Microcystic toxin-LR rapid detection biosensor

Abstract

The invention belongs to the field of analysis and detection, and particularly relates to a microcystic toxin-LR rapid detection biosensor. The invention provides an enzyme-free biosensor for MC-LR detection based on the principles of aptamer recognition and self-assembly of a hairpin probe on a magnetic bead. An amplification strategy of toehold-mediated strand displacement and circular hybridization reaction is connected in series, and high-sensitivity MC-LR detection is realized based on a fluorescence sensitive platform. The method simplifies the operation and reduces the cost. The whole detection process is quick in response, the operation process can be mastered without professional training, and quick popularization and use are facilitated. The method can reach the detection limit of 53fM at most, has good specificity, can only specifically detect microcystic toxins-LR, and does not specifically recognize other substances such as microcystic toxins-LA, cystic toxins-YR, microcystic toxins-RR and the like.

Description

Technical Field

[0001] The invention belongs to the field of analysis and detection, and specifically relates to a microcystin-LR rapid detection biosensor. Background Art

[0002] Microcystin-LR (MC-LR) is produced by cyanobacteria in aquatic environments due to eutrophication. It is highly toxic even at low concentrations. It inhibits the activity of protein phosphatases and causes liver damage and even promotes tumors through consumption of contaminated food and drinking water. Therefore, it is considered to be a huge threat to human health. China has set the national standard for MC-LR at less than 1g / L in drinking water.

[0003] At present, conventional MC-LR detection methods mainly include high performance liquid chromatography (HPLC), liquid chromatography-tandem mass spectrometry (LC / MS / MS) and capillary electrophoresis (CE). Although these methods are accurate, they require bulky instruments, complex sample pretreatment procedures and skilled operators, which is not conducive to rapid on-site detection. In recent years, methods using nucleic acid aptamers to detect targets have attracted much attention. Analytical techniques such as fluorescence, electrochemistry and colorimetry have been established, but most of them show low sensitivity, which limits the widespread application of these technologies.

[0004] Therefore, there is an urgent need for tandem signal amplification technology for high-sensitivity detection of MC-LR to make the detection process simple and rapid, reduce costs, and facilitate promotion. Summary of the invention

[0005] The first aspect of the present invention aims to provide a probe targeting microcystin-LR.

[0006] The second aspect of the present invention aims to provide a set of reagents for detecting microcystin-LR.

[0007] The purpose of the third aspect of the present invention is to provide the use of the probe described in the first aspect of the present invention and the reagent described in the second aspect of the present invention.

[0008] The fourth aspect of the present invention aims to provide a kit for detecting microcystin-LR.

[0009] The fifth aspect of the present invention aims to provide a method for detecting microcystin-LR.

[0010] In order to achieve the above-mentioned purpose of the present invention, the technical solution adopted by the present invention is:

[0011] In a first aspect, the present invention provides a probe targeting microcystin-LR.

[0012] In some embodiments of the present invention, the probe includes a hairpin probe Hairpin 1, which is composed of a nucleic acid aptamer Aptamer, a trigger DNA sequence, biotin and PolyA.

[0013] In some embodiments of the present invention, the sequence of the nucleic acid aptamer Aptamer is shown as SEQ ID NO:2.

[0014] In some embodiments of the present invention, the trigger DNA sequence is shown as SEQ ID NO:3.

[0015] In some embodiments of the present invention, the sequence of the probe is shown in SEQ ID NO:1.

[0016] In some embodiments of the present invention, the probe has domain 1 and domain 2.

[0017] In some embodiments of the present invention, the sequence of domain 1 is ACCATGT.

[0018] In some embodiments of the present invention, the sequence of domain 2 is TCATCCCTTGTCAACG (SEQ ID NO: 4).

[0019] The second aspect of the present invention aims to provide a set of reagents for detecting microcystin-LR.

[0020] In some embodiments of the present invention, the reagent comprises the probe and signal amplification reagent described in the first aspect of the present invention;

[0021] In some embodiments of the present invention, the signal amplification reagent includes a hairpin probe Hairpin 2 and a hairpin probe Hairpin 3.

[0022] In some embodiments of the present invention, the sequence of the hairpin probe Hairpin 2 is shown as SEQ ID NO:5.

[0023] In some embodiments of the present invention, the sequence of the hairpin probe Hairpin 3 is shown as SEQ ID NO:7.

[0024] In some embodiments of the present invention, the sequence of the hairpin probe Hairpin 2 includes domain 3 (ATAGTCC), a domain 1* sequence complementary to domain 1 (ACATGGT), domain 2 (shown in SEQ ID NO: 4), a domain 2* sequence complementary to domain 2 (shown in SEQ ID NO: 6), and PolyA.

[0025] In some embodiments of the present invention, the hairpin probe Hairpin 2 has a fluorescent group and a quenching group.

[0026] In some embodiments of the present invention, the fluorescent group is selected from any one of FAM, CY3, CY5, HTX, ROX, VIC and HEX; preferably, it is FAM.

[0027] In some embodiments of the present invention, the quenching group is selected from any one of BHQ and TAMRA; preferably, it is BHQ.

[0028] In some embodiments of the present invention, the fluorescent group is located within 5 nucleotides at the 5' end of domain 2 of the hairpin probe Hairpin 2, and the quenching group is located within 5 nucleotides at the 3' end of domain 2*. Of course, those skilled in the art can exchange the positions of the fluorescent group and the quenching group and achieve similar fluorescence effects.

[0029] In some embodiments of the present invention, the sequence of the hairpin probe Hairpin 3 includes PolyA, domain 3* (GGACTAT) complementary to domain 3, domain 2* sequence complementary to domain 2 (shown in SEQ ID NO: 6), domain 1 (ACCATGT), and domain 2 (shown in SEQ ID NO: 4).

[0030] In some embodiments of the present invention, the hairpin probe Hairpin 2 and the hairpin probe Hairpin 3 are modified with biotin.

[0031] The third aspect of the present invention provides a kit for detecting microcystin-LR, comprising the reagent described in the second aspect of the present invention.

[0032] In some embodiments of the present invention, the kit further comprises streptavidin-labeled magnetic beads and a reaction buffer.

[0033] In some embodiments of the present invention, the reaction buffer comprises a Tris-HCl buffer solution, wherein one of the feasible formulas is: 100 mM NaCl, 5 mM MgCl2, 200 mM KCl, 1 mM EDTA, pH 7.4.

[0034] In some embodiments of the present invention, the kit may further include a negative control standard and a positive control standard.

[0035] A fourth aspect of the present invention provides a method for detecting microcystin-LR, comprising the following steps:

[0036] 1) Mix the hairpin probes Hairpin 1, Hairpin 2, and Hairpin 3 with the reaction buffer and heat them for annealing;

[0037] 2) incubating the product obtained in step 1) with streptavidin-labeled magnetic beads to form a complex;

[0038] 3) Magnetic bead separation, mixing the separated magnetic beads with the sample and detecting.

[0039] In some embodiments of the present invention, the final concentration of the hairpin probes Hairpin 1, Hairpin 2, and Hairpin 3 is 0.01 μM to 10 μM.

[0040] In some embodiments of the present invention, a specific detection method is provided, comprising:

[0041] (1) Formation of H1 / H2 / H3 complex. At room temperature, H1, H2, and H3 (different concentration ratios will give different signal-to-noise ratios, and the larger the signal-to-noise ratio, the better the experimental results) were mixed in a Tris-HCl buffer solution (100 mM NaCl, 5 mM MgCl2, 200 mM KCl, 1 mM EDTA, pH 7.4) and heated at 90°C for 10 minutes. The mixture was then slowly cooled to room temperature to form an H1 / H2 / H3 complex.

[0042] (2) Formation of SA-MB / H1 / H2 / H3 complex. Incubate 100 nM biotinylated H1, 100 nM biotinylated H2, and 200 nM biotinylated H3 (different concentration ratios will give different signal-to-noise ratios, and the greater the signal-to-noise ratio, the better the experimental results) with SA-MB (100 μL, 1.0 mg / mL) for 30 minutes to form a SA-MB / H1 / H2 / H3 complex. Each experimental condition has a great influence on the experimental results. The optimal condition of each reaction condition is the one that achieves the maximum corresponding signal-to-noise ratio. In this way, the experimental effect is optimal under the optimal conditions.

[0043] (3) MC-LR detection. After magnetic separation, the MBs were redispersed in 50 mM Tris-HCl buffer. Then, the target MC-LR was added to the MB system. After incubation for 45 minutes, the fluorescence spectrum from 500 to 750 nm was recorded (Ex = 495 nm, Em = 525 nm). The concentration of the substrate strand cleaved by the enzyme is linearly related to the fluorescence intensity, thereby achieving the purpose of detecting MC-LR.

[0044] The beneficial effects of the present invention are:

[0045] The present invention uses MC-LR nucleic acid aptamers as sensing elements, based on aptamer recognition and self-assembly of hairpin probes on MB, and connects toehold-mediated chain displacement and cyclic hybridization reaction amplification strategies in series, relying on a fluorescent sensitive platform to achieve high-sensitivity detection of MC-LR. The method simplifies the operation and reduces the cost. The entire detection process responds quickly, and the operation process can be mastered without professional training, which is convenient for rapid promotion and use. It is of great significance in the rapid detection of MC-LR in the detection environment. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0047] Figure 1 The schematic diagram of the detection method of the present invention.

[0048] Figure 2 It is a sensitivity detection result diagram, where A is the fluorescence response result of the biosensor treated with different MC-LR concentrations, B is the corresponding fluorescence intensity of different concentrations of standards at 525nm, and C is the fitting curve.

[0049] Figure 3 This is a graph showing the results of a specific experiment. DETAILED DESCRIPTION

[0050] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0051] The detection principle of the present invention is:

[0052] In the presence of MC-LR, the binding between MC-LR and the aptamer sequence in H1 forms a MC-LR / H1 complex, in which the trigger DNA (domains 1 and 2) is opened. Domain 1 of the trigger DNA can then serve as a DNA support point to pair with the sticky end (domain 1*) of H2. Domain 2 of the trigger DNA can further hybridize with domain 2* of H2 through a toehold-mediated strand displacement reaction. After strand branch migration (1-1* and 2-2* hybridization), H2 will open. In the formed MC-LR / H1 / H2 complex, the previously occupied domains 2 and 3 in H2 become free and can open H3 through a toehold-mediated strand displacement reaction. Importantly, since H3 also contains domains 1 and 2, the circular hybridization reaction between H2 and H3 can occur continuously on the MB. In the formed product (MC-LR / H1 / nH2 / nH3), FAM and BHQ are separated, and a high FAM fluorescence signal can be observed. The MB system can eliminate the need for separate reactions, increase detection speed, and reduce sample loss when cyclic hybridization reactions are completed directly on the MB surface. In the absence of MC-LR, all hairpin probes maintain the hairpin structure on the MB, and only background fluorescence signals are observed due to the close positions of FAM and BHQ in H2. Under optimal conditions, the linear range of the method is from 100fM to 1nM, and the detection limit is 53fM. The method also shows significant selectivity for other possible analogs. MC-LR analysis of actual environmental water samples showed that the method has good precision and accuracy.

[0053] The specific experimental results are shown in the following examples.

[0054] Example 1 Design and synthesis of primer sequences

[0055] The primer sequences designed by the present invention are as follows:

[0056] Hairpin 1: 5'-Biotin-AAAAAAAAAAAAAAAAAA-GGCGCCAAACAGGACCACCATG ACAATTACCCATACCACCTCATTATGCCCCATCTCCATCTCCGC-ACCATGT-TCATCCCT TGTCAACG-3' (SEQ ID NO: 1).

[0057] Among them, MC-LR aptamer is: GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCTCCATCTCCGC (SEQ ID NO: 2).

[0058] The trigger DNA sequence includes structure 1 and structure 2, specifically ACCATGT-TCATCCCT TGTCAACG (SEQ ID NO: 3).

[0059] Domain 1 is ACCATGT.

[0060] Domain 2 is TCATCCCTTGTCAACG (SEQ ID NO: 4).

[0061] Hairpin 2: 5'-TCAT(BHQ)CCCTTGTCAACG-ATAGTCC-CGTTGACAAGGGAT(FAM)GA-ACATGGT-AAAAAAAAAAAAAAA AAAAAA-Biotin-3' (SEQ ID NO: 5).

[0062] Among them, domain 3 is ATAGTCC;

[0063] Domain 1* is ACATGGT

[0064] Domain 2 is TCATCCCTTGTCAACG, which includes a quenching group BHQ.

[0065] Domain 2* is CGTTGACAAGGGATGA (SEQ ID NO: 6), which includes a fluorescent group FAM.

[0066] Hairpin 3: 5'-Biotin-AAAAAAAAAAAAAAAAAAAAA-GGACTAT-CGTTGACAAGGG ATGA-ACCATGT-TCATCCCTTGTCAACG (SEQ ID NO: 7).

[0067] Among them, domain 3* is GGACTAT;

[0068] Domain 2* is CGTTGACAAGGGATGA

[0069] Domain 1 is ACCATGT.

[0070] Domain 2 is TCATCCCTTGTCAACG.

[0071] Example 2 Reaction system

[0072] A method for label-free fluorescence detection of MC-LR is carried out according to the following steps:

[0073] (1) Formation of H1, H2, and H3 hairpin structures. 100 nM H1, 100 nM H2, and 200 nM H3 were heated at 90°C for 10 minutes in a Tris-HCl buffer solution (100 mM NaCl, 5 mM MgCl2, 200 mM KCl, 1 mM EDTA, pH 7.4) at room temperature. They were then slowly cooled to room temperature to form H1, H2, and H3 hairpin probes, respectively.

[0074] 2) Formation of SA-MB / H1 / H2 / H3 complex The H1, H2, and H3 probes obtained above were incubated with SA-MB (XFB04, 100 μL, 1.0 mg / mL) for 30 minutes to form a SA-MB / H1 / H2 / H3 complex.

[0075] 3) MC-LR detection. After magnetic separation, the MBs were redispersed in 50 mM Tris-HCl buffer. Then, 10 uL of the sample was added to the MB system. After incubation for 45 minutes, the fluorescence spectrum from 500 to 750 nm (Ex = 495 nm,

[0076] Em=525nm). According to the linear relationship between MC-LR concentration and fluorescence intensity, the purpose of detecting MC-LR is achieved.

[0077] Example 3 Sensitivity Detection

[0078] MC-LR standard solutions were prepared with concentrations of 0, 100fM, 1pM, 10pM, 100pM, 1nM and 10nM, respectively, and stored at 4°C.

[0079] MC-LR solutions of different concentrations were added to the reaction system described in Example 2, and the fluorescence intensity was observed after sufficient reaction. Figure 2 ( Figure 2 Middle A: Emission spectra corresponding to different MC-LR concentrations at λex = 495nm; Figure 2 B: The fluorescence standard curve obtained under the condition of λex=525nm and Fλem=525nm) shows that 53fM MC-LR can produce obvious fluorescence changes, indicating that its detection limit is 53fM. As the concentration of MC-LR increases, the fluorescence intensity also increases and gradually tends to saturation.

[0080] Example 4 Specificity Detection

[0081] Prepare 1 nM standard solutions of different MC-LR analogs and potential interfering substances, namely microcystin-LA (MC-LA), microcystin-YR (MC-YR), microcystin-RR (MC-RR), uranyl ion (UO 22+ ), mercury ion (Hg 2+ ), cadmium ions (Cd 2+ ), tetracycline (TET) and ochratoxin A (OTA).

[0082] 1 nM standard solutions of different interfering substances and 1 nM MC-LR solution were added to the reaction system described in Example 1, and the change of fluorescence intensity was observed after sufficient reaction. Figure 3 As shown, 1 nM microcystin-LA (MC-LA), microcystin-YR (MC-YR), microcystin-RR (MC-RR), uranyl ion (UO 2 2+ ), mercury ion (Hg 2+ ), cadmium ions (Cd 2+ ), tetracycline (TET) and ochratoxin A (OTA) fluorescence intensities were much lower than that of 1 nM MC-LR, which proved that this method had good specificity for the detection of MC-LR.

[0083] In summary, the detection method established by the present invention can reach a detection limit of 53 fM at most and has good specificity. It can only specifically detect microcystin-LR, but not microcystin-LA (MC-LA), microcystin-YR (MC-YR), microcystin-RR (MC-RR), uranyl ion (UO 2 2+ ), mercury ion (Hg 2+ ), cadmium ions (Cd 2+ ), tetracycline (TET) and ochratoxin A (OTA) do not undergo specific recognition. The method and kit make the detection process fast and simple, with high sensitivity, and easy to promote and use on a large scale.

Claims

1. A probe targeting microcystin-LR, characterized in that: The probe includes a hairpin probe Hairpin 1, which is composed of a nucleic acid aptamer Aptamer, a trigger DNA sequence, biotin and PolyA; The sequence of the nucleic acid aptamer Aptamer is shown in SEQ ID NO: 2; The trigger DNA sequence is shown in SEQ ID NO:

3.

2. The probe according to claim 1, characterized in that: The sequence of the probe is shown in SEQ ID NO:

1.

3. A set of reagents for detecting microcystin-LR, characterized in that: The reagent comprises the probe and signal amplification reagent according to claim 1; The signal amplification reagent includes a hairpin probe Hairpin 2 and a hairpin probe Hairpin 3; The sequence of the hairpin probe Hairpin 2 is shown in SEQ ID NO: 5; The sequence of the hairpin probe Hairpin 3 is shown in SEQ ID NO:

7.

4. The reagent according to claim 3, characterized in that: The hairpin probe Hairpin 2 and the hairpin probe Hairpin 3 are modified with biotin.

5. The reagent according to claim 4, characterized in that: The hairpin probe Hairpin 2 has a fluorescent group and a quenching group.

6. Use of the probe according to any one of claims 1 to 2 and the reagent according to any one of claims 3 to 5 in the preparation of a product for detecting microcystin-LR.

7. A kit for detecting microcystin-LR, characterized in that: The kit comprises the reagent according to any one of claims 3 to 5.

8. The kit according to claim 7, characterized in that: The kit also includes streptavidin-labeled magnetic beads and a reaction buffer.

9. A method for detecting microcystin-LR, comprising the following steps: 1) Mix the hairpin probes Hairpin 1, Hairpin 2, and Hairpin 3 with the reaction buffer and heat them for annealing; 2) incubating the product obtained in step 1) with streptavidin-labeled magnetic beads to form a complex; 3) Magnetic bead separation, mixing the separated magnetic beads with the sample and detecting.

10. The method according to claim 9, characterized in that: The final concentration of the hairpin probes Hairpin 1, Hairpin 2, and Hairpin 3 is 0.01 μM to 10 μM.

Images