Microcystin-lr rapid detection biosensor
By combining the targeted microcystin-LR probe and signal amplification reagent, and utilizing hairpin probe self-assembly and chain displacement reaction, the problems of complex MC-LR detection and low sensitivity in existing technologies are solved, achieving a fast, simple and highly sensitive detection effect.
Patent Information
- Application Number
- CN202411877343.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-19
- Publication Date
- 2025-10-17
- Estimated Expiration
- 2044-12-19
AI Technical Summary
The existing MC-LR detection method requires bulky instruments and complex sample pretreatment, and has low sensitivity, making it unsuitable for rapid on-site detection.
Using probes and signal amplification reagents targeting microcystin-LR, combined with magnetic beads and a fluorescence-sensitive platform, highly sensitive detection is achieved through self-assembly and chain displacement reactions of hairpin probes.
It realizes fast and simple MC-LR detection, reduces costs, and has high sensitivity and specificity, making it suitable for large-scale promotion and use.
Smart Images

Figure HDA0005197251400000011 
Figure HDA0005197251400000012 
Figure HDA0005197251400000021
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of analytical detection, and particularly relates to a microcystin-LR rapid detection biosensor. BACKGROUND
[0002] Microcystin-LR (MC-LR) is produced by cyanobacteria in water environment due to eutrophication, and has high toxicity even at low concentrations. They can inhibit the activity of protein phosphatase and cause liver damage and even promote tumors through eating contaminated food and drinking water, and thus are considered to have great threat to human health.
[0003] At present, conventional MC-LR detection methods mainly include high performance liquid chromatography (HPLC), liquid chromatography-tandem mass spectrometry (LC / MS / MS) and capillary electrophoresis (CE) methods. Although these methods are accurate, they need bulky instruments, complex sample pretreatment procedures and skilled operators, which are not conducive to rapid on-site detection. In recent years, the method of using aptamer for detecting target objects has attracted much attention, and fluorescence, electrochemical and colorimetric analysis techniques have been established, but most of them exhibit low sensitivity, thus limiting the wide application of these techniques.
[0004] Therefore, it is urgent to use a tandem signal amplification technique for high-sensitivity detection of MC-LR, so as to make the detection process simple and rapid, reduce the cost, and be easy to popularize. SUMMARY
[0005] The first aspect of the present application aims to provide a probe targeting microcystin-LR.
[0006] The second aspect of the present application aims to provide a set of reagents for detecting microcystin-LR.
[0007] The third aspect of the present application aims to provide the use of the probe of the first aspect of the present application and the reagents of the second aspect of the present application.
[0008] The fourth aspect of the present application aims to provide a kit for detecting microcystin-LR.
[0009] The fifth aspect of the present application aims to provide a method for detecting microcystin-LR.
[0010] In order to achieve the above-mentioned purposes of the present application, the technical solutions adopted by the present application are as follows:
[0011] The first aspect of the present application provides a probe targeting microcystin-LR.
[0012] In some embodiments of the present application, the probe comprises a hairpin probe Hairpin 1, which is composed of a nucleic acid aptamer, a trigger DNA sequence, biotin and PolyA.
[0013] In some embodiments of the present application, the sequence of the nucleic acid aptamer Aptamer is shown as SEQ ID NO: 2.
[0014] In some embodiments of the present application, the sequence of the trigger DNA sequence is shown as SEQ ID NO: 3.
[0015] In some embodiments of the present application, the sequence of the probe is shown as SEQ ID NO: 1.
[0016] In some embodiments of the present application, the probe has a domain 1 and a domain 2.
[0017] In some embodiments of the present application, the sequence of the domain 1 is ACCATGT.
[0018] In some embodiments of the present application, the sequence of the domain 2 is TCATCCCTTGTCAACG (SEQ ID NO: 4).
[0019] The second aspect of the present application aims to provide a set of reagents for detecting microcystin-LR.
[0020] In some embodiments of the present application, the reagents comprise the probe of the first aspect of the present application and a signal amplification reagent.
[0021] In some embodiments of the present application, the signal amplification reagent comprises a hairpin probe Hairpin 2 and a hairpin probe Hairpin 3.
[0022] In some embodiments of the present application, the sequence of the hairpin probe Hairpin 2 is shown as SEQ ID NO: 5.
[0023] In some embodiments of the present application, the sequence of the hairpin probe Hairpin 3 is shown as SEQ ID NO: 7.
[0024] In some embodiments of the present application, the sequence of the hairpin probe Hairpin 2 comprises a domain 3 (ATAGTCC), a domain 1* sequence (ACATGGT) complementary to the domain 1, a domain 2 (shown as SEQ ID NO: 4), a domain 2* sequence (shown as SEQ ID NO: 6) complementary to the domain 2, and a PolyA.
[0025] In some embodiments of the present application, the hairpin probe Hairpin 2 has a fluorescent group and a quencher group.
[0026] In some embodiments of the present application, the fluorescent group is selected from any one of FAM, CY3, CY5, HTX, ROX, VIC and HEX; preferably, FAM.
[0027] In some embodiments of the present application, the quencher group is selected from any one of BHQ, TAMRA; preferably, BHQ.
[0028] In some embodiments of the present application, the fluorescent group is located within 5 nucleotides from the 5' end of domain 2 of the hairpin probe Hairpin 2, and the quencher group is located within 5 nucleotides from the 3' end of domain 2*. Of course, one skilled in the art can exchange the positions of the fluorescent group and the quencher group, and achieve similar fluorescence effects.
[0029] In some embodiments of the present application, the sequence of the hairpin probe Hairpin 3 comprises PolyA, domain 3* (GGACTAT) complementary to domain 3, domain 2* sequence (shown in SEQ ID NO: 6) complementary to domain 2, domain 1 (ACCATGT), domain 2 (shown in SEQ ID NO: 4).
[0030] In some embodiments of the present application, the hairpin probe Hairpin 2 and the hairpin probe Hairpin 3 have biotin modification.
[0031] In a third aspect of the present application, a kit for detecting microcystin-LR is provided, comprising the reagent of the second aspect of the present application.
[0032] In some embodiments of the present application, the kit further comprises streptavidin-labeled magnetic beads, and a reaction buffer.
[0033] In some embodiments of the present application, the reaction buffer comprises a Tris-HCl buffer solution. One of the implementable formulations is: 100 mM NaCl, 5 mM MgCl2, 200 mM KCl, 1 mM EDTA, pH 7.4.
[0034] In some embodiments of the present application, the kit can further comprise a negative control standard and a positive control standard.
[0035] In a fourth aspect of the present application, a method for detecting microcystin-LR is provided, comprising the following steps:
[0036] 1) Mix the hairpin probes Hairpin 1, Hairpin 2, Hairpin 3 with reaction buffer, heat and anneal;
[0037] 2) Incubate the product obtained in step 1) with streptavidin-labeled magnetic beads to form a complex;
[0038] 3) Magnetic bead separation, mix the separated magnetic beads with the sample and detect.
[0039] In some embodiments of the present application, the use final concentration of the hairpin probes Hairpin 1, Hairpin 2, Hairpin 3 is 0.01 μM-10 μM.
[0040] In some embodiments of the present application, a specific detection method is provided, comprising:
[0041] (1) Formation of H1 / H2 / H3 complex. Mix H1, H2, H3 (different concentration ratios will result in different signal-to-noise ratios, and the larger the signal-to-noise ratio, the better the experimental results) in Tris-HCl buffer solution (100 mM NaCl, 5 mM MgCl2, 200 mM KCl, 1 mM EDTA, pH 7.4) at room temperature, heat at 90°C for 10 minutes. Then slowly cool to room temperature to form H1 / H2 / H3 complex.
[0042] (2) Formation of SA-MB / H1 / H2 / H3 complex. Incubate 100 nM biotinylated H1, 100 nM biotinylated H2 and 200 nM biotinylated H3 (different concentration ratios will result in different signal-to-noise ratios, and the larger the signal-to-noise ratio, the better the experimental results) with SA-MB (100 μL, 1.0 mg / mL) for 30 minutes to form SA-MB / H1 / H2 / H3 complex. Each experimental condition has a great influence on the experimental results. The optimal condition of each reaction condition is that the corresponding signal-to-noise ratio reaches the maximum. In this way, under the optimal conditions, the experimental results are optimal.
[0043] (3) MC-LR detection. After magnetic separation, disperse the MB in 50 mM Tris-HCl buffer. Then, add the target MC-LR to the MB system. After incubation for 45 minutes, record the fluorescence spectrum (Ex=495 nm, Em=525 nm) from 500 to 750 nm. According to the linear relationship between the concentration of the enzyme-cut substrate strand and the fluorescence intensity, the purpose of detecting MC-LR is achieved.
[0044] The beneficial effects of the present application are:
[0045] This invention uses MC-LR nucleic acid aptamers as sensing elements. Based on aptamer recognition and hairpin probe self-assembly on MBs, it combines a toehold-mediated strand displacement and cyclic hybridization amplification strategy with a fluorescence-sensitive platform to achieve highly sensitive detection of MC-LR. This method simplifies operation and reduces costs. The entire detection process is rapid, and the operational procedures can be mastered without specialized training, facilitating rapid widespread use. It is of great significance for the rapid detection of MC-LR in testing environments. BRIEF DESCRIPTION OF THE DRAWINGS
[0046] The present invention will be further described below with reference to the accompanying drawings and embodiments, in which:
[0047] Figure 1 Schematic diagram of the detection method of the present invention.
[0048] Figure 2 Figure 2 is a sensitivity test result diagram, where A is the fluorescence response result of the biosensor treated with different MC-LR concentrations, B is the corresponding fluorescence intensity of different concentrations of standards at 525 nm, and C is the fitting curve.
[0049] Figure 3 This is a graph showing the results of a specificity experiment. DETAILED DESCRIPTION
[0050] The following will clearly and completely describe the concept and technical effects of the present invention in conjunction with the embodiments to fully understand the purpose, features and effects of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.
[0051] The detection principle of the present invention is:
[0052] In the presence of MC-LR, the binding between MC-LR and the aptamer sequence in H1 forms an MC-LR / H1 complex, in which the trigger DNA (domains 1 and 2) is opened. Then, domain 1 of the trigger DNA can pair with the sticky end (domain 1*) of H2 as a support point of DNA. Through the toehold-mediated strand displacement reaction, domain 2 of the trigger DNA can further hybridize with domain 2* of H2. After strand branch migration (1-1* and 2-2* hybridization), H2 will be opened. In the formed MC-LR / H1 / H2 complex, domains 2 and 3 previously occupied in H2 become free, which can open H3 through the toehold-mediated strand displacement reaction. Importantly, since H3 also contains domains 1 and 2, a circular hybridization reaction between H2 and H3 can occur continuously on the MB. In the formed product (MC-LR / H1 / nH2 / nH3), FAM and BHQ are separated, and a high FAM fluorescence signal can be observed. The MB system can eliminate the need for separate reactions, improve detection speed, and reduce sample loss when the direct circular hybridization reaction is completed on the surface of the MB. In the absence of MC-LR, all hairpin probes remain in a hairpin structure on the MB, and since FAM and BHQ are very close in position in H2, only a background fluorescence signal can be observed. Under optimal conditions, the linear range of this method is from 100 fM to 1 nM, and the detection limit is 53 fM. The method also shows significant selectivity to other possible analogs. Environmental water actual sample MC-LR analysis shows that the method has good precision and accuracy.
[0053] The specific experimental effects are shown in the following examples.
[0054] Example 1 Design and synthesis of primer sequences
[0055] The primer sequences designed in the application are as follows:
[0056] Hairpin 1: 5'-Biotin-AAAAAAAAAAAAAAAAAAA-GGCGCCAAACAGGACCACCATG ACAATTACCCATACCACCTCATTATGCCCCATCTCCATCTCCGC-ACCATGT-TCATCCCT TGTCAACG-3' (SEQ ID NO: 1).
[0057] wherein the MC-LR aptamer is: GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCTCCATCTCCGC (SEQ ID NO: 2).
[0058] The trigger DNA sequence includes structure 1 and structure 2, specifically ACCATGT-TCATCCCT TGTCAACG (SEQ ID NO: 3).
[0059] Domain 1 is ACCATGT.
[0060] Domain 2 is TCATCCCTTGTCAACG (SEQ ID NO: 4).
[0061] Hairpin 2: 5'-TCAT(BHQ)CCCTTGTCAACG-ATAGTCC-CGTTGACAAGGGAT(FAM)GA-ACATGGT-AAAAAAAAAAAAAAA AAAAAA-Biotin-3' (SEQ ID NO: 5).
[0062] Among them, domain 3 is ATAGTCC;
[0063] Domain 1* is ACATGGT
[0064] Domain 2 is TCATCCCTTGTCAACG, which includes a quenching group BHQ.
[0065] Domain 2* is CGTTGACAAGGGATGA (SEQ ID NO: 6), which includes a fluorescent group FAM.
[0066] Hairpin 3: 5'-Biotin-AAAAAAAAAAAAAAAAAAAAA-GGACTAT-CGTTGACAAGGG ATGA-ACCATGT-TCATCCCTTGTCAACG (SEQ ID NO: 7).
[0067] Among them, domain 3* is GGACTAT;
[0068] Domain 2* is CGTTGACAAGGGATGA
[0069] Domain 1 is ACCATGT.
[0070] Domain 2 is TCATCCCTTGTCAACG.
[0071] Example 2 Reaction system
[0072] A label-free fluorescence detection method for MC-LR is carried out according to the following steps:
[0073] (1) Formation of H1, H2, H3 hairpin structure. 100 nM H1, 100 nM H2, 200 nM H3 were heated at 90 °C for 10 min in Tris-HCl buffer solution (100 mM NaCl, 5 mM MgCl2, 200 mM KCl, 1 mM EDTA, pH 7.4) respectively. Then, they were slowly cooled to room temperature to form H1, H2, H3 hairpin probes respectively.
[0074] 2) Formation of SA-MB / H1 / H2 / H3 complex. The above obtained H1, H2, H3 probes were incubated with SA-MB (XFB04, 100 μL, 1.0 mg / mL) for 30 min to form SA-MB / H1 / H2 / H3 complex.
[0075] 3) MC-LR detection. After magnetic separation, the MB was re-dispersed in 50 mM Tris-HCl buffer solution. Then, 10 uL sample was added into the MB system. After incubation for 45 min, the fluorescence spectrum from 500 to 750 nm (Ex = 495 nm, Em = 525 nm) was recorded. According to the linear relationship between MC-LR concentration and fluorescence intensity, the purpose of detecting MC-LR was achieved.
[0076]
[0077] Example 3 Sensitivity detection
[0078] The standard solution of MC-LR was prepared with the concentration of 0, 100 fM, 1 pM, 10 pM, 100 pM, 1 nM and 10 nM respectively, and stored at 4 °C.
[0079] Different concentrations of MC-LR solution were added into the reaction system described in Example 2, and the fluorescence intensity was observed after sufficient reaction, as shown in Fig. 3A (under the condition of λex= 495 nm, the emission spectrum diagram corresponding to different MC-LR concentrations) and Fig. 3B (under the condition of λex= 525 nm, the fluorescence standard curve diagram obtained by Fλem= 525 nm). Figure 2 Figure 2 Figure 2 As shown in Fig. 3A and Fig. 3B, 53 fM of MC-LR can produce obvious fluorescence change, indicating that the detection limit is 53 fM. With the increase of MC-LR concentration, the fluorescence intensity also increases and gradually tends to saturation.
[0080] Example 4 Specificity detection
[0081] The standard solution of 1 nM different MC-LR analogues and potential interfering substances was prepared, which were microcystin-LA (MC-LA), microcystin-YR (MC-YR), microcystin-RR (MC-RR), uranyl ion (UO2 2+ ), mercury ions (Hg 2+ ), cadmium ions (Cd 2+ ), tetracycline (TET) and ochratoxin A (OTA).
[0082] 1 nM standard solutions of different interfering substances and 1 nM MC-LR solution were added to the reaction system described in Example 1, and the changes in fluorescence intensity were observed after sufficient reaction. Figure 3 As shown, 1 nM microcystin-LA (MC-LA), microcystin-YR (MC-YR), microcystin-RR (MC-RR), uranyl ion (UO2 2+ ), mercury ions (Hg 2+ ), cadmium ions (Cd 2+ ), tetracycline (TET) and ochratoxin A (OTA) fluorescence intensities were much lower than 1 nM MC-LR, which proved that this method had good specificity for the detection of MC-LR.
[0083] In summary, the detection method established by the present invention can reach a detection limit of 53 fM at most and has good specificity. It can only specifically detect microcystin-LR, but not microcystin-LA (MC-LA), microcystin-YR (MC-YR), microcystin-RR (MC-RR), uranyl ion (UO2 2+ ), mercury ions (Hg 2+ ), cadmium ions (Cd 2+ ), tetracycline (TET) and ochratoxin A (OTA) do not undergo specific recognition. The method and kit make the detection process fast, simple, and highly sensitive, and are easy to promote and use on a large scale.
Claims
1. A set of reagents for detecting microcystin-LR, characterized by: The reagents include: 1) Probes targeting microcystin-LR; The probe includes a hairpin probe Hairpin 1, which is composed of a nucleic acid aptamer Aptamer, a trigger DNA sequence, biotin and PolyA; The sequence of the nucleic acid aptamer Aptamer is shown in SEQ ID NO: 2; The trigger DNA sequence is shown in SEQ ID NO: 3; 2) Signal amplification reagents; The signal amplification reagent includes a hairpin probe Hairpin 2 and a hairpin probe Hairpin 3; The sequence of the hairpin probe Hairpin 2 is shown in SEQ ID NO: 5; The sequence of the hairpin probe Hairpin 3 is shown in SEQ ID NO: 7; The hairpin probe Hairpin 2 has a fluorescent group and a quenching group.
2. The reagent according to claim 1, characterized in that: The sequence of the probe is shown in SEQ ID NO:
1.
3. The reagent according to claim 1, characterized in that: The hairpin probes Hairpin 2 and Hairpin 3 are modified with biotin.
4. Use of the reagent according to any one of claims 1 to 3 in the preparation of a product for detecting microcystin-LR.
5. A kit for detecting microcystin-LR, characterized in that: The kit comprises the reagent according to any one of claims 1 to 3.
6. The kit according to claim 5, wherein: The kit further comprises streptavidin-labeled magnetic beads and a reaction buffer.
7. A method for detecting microcystin-LR, comprising the following steps: 1) mixing the hairpin probes Hairpin 1, Hairpin 2, and Hairpin 3 according to any one of claims 1 to 3 with a reaction buffer and heating and annealing; 2) incubating the product obtained in step 1) with streptavidin-labeled magnetic beads to form a complex; 3) Magnetic bead separation, mixing the separated magnetic beads with the sample and detecting.
8. The method according to claim 7, wherein: The final concentration of the hairpin probes Hairpin 1, Hairpin 2, and Hairpin 3 is 0.01 μM to 10 μM.
Citation Information
Patent Citations
Nucleic acid aptamer based micro-cantilever array detection method of MC-LR (microcystin LR)
CN108181459A
Biosensor for detecting salmonella based on aptamer and preparation method thereof and application
CN110632300A