteatum* germplasm resources. The agarose gel concentration is 2%. In the image, M represents the DNA marker. Detailed Implementation

[0031] The present invention will now be described in detail through specific embodiments. These embodiments are provided so that this invention will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.

[0032] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used can be purchased commercially.

[0033] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0034] Example 1: Development of molecular markers related to arrowhead pea yield

[0035] This invention uses the dry weight (DW, in g) index to evaluate the yield trait of *Viola yezoensis*. A higher DW value indicates higher yield, and a lower value indicates lower yield. After measuring the DW in the *Viola yezoensis* population, GWAS analysis located an InDel locus in the *Viola yezoensis*. Figure 1The red locus, named Vs_Chr3_168325060, is located at position 168325060 on chromosome 3 of the *Vaccinium bracteatum* reference genome (downloadable at: http: / / dx.doi.org / 10.5524 / 100954). The first allele with InDel insertion has a genotype of 0 / 0, while the second allele with InDel deletion has a genotype of 1 / 1. The DW box plot of different genotypes at the Vs_Chr3_168325060 locus in the *Vaccinium bracteatum* population is shown below. Figure 2 This indicates that the dry weight of *Vicia sativa* genotype 1 / 1 was significantly higher than that of genotype 0 / 0. The insertion / deletion fragment at locus 168325060 on chromosome 3 of *Vicia sativa* is AGAGCCTTTGGTTCGAGAAAGGGATCGAAAAGGACTTGTATCGAATGCTTGTTCCTCAACTTTATATCAATGCTCCTACTATTAACTCCCTCCAACATGGTATT (shown in SEQ ID NO. 3). Figure 3 The 0 / 0 type has the insert fragment of SEQ ID NO.3, while the 1 / 1 type lacks the insert fragment of SEQ ID NO.3.

[0036] Based on the InDel variant and its upstream and downstream sequences, the following primers were designed using Primer 5.0 software:

[0037] Vs_Chr3_168325060-F: CAAGTGTGAGTAAGTGGGGAAA (as shown in SEQ ID NO.1);

[0038] Vs_Chr3_168325060-R: ACTTCTTGGGTGCATTCAATAC (shown as SEQ ID NO.2).

[0039] Then, the primers were used to perform PCR amplification on the test samples. The results showed that the PCR product of the low-yielding arrowhead pea sample had a characteristic band of 354 bp, while the PCR product of the high-yielding arrowhead pea sample had a characteristic band of 250 bp.

[0040] Example 2: Accuracy verification of the molecular markers described in this invention

[0041] A total of 222 germplasm accessions were identified, and the specific germplasm materials used are shown in Table 2:

[0042] Table 2222 Dry weight indices and genotypes corresponding to the Vs_Chr3_168325060 locus of *Vallis fulva* germplasm.

[0043]

[0044]

[0045]

[0046]

[0047]

[0048]

[0049] Note: In the table, genotype. / . represents genotype deletion.

[0050] 1) Using the genomic DNA of the arrowhead pea to be identified as a template, PCR amplification was performed using the primer pair to obtain the PCR product;

[0051] The PCR amplification reaction system is as follows: template DNA 10–100 ng, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 5 μL of 2×Taq PCR Master Mix, and deionized water to a final volume of 10 μL. The preferred PCR amplification reaction program is: 98℃ pre-denaturation for 30 s; 98℃ denaturation for 10 s, 55℃ annealing for 5 s, 72℃ extension for 5 s, 35 cycles; 72℃ extension for 5 min; and storage at 4℃. Separation is performed by electrophoresis on a 2% agarose gel. After loading, electrophoresis is performed at 140V DC for 1 h, and the PCR banding patterns of each sample are then read.

[0052] 2) Determine the genotype of *Vaccaria buergeriana* based on the size of the PCR product: if the PCR product of the *Vaccaria buergeriana* to be identified contains the fragment shown in SEQ ID NO.3, then the *Vaccaria buergeriana* to be identified is type 0 / 0; if the PCR product of the *Vaccaria buergeriana* to be identified lacks the fragment shown in SEQ ID NO.3, then the *Vaccaria buergeriana* to be identified is type 1 / 1.

[0053] Specifically, when the PCR product of the *Vaccaria buergeriana* to be identified contains the fragment shown in SEQ ID NO.3, and the band length of the PCR product is 354 bp (SEQ ID NO.4), then the *Vaccaria buergeriana* to be identified is of type O / O.

[0054] The sequence of SEQ ID NO.4 is as follows:

[0055]

[0056] When the PCR product of the *Vaccaria serrata* to be identified lacks the fragment shown in SEQ ID NO.3, the band length of the PCR product is 250 bp (SEQ ID NO.5), then the *Vaccaria serrata* to be identified is type 1 / 1.

[0057] The sequence of SEQ ID NO.5 is as follows:

[0058]

[0059]

[0060] Analysis of the 222 *Viburnum cuspidatum* accessions in Table 2 revealed that, excluding 6 accessions with missing genotypes, 152 accessions had a genotype of 0 / 0 at the Vs_Chr3_168325060 locus, with a mean yield (DW) of 18.29972059 g, classifying them as low-yielding *Viburnum cuspidatum*. Conversely, 64 accessions had a genotype of 1 / 1 at the Vs_Chr3_168325060 locus, with a mean DW of 22.89925926 g, classifying them as high-yielding *Viburnum cuspidatum*. Analysis of variance showed a highly significant difference in DW between the high-yielding and low-yielding *Viburnum cuspidatum* accessions (P < 0.01).

[0061] Twenty-four accessions from 222 *Viburnum cuspidatum* accessions (germplasm numbers 109, 164, 202, 235, 33, 409, 436, 79, 113, 200, 303, 302, 62, 458, 467, 64, 65, 470, 17, 270, and 67) were selected for validation. Figure 4 It can be seen that 7 *Viburnum cuspidatum* materials amplified a 250bp characteristic band, indicating the 1 / 1 type. Statistical analysis showed that the average yield (DW) of these 7 materials was 22.91833333g. 14 *Viburnum cuspidatum* materials amplified a 354bp characteristic band, indicating the 0 / 0 type. Statistical analysis showed that the average DW of these 14 0 / 0 type materials was 12.7675g, lower than the average DW of the 7 1 / 1 type materials. Analysis of variance showed a significant difference in DW between the 0 / 0 and 1 / 1 types (P<0.01). The 1 / 1 type *Viburnum cuspidatum* materials, genotyped by PCR detection, were expected to be high-yielding materials, and the actual results were largely consistent with the expectations, demonstrating high accuracy. Therefore, the InDel molecular marker of this invention can effectively identify the yield trait of *Viburnum cuspidatum* and can be used for the prediction and screening of high-yielding *Viburnum cuspidatum* varieties.

[0062] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. A method for identifying the yield trait of arrowhead pea, the method comprising the following steps: (1) Extract genomic DNA from the target *Vitis hyacinthus* pea; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using primer pairs, and perform electrophoresis detection and / or sequencing on the PCR amplification products; (3) The determination is based on the electrophoresis bands and / or sequencing results of step (2), and the specific criteria are as follows: The genomic DNA of *Vitis hyacinthus* to be tested was amplified by PCR using primers Vs_Chr3_168325060-F and Vs_Chr3_168325060-R. If the PCR amplification product was a characteristic band of 354 bp as shown in SEQ ID NO.4, then *Vitis hyacinthus* was a low-yielding variety; if the PCR amplification product was a characteristic band of 250 bp as shown in SEQ ID NO.5, then *Vitis hyacinthus* was a high-yielding variety. The sequences of the primer pair are as follows: Vs_Chr3_168325060-F: CAAGTGTGAGTAAGTGGGGAAA; Vs_Chr3_168325060-R:ACTTCTTGGGTGCATTCAATAC; The yield of arrowhead peas is evaluated using the dry weight index. The higher the value, the higher the yield of arrowhead peas; the lower the value, the lower the yield of arrowhead peas.

2. The application of a reagent kit in identifying genotypes related to yield in arrowhead peas, characterized in that, The kit contains the primer pair described in claim 1. The method for identifying yield-related genotypes of arrowhead pea using the kit is as follows: (1) Extract genomic DNA from the target *Vitis hyacinthus* pea; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair described in claim 1, and perform electrophoresis detection and / or sequencing on the PCR amplification products; (3) Electrophoresis and / or sequencing of the PCR amplification products. If the PCR amplification product is a characteristic band of 354 bp as shown in SEQ ID NO.4, then the arrowhead pea is a low-yielding genotype; if the PCR amplification product is a characteristic band of 250 bp as shown in SEQ ID NO.5, then the arrowhead pea is a high-yielding genotype. The yield of the arrowhead pea is evaluated by the dry weight index. The higher the value, the higher the yield of the arrowhead pea; the lower the value, the lower the yield of the arrowhead pea.

Images