Use of OTUD7B as a target in the preparation of products for diagnosing and / or preventing and treating aortic dissection
By detecting and inhibiting the expression of OTUD7B, the early diagnosis and treatment problems of aortic dissection are solved, new therapeutic targets and methods are provided, and the incidence and severity of aortic dissection are reduced.
Patent Information
- Application Number
- CN202411834631.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-13
- Publication Date
- 2025-07-29
- Estimated Expiration
- 2044-12-13
AI Technical Summary
The prior art lacks effective early diagnostic methods and therapeutic means to prevent and treat aortic dissection, and the role of OTUD7B in aortic dissection is not fully understood.
By detecting the expression level of OTUD7B, using reagents and inhibitors such as OTUD7B antibodies, primer pairs, siRNA or shRNA, products and systems for diagnosing and treating aortic dissections, including detection devices and data processing modules, using significant upregulation of OTUD7B as a diagnostic marker, and preventing and treating aortic dissections by inhibiting OTUD7B expression.
Early diagnosis and effective treatment of aortic dissection is achieved, the incidence and severity of aortic dissection is reduced, and new therapeutic targets are provided. OTUD7B inhibitors can prevent and treat aortic dissection.
Smart Images

Figure CN119780433B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of disease diagnosis and treatment, and particularly relates to the application of OTUD7B as a target in the preparation of products for diagnosing and / or preventing and treating aortic dissection. Background Art
[0002] Cardiovascular diseases are circulatory system diseases induced by multiple factors. Due to their complex pathogenesis and the limitations of treatment and prognosis, the incidence and mortality of cardiovascular diseases have been remaining high, and they have become the primary threat factor to human health. Vascular injury is the main pathological form of cardiovascular diseases, and the vascular injury caused by aortic dissection is particularly severe. Aortic dissection can occur at any age and is one of the common, most complex and dangerous aortic diseases in clinical practice. Once rupture and bleeding occur and the patient fails to receive timely diagnosis and treatment, the fatality rate is extremely high. Currently, there is still a lack of effective drugs to limit the progression of aortic dissection in clinical practice, and the only means for the treatment of aortic dissection is still surgical intervention. Therefore, exploring the molecular mechanism of the occurrence of aortic dissection is of great significance for developing new therapeutic targets or strategies to prevent aortic dissection and reduce the mortality of cardiovascular diseases.
[0003] The aorta is a highly complex structure containing various different types of cells, which perform diverse functions to maintain the stable state of the aorta. Recent studies have found that various cell types in the aortic wall may play a role in regulating the occurrence and development of aortic dissection, but their exact mechanisms are still unclear. In past studies, it was considered that the degenerative changes of smooth muscle cells in the media of blood vessels, the gradual loss of the contractile function of smooth muscle cells and the degradation of the extracellular matrix were the main pathogenic mechanisms of aortic dissection. However, more and more studies have found that other cell types in the arterial wall, including endothelial cells, inflammatory cells, especially macrophages, are all involved in the remodeling of smooth muscle cells, the remodeling of the extracellular matrix and tissue repair. At different stages of aortic injury, repair and remodeling, these cells and extracellular components that make up the aortic wall cooperate to adapt to the changing external environment. Using multi-omics methods, such as single-cell sequencing and single-cell spatial omics, to analyze the proteins involved in the progression of aortic dissection and further explore cell transformation, communication between cell populations and key transcription factors in the vascular wall is of great significance for discovering new drug targets for aortic dissection.
[0004] Aortic dissection progresses rapidly, and its clinical diagnosis usually faces certain limitations. Currently, there is no convenient and rapid detection method available. Patients usually undergo imaging examinations, such as ultrasound or computed tomography (CT), to obtain a definite diagnosis after presenting symptoms such as abdominal pain or chest and back pain. As a non-invasive, harmless, and cost-effective method, ultrasound imaging can be used for the diagnosis and monitoring of dissection. CT, on the other hand, helps detect aneurysms that may accompany the dissection, providing important information and intervention plans for surgical intervention. However, these two methods can usually only detect problems in the late stage after the patient shows symptoms, so there is still a lack of biomarkers for early dissection for diagnosis. In addition to traditional imaging techniques, functional imaging PET based on the fluorodeoxyglucose F18 (18F-FDG) tracer can also be used to evaluate aortic dissection. However, due to the non-specificity of the tracer, PET imaging still poses challenges in the diagnostic application of aortic dissection. In recent years, researchers have begun to focus on the metabolic changes during the development of aortic dissection. A variety of metabolites related to aortic dissection have been discovered, including amino acids, succinate, lipid metabolites, and phosphatidylcholine metabolites, etc. However, the specific functions and mechanisms of these metabolites still need to be further verified. Exploring new metabolic markers through metabolomics methods, developing targeted molecular probe technologies, and more sensitive detection methods may contribute to the early detection, early diagnosis, and early treatment of aortic dissection, which is of great significance to the clinic.
[0005] Aortic dissection is a disease with high risk and high fatality rate, and its pathogenesis is still unclear, bringing a heavy burden to patients, their families, and society. Improving the efficiency of diagnosis and treatment and deeply understanding the pathogenesis are the core problems in the study of aortic dissection. Therefore, there is an urgent need to conduct large-scale studies to explore the pathogenesis of aortic dissection from different perspectives in order to provide strategies for the development of treatment regimens that can be used for human treatment in the future.
[0006] OTUD7B (OTU Deubiquitinase 7B) is a deubiquitinase. It has been reported that OTUD7B regulates the cell cycle, tumorigenesis, neural progenitor cell differentiation, inflammatory response, mucosal immunity, and diseases related to the non-canonical NF-kB pathway by catalyzing the deubiquitination of substrates including CyclinB, AuroraA, epidermal growth factor receptor (EGFR), GβL, Sox2, Zap70, and TRAF3. Genomic amplification of OTUD7B is frequently found in human cancers. However, the role of this deubiquitinase in the occurrence of aortic dissection is unknown. Summary of the Invention
[0007] In view of this, the purpose of the present invention is to provide an application of targeting OTUD7B in the preparation of products for the diagnosis and / or prevention and treatment of aortic dissection.
[0008] In order to achieve the above-mentioned invention purpose, the present invention provides the following technical solutions:
[0009] The present invention provides the use of a reagent for detecting OTUD7B expression in the preparation of a product for diagnosing aortic dissection.
[0010] Preferably, the reagent for detecting OTUD7B expression includes an antibody for detecting OTUD7B or a primer pair for detecting OTUD7B.
[0011] Preferably, the sequences of the primer pair for detecting OTUD7B are shown as SEQ ID NO.1 and SEQ ID NO.2.
[0012] The present invention provides the use of an OTUD7B inhibitor in the preparation of a drug for preventing and / or treating OTUD7B.
[0013] Preferably, the OTUD7B inhibitor includes one or both of a reagent for reducing OTUD7B expression and a regulator for reducing OTUD7B products.
[0014] Preferably, the reagent for reducing OTUD7B expression includes a reagent for knocking down or silencing OTUD7B; the regulator for reducing OTUD7B products includes an antibody against OTUD7B or a protease for degrading OTUD7B products.
[0015] Preferably, the reagent for knocking down or silencing OTUD7B includes siRNA, shRNA or miRNA.
[0016] Preferably, the sequences of the shRNA are shown as SEQ ID NO.3 and SEQ ID NO.4.
[0017] The present invention provides a drug for treating aortic dissection, including the shRNA shown as SEQ ID NO.3 and SEQ ID NO.4.
[0018] The present invention provides a system for diagnosing aortic dissection, including a data processing device and a detection device. The detection device is used to detect the expression level of OTUD7B in a test sample and a healthy sample; the data processing device includes a conclusion output module. If the expression level of OTUD7B in the test sample is significantly higher than that in the healthy sample, the test sample is diagnosed as having aortic dissection.
[0019] Compared with the prior art, the present invention has the following beneficial effects:
[0020] The present invention provides an application of OTUD7B as a target in the preparation of products for diagnosing and / or preventing and treating aortic dissection. It is found that compared with healthy people, the expression of OTUD7B is significantly up-regulated in mice with BAPN-induced aortic dissection model and patients with aortic dissection. That is, the detection of the expression of OTUD7B can be used for the diagnosis of aortic dissection. Mice with OTUD7B knockdown in vascular fibroblasts are less likely to develop aortic dissection and elastic fiber degradation under BAPN induction, while mice with high expression of OTUD7B in vascular fibroblasts are more likely to develop aortic dissection and elastic fiber degradation under BAPN induction, indicating that OTUD7B inhibitors can be used for the prevention and / or treatment of aortic dissection. In addition, the study also found that OTUD7B promotes the degradation of the vascular extracellular matrix by regulating the inflammatory phenotype of vascular smooth muscle, and knocking down OTUD7B improves this phenomenon. Therefore, OTUD7B provides a new target for diagnosing and / or preventing and treating aortic dissection. Description of the Drawings
[0021] Figure 1 It is a volcano plot of differentially expressed genes in the ascending aortic vascular tissue of patients with aortic dissection and healthy human blood vessels. Log2(FC) ≥ 1 or ≤ -1, and P.adjust < 0.05 are significantly different genes. Among them, red represents genes with up-regulated expression in the vascular tissue of patients with aortic dissection compared with healthy blood vessels, and blue represents genes with down-regulated expression in the vascular tissue of patients with aortic dissection compared with healthy blood vessels;
[0022] Figure 2 It is the result of up-regulated expression of OTUD7B in single-cell sequencing data of patients with aortic aneurysm and dissection. A is the UMAP clustering map of single cells in the blood vessels of patients with aortic aneurysm and dissection in GSE155468; B is the result that OTUD7B is mainly expressed in fibroblasts; C is the result that the expression content of OTUD7B in fibroblasts in the blood vessels of patients with aortic aneurysm and dissection (n = 3) is significantly increased compared with healthy blood vessels (n = 8);
[0023] Figure 3As a result of the upregulation of OTUD7B expression in fibroblasts in the blood vessels of patients with aortic dissection. A shows the result of increased mRNA levels of OTUD7B in the blood vessel tissues of patients with aortic dissection (Dissection) compared with healthy blood vessel (Healthy) tissues; B shows the result of increased protein expression levels of OTUD7B in the blood vessel tissues of patients with aortic dissection (Dissection) compared with healthy blood vessel (Healthy) tissues; C is a representative immunofluorescence staining diagram of OTUD7B (red), COL1A2 (green) and DAPI (blue) in cross-sections of healthy blood vessel (Healthy) and human aortic dissection (Dissection) blood vessel tissues. The scale bar is 20 μm, where A represents the adventitia and M represents the media; D is the statistical result of the immunofluorescence staining of healthy blood vessel (Healthy) and human aortic dissection (Dissection) blood vessel tissues.
[0024] Figure 4 As a result of the increased expression of OTUD7B in fibroblasts in the blood vessel tissues of a mouse model of aortic dissection. A shows aortic dissection in the blood vessels of mice after BAPN treatment; B shows the mRNA levels of OTUD7B in the blood vessel tissues of control (Water) and aortic dissection (BAPN) mice; C shows the protein levels of OTUD7B in the blood vessel tissues of control (Water) and aortic dissection (BAPN) mice; D is a representative immunofluorescence staining diagram of OTUD7B (red), COL1A2 (green) and DAPI (blue) in cross-sections of blood vessel tissues. The scale bar is 20 μm, where A represents the adventitia and M represents the media; E is the statistical result of the immunofluorescence staining of OTUD7B (red), COL1A2 (green) and DAPI (blue) in cross-sections of blood vessel tissues.
[0025] Figure 5 Construction and identification of mice with specific high expression of OTUD7B in fibroblasts. A is a schematic diagram of the construction of mice with high expression of OTUD7B in fibroblasts (AAV-OTUD7B); B shows the blood vessel morphology of control (AAV-Control) and AAV-OTUD7B mice. The scale bar is 2 mm; C shows the detection of the expression level of OTUD7B in fibroblasts of AAV-COL1A2-Control and AAV-COL1A2-OTUD7B mice, a representative immunofluorescence staining diagram of OTUD7B (red) and DAPI (blue) in cross-sections of blood vessel tissues and the statistical result. The scale bar is 40 μm.
[0026] Figure 6As a result of significantly increased aortic dissection formation due to high expression of OTUD7B in fibroblasts, A is a schematic diagram of the aortic dissection model experiment in AAV-Control and AAV-OTUD7B mice; B is the comparison result of aortic dissection formation between mice with high expression of OTUD7B in fibroblasts (AAV-OTUD7B) and the control group (AAV-Control), the scale bar is 2 mm, C is the comparison result of the aortic dissection formation ratio between mice with high expression of OTUD7B in fibroblasts (AAV-OTUD7B) and the control group (AAV-Control); D is the comparison result of elastic membrane rupture between mice with high expression of OTUD7B in fibroblasts (AAV-OTUD7B) and the control group (AAV-Control), the scale bar is 100 μm;
[0027] Figure 7 As a result of increased inflammation in smooth muscle cells caused by high expression of OTUD7B in fibroblasts, A is a schematic diagram of the method for culturing smooth muscle cells with the conditioned medium of fibroblasts; B is the mRNA levels of smooth muscle cell-related inflammatory factors Mcp-1, Il-6, and Nos2 after high expression of OTUD7B in fibroblasts.
[0028] Figure 8 As a result of knocking down OTUD7B inhibiting the occurrence of aortic dissection, A is the comparison result of OTUD7B expression levels in the blood vessels of mice constructed in different groups; B is the overall blood vessel map of aortic dissection in control and OTUD7B-knockdown mice induced by BAPN; C is the aortic dissection formation ratio in control and OTUD7B-knockdown mice; D is the elastic membrane staining and quantification results in control and OTUD7B-knockdown mice; E is the comparison result of the mRNA levels of inflammatory factors and matrix metalloproteinases in control and OTUD7B-knockdown mice;
[0029] Figure 9 For differential gene and KEGG pathway analysis after knocking down OTUD7B in smooth muscle cells, A is a heat map of differential genes showing that SLC25A1 is downregulated in smooth muscle cells with low expression of OTUD7B; B is the GO functional annotation analysis showing that 14.5% of the differential genes are involved in metabolic-related pathways; C is the result of KEGG analysis showing that the TCA cycle is disturbed;
[0030] Figure 10 As high expression of OTUD7B upregulates the expression of SLC25A1 and the expression of SLC25A1 decreases after knocking down OTUD7B, A is that knocking down OTUD7B in fibroblasts results in a downregulation of the mRNA level of SLC25A1; B is that high expression of OTUD7B in fibroblasts results in an upregulation of the mRNA level of SLC25A1; C is mitochondrial dysfunction after high expression of OTUD7B in fibroblasts. Detailed implementation methods
[0031] The present invention provides an application of a reagent for detecting OTUD7B expression in the preparation of a product for diagnosing aortic dissection.
[0032] In the present invention, the reagent for detecting OTUD7B expression includes an antibody for detecting OTUD7B or a primer pair for detecting OTUD7B. The method for detecting OTUD7B expression can adopt Western Blot or QPCR methods. The sequences of the primer pair for detecting OTUD7B are shown as SEQ ID NO.1 and SEQ ID NO.2. In the present invention, by obtaining the GSE155468 dataset from the GEO database and the RNA transcriptome sequencing of the blood vessels of aortic dissection patients, it is found that the expression level of OTUD7B in the blood vessels of aortic dissection is significantly increased. Further detecting the expression of OTUD7B in the blood vessels of clinical aortic dissection patients and aortic dissection mouse models, the results show that, compared with the control group, the OTUD7B in the blood vessels of aortic dissection patients and aortic dissection mice is significantly increased. On the other hand, a mouse with high expression of OTUD7B in fibroblasts was also constructed, and it was found that high expression of OTUD7B in fibroblasts aggravated the formation of aortic dissection. The above results indicate that targeting OTUD7B can be used to diagnose aortic dissection or evaluate the risk of suffering from aortic dissection.
[0033] The present invention provides an application of an OTUD7B inhibitor in the preparation of a drug for preventing and / or treating OTUD7B.
[0034] In the present invention, the OTUD7B inhibitor includes one or both of a reagent for reducing OTUD7B expression and a regulator for reducing OTUD7B products. The reagent for reducing OTUD7B expression includes a reagent for knocking down or silencing OTUD7B; the regulator for reducing OTUD7B products includes an OTUD7B antibody or a protease for degrading OTUD7B products. The reagent for knocking down or silencing OTUD7B includes siRNA, shRNA or miRNA. The sequences of the shRNA are shown as SEQ ID NO.3 and SEQ ID NO.4. In the present invention, an OTUD7B knockdown mouse was constructed using shRNA, and the results showed that the formation of aortic dissection in the OTUD7B knockdown mouse was weakened and the mortality rate was reduced. Therefore, the OTUD7B inhibitor can be used to prevent and / or treat aortic dissection.
[0035] The present invention provides a drug for treating aortic dissection, including the shRNA shown as SEQ ID NO.3 and SEQ ID NO.4.
[0036] In the present invention, the shRNA can reduce the risk of aortic dissection formation, thereby achieving the purpose of treating aortic dissection. In the present invention, the drug further comprises a pharmaceutically acceptable excipient. The present invention studies and finds that the shRNA shown in SEQ ID NO.3 and SEQ ID NO.4 can be used as the sole active ingredient for preventing and treating aortic dissection.
[0037] The present invention provides a system for diagnosing aortic dissection, comprising a data processing device and a detection device. The detection device is configured to detect the expression levels of OTUD7B in a test sample and a healthy sample; the data processing device comprises a conclusion output module. If the expression level of OTUD7B in the test sample is significantly increased compared with the expression level of OTUD7B in the healthy sample, the test sample is diagnosed as having aortic dissection.
[0038] In the present invention, the data processing device further comprises a data input module, a data recording module and a data comparison module; the data input module is configured to input the expression level values of OTUD7B in the test sample and the healthy sample; the data recording module is configured to store the expression level values of OTUD7B in the test sample and the expression level values of OTUD7B in the healthy sample; the data comparison module is configured to receive the expression level values of OTUD7B in the test sample and the expression level values of OTUD7B in the healthy sample sent by the data input module, and compare the expression level values of OTUD7B in the healthy sample with the expression level values of OTUD7B in the test sample from the data recording module; the conclusion output module is configured to receive the comparison result sent by the data comparison module and determine the comparison result according to a predetermined determination condition. The predetermined determination condition is that if the expression level of OTUD7B in the test sample is significantly increased compared with the expression level of OTUD7B in the healthy sample, the test sample is diagnosed as having aortic dissection.
[0039] In the present invention, unless otherwise specified, all raw material components are commercially available products well-known to those skilled in the art.
[0040] The technical solutions provided by the present invention will be described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.
[0041] In the following embodiments, the preparation method of 0.5% BPAN by concentration is to mix 5 g of BAPN with 1 L of water.
[0042] Example 1
[0043] (1) In the RNA transcriptome sequencing of the blood vessels of patients with aortic dissection, the expression level of OTUD7B is up-regulated
[0044] Research subjects: 18 patients with aortic dissection, with a male-to-female ratio of 7:2, aged 55.4 ± 10.13 years old. Inclusion criteria for aortic dissection disease: Clinically diagnosed as aortic dissection upon admission. Exclusion criteria: Vascular diseases caused by genetic reasons, such as Marfan syndrome. 12 healthy individuals, with a male-to-female ratio of 5:1, aged 51.67 ± 6.46 years old.
[0045] To study the changes of OTUD7B in aortic dissection, the ascending aortic vascular tissues of the above-mentioned aortic dissection patients and the blood vessels of healthy individuals were collected for RNA transcriptome sequencing, differential expression genes were screened, and the expression content of OTUD7B was analyzed.
[0046] Figure 1 The results showed that compared with healthy individuals, the expression content of OTUD7B was significantly increased in the vascular tissues of aortic dissection patients.
[0047] (2) In GSE155468, OTUD7B was mainly highly expressed in fibroblasts
[0048] Screening of single-cell sequencing data of aortic aneurysm and dissection in the GEO database to obtain the GSE155468 dataset. First, use Seurat to re-analyze the dataset. After cell clustering, 11 cell populations including fibroblasts, smooth muscle cells, and macrophages were obtained (see A in Figure 2 ). Analyze the expression content of OTUD7B in each cell population.
[0049] Figure 2 The results showed that OTUD7B was mainly expressed in fibroblasts (see B in Figure 2 ), and the expression content of OTUD7B was significantly increased in the fibroblasts of aortic dissection blood vessels (see C in Figure 2 ).
[0050] (3) In the blood vessels of aortic dissection patients, the expression level of OTUD7B was up-regulated
[0051] To further confirm the relationship between OTUD7B and the formation of aortic dissection, total proteins and RNAs of vascular tissues of clinical aortic dissection patients and healthy individuals were collected and extracted. The mRNA and protein levels of OTUD7B in aortic dissection patients and healthy vascular tissues were measured by real-time fluorescence quantitative PCR. The specific steps are as follows:
[0052] The basic principle of real-time fluorescence quantitative PCR is to utilize the property of DNA polymerase to synthesize new DNA strands during the PCR process, combined with a fluorescently labeled probe or dye, and measure the progress of the PCR reaction by monitoring the increase in fluorescence signal in real time. At the beginning of the PCR reaction, primers complementary to specific regions of the OTUD7B sequence bind to both ends of the DNA template sequence from the patient's blood vessels. The forward primer is 5’-TGTCCGATTGGCCAGTATAA-3’ (SEQ ID NO.1). The reverse primer is 5’-ACAGTGGGATCCACTTCACA-3’ (SEQ ID NO.2).
[0053] In real-time fluorescence quantitative PCR, a fluorescently labeled probe is also added. When the probe binds to the target DNA, it is cleaved by DNA polymerase, releasing fluorescent molecules, resulting in an increase in the fluorescence signal. The intensity of this fluorescence signal is proportional to the amount of target DNA in the PCR reaction.
[0054] The PCR reaction system is 20 μL: 10 μL of 2×SYBR Green qPCR Mix, 6 μL of enzyme-free water, 1 μL of 2 μM forward primer, 1 μL of 2 μM reverse primer, 2 μL of cDNA template;
[0055] The internal reference reaction system is 20 μL: 10 μL of Mastermix, 6 μL of enzyme-free water, 1 μL of 2 μM forward primer for the internal reference 18s, 1 μL of 2 μM reverse primer for the internal reference 18s, 2 μL of cDNA template;
[0056] Among them, the forward primer for the internal reference 18s is 5’-AAACGGCTACCACATCCAAG-3’ (SEQ ID NO.5), and the reverse primer is 5’-CCTCCAATGGATCCTCGTTA-3’ (SEQ ID NO.6).
[0057] The PCR reaction program is the same for both: 95°C for 10 min; 95°C for 10 s, 65°C for 30 s, for 40 cycles.
[0058] The fluorescence value signal is read at the end of each cycle.
[0059] The cycle value at which the fluorescence signal is obtained is recorded, which is the Ct value.
[0060] Adopt 2 -[Ct(内参18S)-Ct(OUD7B)] The relative content of the target gene in the sample is calculated.
[0061] The diseased blood vessels were from patients with aortic dissection who underwent autologous blood vessel replacement, and the healthy tissues were from heart and liver transplant recipients, patients who received TAVI / TAVR (Transcatheter aortic valve implantation / replacement) treatment, or patients who died of non-vascular diseases. Informed consent was obtained from all of them. The samples were carefully transported under dry ice to ensure that the specimen quality was suitable for subsequent experiments.
[0062] Among them, there were 18 cases of aortic dissection patients, including 14 males and 4 females, with an age of 55.44 ± 10.13 years old. The inclusion criteria for aortic dissection disease were: clinically admitted diagnosis of aortic dissection. Exclusion criteria: vascular diseases caused by genetic reasons, such as Marfan syndrome. There were 12 cases of healthy people, including 10 males and 2 females, with an age of 51.67 ± 6.46 years old.
[0063] Figure 3 The results showed that compared with healthy blood vessels, the mRNA of OTUD7B (see A in Figure 3 and the protein level (see B in Figure 3 ) in the vascular tissues of aortic dissection patients were significantly increased, indicating that OTUD7B may be involved in the occurrence and development of aortic dissection.
[0064] To further confirm the main cell types expressing OTUD7B, an immunofluorescence staining experiment was conducted.
[0065] Figure 3 The results in C - D in
[0066] showed that compared with healthy blood vessels, OTUD7B was highly expressed in fibroblasts of the vascular tissues of aortic dissection patients.
[0067] Subsequently, a mouse model of aortic dissection was established. Three-week-old wild-type C57 mice were randomly divided into two groups: a control group and a BAPN treatment group, with 10 mice in each group. In the BAPN treatment group, mice were fed with 0.5% BPAN (β-Aminopropionitrile) in drinking water for 4 weeks, and in the control group, mice were fed with water for 4 weeks and then sacrificed. The whole aortic tissue was taken, and after partial fixation, aortic sections were made, and immunofluorescence staining was used to detect the expression of OTUD7B protein. The remaining aortic tissue was snap-frozen in liquid nitrogen. One part was used to extract RNA, and QPCR was used with primers F: TGTCCGATTGGCCAGTATAA (SEQ ID NO.1) and R: ACAGTGGGATCCACTTCACA (SEQ ID NO.2) to detect the mRNA expression of OTUD7B; one part was used to extract protein, and Western Blot was used to detect the expression of OTUD7B protein.
[0068] The results showed that aortic dissection formed after BAPN treatment (see A in Figure 4 ), and the expression of OTUD�B in the BAPN treatment group was significantly higher than that in the control group (see B - C in Figure 4 ).
[0069] Meanwhile, the cross-sections of vascular tissues in the control group and the BAPN treatment group were subjected to immunofluorescence staining respectively, and it was found that the fluorescence intensity of OTUD�B in the BAPN treatment group was significantly increased in Clo1a2-positive cells (see D - E in Figure 4 ).
[0070] (5) Constructing mice with high expression of OTUD�B in fibroblasts
[0071] Mice with high expression of OTUD7B in fibroblasts were constructed. The overexpression plasmid pAd-track-OTUD7B (the sequence of OTUD7B is shown in Gene ID: 229603 of NCBI, constructed and synthesized by Shanghai Hanheng Biotechnology Co., Ltd.) or pAd-track (purchased from Shanghai Hanheng Biotechnology Co., Ltd.) was transformed into Escherichia coli BJ5183 for recombination. Then, monoclonal colonies were picked. After successful enzymatic digestion identification, it was transformed into Escherichia coli DH5A. After bacterial liquid amplification and plasmid extraction, it was linearized with the restriction endonuclease PAC1. This linearized plasmid was transfected into 293A cells to construct an adeno-associated virus (AAV2 / 9-COL1A2-OTUD7B-Flag) or AAV-COL1A2-control in which the fibroblast-specific promoter (COL1A2) drives the expression of OTUD7B. The AAV2 / 9-COL1A2-OTUD7B-Flag or AAV-COL1A2-control was respectively injected into the tail vein at a dosage of 10^12 vg / rat, thus enabling the overexpression of the OTUD7B gene, and mice with high expression of OTUD7B in fibroblasts (AAV-OTUD7B) and control mice (AAV-control) were respectively obtained.
[0072] Three weeks later, the blood vessels were isolated and taken out (see A in Figure 5 ), and there was no abnormality in the appearance of the blood vessels (see B in Figure 5 ). The expression of OTUD7B in the adventitia of mouse blood vessels was detected by immunofluorescence staining. The immunofluorescence staining results showed that OTUD7B was highly expressed in the adventitia of mouse blood vessels (see C in Figure 5 ), indicating that mice with high expression of OTUD7B in fibroblasts were successfully constructed.
[0073] (6) High expression of OTUD7B promoted the formation of BAPN-induced aortic dissection in mice
[0074] Referring to the method in step (5), control mice (AAV-control) and mice with high expression of OTUD7B in fibroblasts (AAV-OTUD7B) were constructed, with 8 mice in each group. One week after virus injection into the tail vein, AAV-control and AAV-OTUD7B mice were respectively fed with 0.5% BPAN (β-Aminopropionitrile) in drinking water for 4 weeks, and then vascular phenotype analysis was performed on the two groups of mice. The specific experimental schematic diagram is shown in A in Figure 6 .
[0075] The results showed that compared with the blood vessels of AAV-control mice, the aortic dissection in AAV-OTUD7B mice was more severe, suggesting that high expression of OTUD7B in fibroblasts aggravated the formation of aortic dissection (seeFigure 6 in B).
[0076] During the induction with BAPN, the mortality of mice was counted. The results showed that compared with AAV-control mice, AAV-OTUD7B mice had a higher incidence of aortic dissection (see Figure 6 in C), and more elastic membrane breaks (see Figure 6 in D).
[0077] (7) High expression of OTUD7B in fibroblasts leads to increased inflammation of smooth muscle cells
[0078] The effect of overexpression of OTUD7B in fibroblasts on the inflammation of smooth muscle cells was detected in cells. The pCDH-Otud7b treatment group was constructed by inserting OTUD7B into the lentiviral pCDH vector (the sequence of the OTUD7B is shown in Gene ID: 229603 of NCBI , commissioned by Hanheng Biotechnology (Shanghai) Co., Ltd. for synthesis), obtaining pCDH-Otud7b. The viral packaging plasmids PxpAx2: PMD2g: pCDH-Otud7b were transfected into 293 cells at a ratio of 4:3:1. After 48 hours, the supernatant was collected to obtain a lentivirus with high expression of pCDH-OTUD7B, which was added to fibroblasts, and then OTUD7B was overexpressed. After culturing for 48 hours, the culture medium was collected and added to smooth muscle cells (see Figure 7 in A). Among them, the control group was transfected with the viral packaging plasmids PxpAx2: PMD2g: pCDH at a ratio of 4:3:1 into 293 cells. After 48 hours, the supernatant was collected and added to fibroblasts. After culturing for 48 hours, the culture medium was collected and added to smooth muscle cells, with 5 parallel experiments in each group. The expression levels of pro-inflammatory factors MCP-1, IL-6, and NOS2 in smooth muscle cells of the control group and the pCDH-Otud7b treatment group were detected by real-time quantitative PCR.
[0079] Compared with the control group, after culturing smooth muscle cells in the culture medium of fibroblasts with high expression of OTUD7B, the expression of pro-inflammatory factors MCP-1, IL-6, and NOS2 in smooth muscle cells increased (see Figure 7 in B), indicating that OTUD7B in fibroblasts promoted the inflammatory damage of smooth muscle cells.
[0080] (8) Knockdown of OTUD7B inhibited the formation of BAPN-induced aortic dissection in mice
[0081] To verify the effect of OTUD7B on aortic dissection formation in vivo, OTUD7B knockdown mice were constructed. The knockdown plasmid pAd-track-OTUD7B-shRNA was transformed into Escherichia coli BJ5183 for recombination. Then, monoclonal colonies were picked. After successful enzyme digestion identification, it was transformed into Escherichia coli DH5A. After bacterial liquid amplification and plasmid extraction, it was linearized with the restriction enzyme PAC1. This linearized plasmid was transfected into 293A cells to obtain an adeno-associated virus with OTUD7B knockdown shRNA. Then, 3-week-old WT mice were selected and injected with the adeno-associated virus with OTUD7B knockdown shRNA via the tail vein. The injection dose per day per mouse was: 10 11 vg / mouse, and it was injected once. Seven days after the tail vein injection, OTUD7B knockdown mice (Otud7b-si group) were obtained.
[0082] The shRNA sequence constructed by OTUD7B knockdown shRNA:
[0083] OTUD7B-shRNA-F: 5’
[0084] -CCGGGAGCACTATGAGGATCGCAATCTCGAGATTGCGATCCTCATAGTGCT CTTTTTG-3’ (SEQ ID NO.3);
[0085] OTUD7B-shRNA-R: 5’
[0086] -AATTCAAAAAGAGCACTATGAGGATCGCAATCTCGAGATTGCGATCCTCAT AGTGCTC-3’ (SEQ ID NO.4).
[0087] Among them, pAd-track-OTUD7B-shRNA was constructed by Hanheng Biotechnology (Shanghai) Co., Ltd. using the above shRNA sequence.
[0088] Among them, the control group (NC) was a virus that did not contain the shRNA sequence.
[0089] After feeding Otud7b-si mice and NC mice with 0.5% BPAN (β-Aminopropionitrile) in drinking water for 4 weeks respectively, the mortality rates were counted separately. Western Blot was used to detect the expression of OTUD7B protein.
[0090] Figure 8 The result in A shows that the expression level of OTUD7B in the blood vessels of Otud7b-si group mice decreased significantly compared with that of NC. Therefore, the present invention successfully constructed OTUD7B knockdown mice.
[0091] After taking the whole aortic tissue, photographs were taken under a stereomicroscope to compare the morphological changes of the aortic blood vessels and the severity of dissection.
[0092] Figure 8 Result B in [reference] showed that compared with the control group, the formation of aortic dissection was weakened in OTUD7B knockdown mice.
[0093] Figure 8 Result C in [reference] showed that compared with the control group, the proportion of dissection formation decreased in OTUD7B knockdown mice.
[0094] The ascending aorta was taken for fixation, sectioned after paraffin embedding, and HE staining and EVG staining were performed on each group to compare the differences in the rupture of vascular elastic fibers.
[0095] The results showed that compared with the control group, the degradation of extracellular elastic fibers was significantly reduced in OTUD7B knockdown mice (see Figure 8 D in [reference]).
[0096] Subsequently, the aortic tissues frozen in liquid nitrogen in each group were taken to detect the mRNA level and protein level of inflammatory factors.
[0097] The results showed that compared with the control group, vascular inflammation was weakened and the expression of extracellular matrix metalloproteinases decreased in OTUD7B knockdown mice (see Figure 8 E in [reference]).
[0098] (9) OTUD7B promotes aortic dissection by affecting the mitochondrial function of cells
[0099] To deeply explore the mechanism by which OTUD7B is involved in the occurrence and development of aortic dissection, the existing transcriptome sequencing data of smooth muscle cells with OTUD7B knockdown were re-analyzed. The control group was smooth muscle cells without any gene editing.
[0100] The results showed that compared with the control group, after low expression of OTUD7B, 14.5% of the differential genes regulated metabolic processes (see Figure 9 A, B in [reference]).
[0101] KEGG signaling pathway analysis showed that low expression of OTUD7B disrupted glycolysis, metabolic pathways, FcγR-mediated phagocytosis, citrate cycle, pyruvate metabolism, etc. in smooth muscle cells (see Figure 9In C) of [reference], it is indicated that there are disorders in multiple biological processes such as citrate transport and tricarboxylic acid cycle in smooth muscle cells with low expression of OTUD7B, and OTUD7B may participate in the regulation of the formation of aortic dissection by affecting the mitochondrial function of cells.
[0102] (10) OTUD7B reduces the inflammatory level of vascular smooth muscle cells through the citrate transporter
[0103] In fibroblasts with low expression of OTUD7B (obtained by adding the above-mentioned constructed and synthesized adeno-associated virus of OTUD7B knockdown shRNA to cultured fibroblasts) and fibroblasts with high expression of OTUD7B (obtained by adding the above-mentioned constructed and synthesized lentivirus with high expression of pCDH-OTUD7B to cultured fibroblasts), the control group (NC) was added with a control virus, that is, a virus that does not contain the siRNA sequence or the pCDH vector does not carry OTUD7B. There were 5 parallels in each group, and the mRNA level of the citrate transporter SLC25A1 was detected.
[0104] The results showed that compared with the control group, in fibroblasts with low expression of OTUD7B, the mRNA level of the citrate transporter SLC25A1 was significantly down-regulated (see Figure 10 in A) of [reference], and in fibroblasts with high expression of OTUD7B, the mRNA level of SLC25A1 was significantly up-regulated (see Figure 10 in B) of [reference], resulting in mitochondrial dysfunction (see Figure 10 in C) of [reference].
[0105] In summary, it can be known from the present invention that overexpression of OTUD7B promotes the occurrence of aortic dissection, knockdown of OTUD7B inhibits the occurrence of aortic dissection, and OTUD7B can be used for the diagnosis of aortic dissection by detection. Mechanistically, overexpression of OTUD7B promotes the inflammation of vascular smooth muscle cells and the expression of matrix metalloproteinases by promoting the expression of the citrate transporter SLC25A1, thereby promoting the occurrence of aortic dissection.
[0106] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.
Claims
1. Use of a reagent for detecting OTUD7B expression in the preparation of a product for diagnosing aortic dissection.
2. The application according to claim 1, characterized in that, The reagent for detecting OTUD7B expression includes an antibody for detecting OTUD7B or a primer pair for detecting OTUD7B.
3. The application according to claim 2, characterized in that, The sequences of the primer pair for detecting OTUD7B are shown as SEQ ID NO.1 and SEQ ID NO.
2.
4. Use of an OTUD7B inhibitor in the preparation of a drug for preventing and / or treating aortic dissection.
5. The application according to claim 4, wherein The OTUD7B inhibitor includes one or both of a reagent for reducing OTUD7B expression and a modulator for reducing OTUD7B products; The reagent for reducing OTUD7B expression includes a reagent for knocking down or silencing OTUD7B; the modulator for reducing OTUD7B products includes an antibody against OTUD7B or a protease for degrading OTUD7B products.
6. The application according to claim 5, wherein The reagent for knocking down or silencing OTUD7B includes siRNA, shRNA or miRNA.
7. The application according to claim 6, wherein The sequence of the shRNA is shown as SEQ ID NO.3 and SEQ ID NO.
4.
8. A drug for treating aortic dissection, characterized in that, Includes shRNA shown as SEQ ID NO.3 and SEQ ID NO.
4.
9. A system for diagnosing aortic dissection, characterized in that, Includes a data processing device and a detection device. The detection device is for detecting the expression level of OTUD7B in a sample to be tested and a healthy sample. The data processing device includes a conclusion output module. If the expression level of OTUD7B in the sample to be tested is significantly increased compared with that in the healthy sample, the sample to be tested is diagnosed as having aortic dissection.
Citation Information
Patent Citations
Recombinant DNA constructs and methods for modulating expression of a target gene
CN106995819A
Application of XOR protein or coding gene thereof as target spot in preparation of medicine for preventing and / or treating vascular calcification
CN117849342A