Method for analyzing RNA degradation

Abstract

The present invention generally relates to methods of analyzing ribonucleic acids (RNAs). In particular, the present invention relates to a method of analyzing RNA to assess the level of RNA molecule degradation in an RNA sample. The method uses exonuclease and means for detecting nucleotides and / or nucleosides. The present invention provides a method for analyzing ssRNA in a sample, the method comprising: (a) contacting the sample with a probe wherein the probe binds to a target region of ssRNA in the sample; (b) incubating the sample together with a single strand specific ribonucleic acid exonuclease; and (c) detecting the nucleotides and / or nucleosides generated by step (b), wherein the nucleotides and / or nucleosides are derived from one or more RNA regions located outside the target region of ssRNA in the sample. The invention also provides a kit for carrying out the method.

Description

[0001] The present invention generally relates to methods for analyzing ribonucleic acid (RNA). In particular, the present invention relates to methods for analyzing RNA to assess the level of RNA molecule degradation in an RNA sample. The method uses exonucleases and means for detecting nucleotides and / or nucleosides.

[0002] RNA is an essential polymer molecule in a variety of biological processes, including gene expression. Therefore, biochemical researchers are eager to analyze specific RNA molecules of interest, while practitioners are eager to use RNA molecules such as microRNA (miRNA) and messenger RNA (mRNA) in RNA therapy.

[0003] However, RNA is relatively unstable, so RNA samples must be stored at low temperatures and handled carefully to avoid the introduction of ribonucleases, avoid shear stress, and minimize hydrolysis. Even with these measures, some level of RNA degradation will occur once the RNA sample is thawed and put into use, so the concentration of the RNA molecule of interest (i.e., intact, functional RNA molecules) will be lower than the concentration initially recorded. Therefore, it is very important to know the absolute and / or relative concentration of the intact RNA molecule of interest in the sample when it is put into use.

[0004] In order to avoid overestimating the concentration of intact RNA molecules of interest in a sample, it is best to measure the level of RNA degradation that has occurred. In industry, capillary gel electrophoresis platforms can be used to measure the degradation level of RNA samples. However, such platforms are not designed for the analysis of synthetic RNA and lack sensitivity. For example, measuring the integrity of RNA molecules based on size differences is particularly challenging for large RNA molecules because hydrolysis of small RNA fragments from larger RNA molecules produces degradation products with sizes and / or charge-to-size ratios that are very close to those of the parent RNA. Therefore, a more sensitive method is needed to quantify RNA degradation in RNA samples.

[0005] The present inventors have developed a highly sensitive method for measuring RNA degradation. Specifically, the present invention provides a method for analyzing (or evaluating) single-stranded RNA (ssRNA) in a sample, the method comprising:

[0006] (a) contacting the sample with a probe, wherein the probe binds to a target region of ssRNA in the sample;

[0007] (b) incubating the sample with a single-stranded specific exoribonuclease; and

[0008] (c) detecting the nucleotides and / or nucleosides generated by step (b), wherein the nucleotides and / or nucleosides include nucleotides and / or nucleosides from one or more RNA regions located outside the target region of the ssRNA in the sample.

[0009] The method of the present invention is based on the combined use of a single-stranded specific exoribonuclease and a probe, wherein the probe is used to block the degradation of the ssRNA target site by the exoribonuclease.

[0010] Degradation of ssRNA in a sample over time (whether enzymatically, chemically or otherwise) results in the formation of increasing numbers of 3' and 5' ends. The more 3' and 5' ends available for cleavage by an exoribonuclease, the more nucleotides and / or nucleosides are released when the exoribonuclease acts on the sample. Therefore, the level of nucleotides and / or nucleosides produced by incubating an ssRNA sample with an exoribonuclease can be used to determine the level of degradation of the ssRNA in the sample (see Fig.10 ).

[0011] However, it has been found that incubating ssRNA with exoribonucleases alone is not sufficient to accurately determine the level of degradation. This is because exoribonuclease incubation releases a significant amount of nucleotides and / or nucleosides, which is independent of the degree of degradation of the ssRNA in the sample. Specifically, these cleavage products are derived from the cleavage of the free ends present in the intact ssRNA molecules in the sample (3' end and / or 5' end, depending on the directionality of the exoribonuclease used in the method). Therefore, when exoribonucleases are used alone, a large amount of background signal (or "noise") is always generated.

[0012] By adding a probe that binds to the end of an ssRNA molecule in the sample (more specifically, the probe binds to the 3' end of an ssRNA molecule when a 3'->5' exoribonuclease is used, or alternatively, the probe binds to the 5' end of an ssRNA molecule when a 5'->3' exoribonuclease is used), the exoribonuclease is prevented from cleaving regions of the ssRNA that are not indicative of RNA degradation, thereby reducing background signal levels and increasing sensitivity. In other words, the single-stranded specific exoribonuclease cannot digest free 3' or 5' ends that are not the result of degradation because the double-stranded nucleic acid region formed by the probe is not a substrate for the single-stranded specific exoribonuclease (or the probe blocks the exoribonuclease by shielding the binding region of the ssRNA).

[0013] For example, in the case of measuring the level of mRNA degradation in a sample, the exoribonuclease can be a 3'->5' exoribonuclease, and the target region of the mRNA can be a poly(A) tail. The probe - e.g., a poly(dT) oligonucleotide, also known as oligo(dT) - binds (or hybridizes) to the poly(A) tail, thereby protecting it from degradation by the exoribonuclease.

[0014] The method of the present invention can detect low levels of RNA degradation in RNA samples, possibly levels of 0.1%, or even lower. The method of the present invention has a higher sensitivity than methods that use capillary gel electrophoresis to measure RNA degradation.

[0015] The methods of the present invention are also advantageous in that the signal output (eg light output) generated by step (c) may be detected using single-throughput or high-throughput detection hardware.

[0016] The methods of the present invention can also be applied to measure 5' capping efficiency and poly(A) tail length in mRNA molecules, as further described below.

[0017] The method of the present invention can also be used to measure the binding efficiency of the probe (which can be a candidate oligonucleotide probe or another candidate ssRNA binding molecule or entity) to the target region. As further described below, this can be useful for analyzing the degree of binding (or hybridization or complementarity) of the probe to the target region within the ssRNA molecule of interest, and / or for assessing stem-loop formation or hairpin formation (i.e., the tendency of the ssRNA of interest to form secondary structures such as hairpins). Therefore, more specifically, the method of the present invention can be used to assess or measure the degree of binding of the probe to the target region, or to assess or measure stem-loop formation or hairpin formation in ssRNA.

[0018] The method of the invention is a method of analyzing ssRNA in a sample (or a method for the same). Alternatively, the method of the invention can be regarded as a method of evaluating, examining, inspecting, studying, reviewing or evaluating ssRNA in a sample (or a method for the same). Preferably, the method of the invention is a method of quantifying or identifying the RNA portion of interest in an ssRNA sample.

[0019] The RNA portion of interest may be a complete RNA (e.g., mRNA) molecule, or of course, in connection therewith, the RNA portion of interest may be an RNA fragment resulting from RNA degradation. Thus, the portion may be a whole RNA molecule or fragment. Alternatively, the portion may be a poly A tail, where the length is quantified. In yet another embodiment, the RNA portion may be a 5' capping group, and one may be interested in understanding how effective a certain cap structure is in preventing digestion, or in determining the proportion of mRNA molecules in the sample that incorporate a cap.

[0020] "ssRNA sample" is a sample comprising ssRNA. The term "ssRNA" refers to an ssRNA molecule, or one or more ssRNA molecules, or multiple ssRNA molecules, depending on the context in which it is used. Typically, the term "ssRNA" refers to an ssRNA molecule or a type of ssRNA molecule, such as a type of ssRNA with a specific sequence or sharing a specific sequence or feature. For example, mRNA is a ssRNA molecule that can be analyzed by the method of the present invention. Different messenger RNA molecules may differ in certain regions, such as different sequences in their protein coding regions; however, since they are messenger RNA molecules, they all have certain common features, such as they all encode proteins and generally have poly (A) tails and 5' caps. Non-coding RNA (such as long non-coding RNA) can also be analyzed by the method of the present invention.

[0021] As used herein, the term "ssRNA" also encompasses modified ssRNA. The modified ssRNA contains one or more modified nucleotides or regions. One or more or all nucleotides or regions in the molecule can be modified. The modified ssRNA can be modified in the sugar and / or core base regions. Therefore, the nucleotides and / or nucleosides produced by step (b) of the present invention can be nucleotide analogs and / or nucleoside analogs.

[0022] Examples of sugar modifications include phosphorodiamidate morpholino oligomers (PMO); 2'-O-methoxyethyl; 2'-O-methyl (2'-OMe); 2'-fluoro (2'-F); 2'-deoxy-2'-fluoroarabinose nucleic acid (FANA); locked nucleic acid (LNA); unlocked nucleic acid (UNA); threose nucleic acid (TNA); 1,5-anhydrohexitol nucleic acid (HNA); cyclohexene nucleic acid (CeNA); and glycol nucleic acid (GNA). Examples of nucleobase modifications include 5-methoxyuridine; pseudouridine; N1-methylpseudouridine; 5-methylcytosine; abasic nucleosides; and 5-fluorobenzofuran-2-deoxyuridine.

[0023] Modified mRNA is generally used in mRNA-based therapy, and the ssRNA of the present invention is preferably 5-methoxyuridine, pseudouridine or N1-methylpseudouridine modified mRNA.

[0024] The sample may be a product for pharmaceutical, prognostic, diagnostic or research use, which has been manufactured in a laboratory or on an industrial scale. The sample may be isolated from humans or other animals, plants or other organisms. The sample may be purified or partially purified, but may not be.

[0025] The method of the present invention can be at least partially automated, so that one or more steps of the method can be performed without human involvement (or without human involvement). The method of the present invention can be automated (or fully automated or fully automated), for example, so that all steps of the method can be performed without human involvement (or without human involvement).

[0026] The method of the present invention is an in vitro (and / or ex vivo) method.

[0027] The sample is preferably a solution comprising ssRNA and optionally a buffer solution.

[0028] The methods of the present invention can be applied to the analysis of any ssRNA (i.e., any ssRNA molecule or type of ssRNA molecule, including modified RNA as discussed above). For example, the ssRNA may be a synthetic or artificial ssRNA. Alternatively, the ssRNA may be non-synthetic, such as a eukaryotic, bacterial, archaeal or viral ssRNA. Preferably, the ssRNA is an ssRNA comprising a poly(A) sequence (i.e., a poly(A) tail) at its 3' end and / or a 5' cap. More preferably, the ssRNA is an mRNA, more preferably a eukaryotic mRNA.

[0029] Step (a)

[0030] The method of the present invention comprises step (a), namely contacting a sample with a probe, wherein the probe binds to a ssRNA target region in the sample.

[0031] The probe used in the method of the present invention can be any molecule or entity that can bind to ssRNA. Binding is usually an annealing or hybridization reaction, but the probe can be or include, for example, an RNA binding protein. The RNA binding protein should specifically recognize and bind to the target region. For example, when the target region is a poly (A) tail, the RNA binding protein can be a poly (A) binding protein (PABP).

[0032] The step of contacting the sample with the probe may include combining (or mixing or blending) the probe and the sample. Typically, the step of contacting the sample with the probe includes adding the probe to the sample. Alternatively, the step of contacting the sample with the probe may include adding the sample to a solution comprising the probe.

[0033] In order to allow the probe to bind (or hybridize or anneal) to the target region of the ssRNA, heating and cooling steps can be used. For example, the contacting step can include mixing the probe and the ssRNA sample, heating the mixture, and then cooling the mixture. More preferably, this may include heating at about 80°C for two minutes and then cooling to room temperature. Such methods for promoting binding (or hybridization) are well known in the art, for example, used in multi-temperature polymerase chain reaction (PCR) protocols.

[0034] The probe can be an oligonucleotide, which term includes oligonucleotides containing modified nucleic acids / nucleotides. The modified nucleic acids / nucleotides are structurally similar to naturally occurring RNA or DNA, but contain one or more natural or synthetic connections or modifications. One or more modifications can be located in any region of the compound, such as in the backbone region (more preferably in the sugar and / or phosphate region) and / or the nucleobase region. Therefore, the oligonucleotide can have an alternative (or modified) backbone, nucleobase or sugar ring chemistry. Of course, in the context of the probe used in the present invention, any such modification must make the oligonucleotide (still) have the ability to bind (or fully bind) to the ssRNA target region.

[0035] Examples of backbone modifications include phosphorothioate (PS); N3'->P5' phosphoramidate (NP); 2',5'-phosphodiester; and peptide nucleic acid (PNA). Examples of sugar modifications include phosphorodiamidate morpholino oligomers (PMO); 2'-O-methoxyethyl; 2'-O-methyl (2'-OMe); 2'-fluoro (2'-F); 2'-deoxy-2'-fluoroarabinose nucleic acid (FANA); locked nucleic acid (LNA); unlocked nucleic acid (UNA); threose nucleic acid (TNA); 1,5-anhydrohexitol nucleic acid (HNA); cyclohexene nucleic acid (CeNA); and glycol nucleic acid (GNA). Examples of nucleobase modifications include 5-methoxyuridine; pseudouridine; N1-methyl pseudouridine; 5-methylcytosine; abasic nucleosides; and 5-fluorobenzofuran-2'-deoxyuridine. Such modifications may be advantageous because they may confer greater affinity for RNA, greater stability, or greater resistance to degradation, thereby providing the probe with improved ability to prevent exoribonuclease degradation of the ssRNA target region.

[0036] Preferably, the probe is a deoxyribonucleic acid (DNA) probe or an RNA probe, more preferably a DNA probe. In other words, preferably, the probe is a DNA molecule or an RNA molecule, more preferably a DNA molecule. Optionally, the 5' or 3' phosphorylation state of the probe can be changed so that the probe cannot be recognized by an exoribonuclease.

[0037] Preferably, the probe is an oligonucleotide, i.e. a single-stranded polynucleotide containing a relatively small number of nucleotides. Thus, the oligonucleotide may have a length of up to 300, 290, 280, 270, 260, 250, 240, 230, 220, 210, 200, 190, 180, 170, 160, 150, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 40, 30, 25, 20, 19, 18, 17, 16 or 15 nucleotides. Alternatively or in addition, the length that oligonucleotide can have is at least 15,16,17,18,19,20,21,22,23,24,25,50,100,110,120,130,140,150,160,170,180,190 or 200 nucleotides.More preferably, the length that oligonucleotide has is 5 to 300,5 to 250,5 to 200,5 to 150,5 to 100,5 to 50 or 5 to 25 nucleotides.Alternatively, the length that oligonucleotide can have is 10 to 300,50 to 300,100 to 300,150 to 300,200 to 300 or 250 to 300 nucleotides. Alternatively, the oligonucleotide may have a length of 5 to 250, 10 to 250, 50 to 250, 100 to 250, 150 to 250 or 200 to 250 nucleotides. Preferably, the oligonucleotide has a length of 15 to 100 nucleotides, more preferably 20 to 60 nucleotides, such as 25 to 45 nucleotides.

[0038] More preferably, the oligonucleotide is a DNA oligonucleotide or a RNA oligonucleotide, more preferably a DNA oligonucleotide.

[0039] The probe used in the method of the invention binds to or hybridizes with (or is suitable for or capable of binding to or hybridizing with) a target region of ssRNA in a sample.

[0040] From another perspective, the probe used in the method of the present invention is preferably complementary to the target region of the ssRNA in the sample. The term "complementary" includes "partial complementarity" and "complete complementarity". In a preferred embodiment, the probe is completely complementary to the target region of the ssRNA in the sample. As understood in the art, an oligonucleotide probe that is completely (i.e., 100%) complementary to the target region is an oligonucleotide that exhibits Watson-Crick base pairing with the target region throughout the oligonucleotide probe sequence.

[0041] In contrast, an oligonucleotide probe that is partially complementary to a target region can be defined as an oligonucleotide that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% complementarity to the target region. Percent complementarity refers to the percentage of bases (i.e., nucleobases or nitrogenous bases) in the probe that exhibit Watson-Crick base pairing with bases in the target region.

[0042] In an embodiment, a saturated (or excess) amount or concentration of probes can be used. This means that the molar (or stoichiometric) ratio of probe molecules to target region copies is at least 1:1 (i.e., the molar ratio of probe molecules to complete ssRNA copies is 1:1). It is preferred to use an excess amount or concentration of probes, more preferably (or at least) an excess of 2 times, 3 times, 4 times, 5 times, 10 times, 50 times, 100 times, 500 times, 1000 times, 2000 times, 3000 times, 4000 times, 5000 times or 10,000 times. It is advantageous to use a saturated or excess amount or concentration of probes because the greater the ratio of probes to target region copies, the greater the percentage of target region copies that the probe binds to or hybridizes to (or blocks).

[0043] A "target region" is typically a sub-portion of an ssRNA whose sequence has been predetermined to which a probe can bind. Typically, when the methods of the invention are performed, the sequence of the target region will be fully elucidated. However, the sequence of the target region may only need to be elucidated to the extent that sufficient binding or hybridization with the target region can be achieved, i.e., to the extent that degradation of the target region (e.g., by exoribonucleases) is sufficiently prevented or blocked. For example, it may only be necessary for the probe to be partially complementary to the target region as discussed herein. Therefore, in some embodiments, when the methods of the invention are performed, the target region may only be partially elucidated.

[0044] The terms "target region of an ssRNA" and "target region of the ssRNA" are used interchangeably herein.

[0045] Step (b)

[0046] The method of the present invention comprises step (b) of incubating the sample with a single-stranded specific exoribonuclease.

[0047] Therefore, when the term "exoribonuclease" is used herein to describe the exoribonuclease used in the present invention, it refers to a "single-strand-specific exoribonuclease" as described above.

[0048] The step of incubating the sample with the exoribonuclease can include combining probe and exoribonuclease (or mixing or blending).Usually, the step of incubating the sample with the exoribonuclease includes adding the exoribonuclease to the sample.Alternately, the step of incubating the sample with the exoribonuclease can include adding the sample to the solution that comprises the exoribonuclease.

[0049] Incubation may last at least (or up to) 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170 or 180 minutes. Preferably, the incubation lasts for 5 to 180, 10 to 180, 15 to 180, 20 to 180, 25 to 180, 30 to 180, 35 to 180, 40 to 180, 45 to 180, 50 to 180, 60 to 180, 70 to 180, 80 to 180, 90 to 180, 100 to 180, 110 to 180, 120 to 180, 130 to 180, 140 to 180, 150 to 180, 160 to 180 or 170 to 180 minutes.

[0050] Alternatively, the incubation may last from 5 to 180, 5 to 170, 5 to 160, 5 to 150, 5 to 140, 5 to 130, 5 to 120, 5 to 110, 5 to 100, 5 to 95, 5 to 90, 5 to 85, 5 to 80, 5 to 75, 5 to 70, 5 to 65 or 5 to 60 minutes. The incubation may conveniently last from 30 to 90 minutes.

[0051] The temperature or temperature range that the incubation step should (or can be optimized) carry out will depend on employed specific exoribonuclease, because different exoribonucleases have different temperature dependencies.Should be understood that the temperature that adjusts the incubation step according to employed specific exoribonuclease belongs to the responsibilities of skilled researchers.For example, the incubation temperature can be 10 to 40 ℃ (for example 25 to 40 ℃), preferably about 25 ℃ (for example when using exoribonuclease T as exoribonuclease) or about 37 ℃ (for example when using PNP enzyme or ribonuclease R as exoribonuclease).

[0052] Of course, the "sample" incubated with the exoribonuclease in step (b) is the sample that has been (or has been, or was, or was, or was, or was) contacted with the probe in step (a) discussed herein. Therefore, for the avoidance of doubt, it should be noted that the steps of the method are carried out in the order described in claim 1 ((a), (b) then (c)).

[0053] Exoribonuclease is a protein with exoribonuclease activity. Exoribonuclease degrades RNA by removing terminal nucleotides from the 5' end of RNA (i.e., 5'->3' exoribonuclease, or alternatively, 5'-3' exoribonuclease) or the 3' end of RNA (i.e., 3'->5' exoribonuclease, or alternatively, 3'-5' exoribonuclease). In an embodiment of the present invention, the exoribonuclease can be a 5'->3' exoribonuclease or a 3'->5' exoribonuclease, preferably a 3'->5' exoribonuclease.

[0054] Exoribonuclease of the present invention does not have (or does not have significant) endonuclease (such as endoribonuclease) activity, i.e. exoribonuclease of the present invention is not (or can not be classified as) endoribonuclease. Exoribonuclease may not have measurable endoribonuclease activity, or when it has some (although not significant) endoribonuclease activities, the exoribonuclease activity it has is higher than endoribonuclease activity by at least 10 times, 50 times, 100 times, 500 times or 1000 times.

[0055] The exoribonuclease used in the present invention is a single-stranded specific exoribonuclease. As understood in the art, term "single-stranded specific exoribonuclease" refers to exoribonuclease of the present invention specifically or preferentially cuts (or degrades or digests) ssRNA, rather than double-stranded (ds) polynucleotides, such as dsRNA or DNA-RNA hybridization polynucleotides. Single-stranded specific exoribonuclease may not have double-stranded exoribonuclease activity, or, when it has some double-stranded exoribonuclease activities, for any given concentration, its single-stranded exoribonuclease activity can have at least 5 times, 10 times, 50 times, 100 times, 500 times or 1000 times higher than double-stranded (ds) exoribonuclease activity.

[0056] The specificity between ss and ds nucleic acids may be concentration dependent, but in the methods of the present invention, the concentrations of reagents and enzymes (as well as the reaction conditions) are selected to minimize ds exonuclease activity so that in the methods of the present invention, the exonuclease exhibits a single-stranded exonuclease activity that is at least 5 times, 10 times, 50 times, 100 times, 500 times, or 1000 times greater than the double-stranded (ds) exonuclease activity.

[0057] Therefore, the catalytic activity (or nucleic acid processing activity) of single-stranded specific exoribonuclease of the present invention is composed of single-stranded specific (ribose) exoribonuclease activity (or mainly composed of it).From another angle, in the embodiment of the method of the present invention, exoribonuclease does not show any (or any significant or strong) nucleic acid processing activity except the single-stranded specific exoribonuclease activity.

[0058] The exoribonuclease may be a natural exoribonuclease or a synthetic exoribonuclease. The exoribonuclease may be a natural exoribonuclease or a synthetic exoribonuclease that has been modified (or mutated) to increase specificity for ssRNA.

[0059] Exoribonucleases are divided into two subgroups based on their mechanism of action, namely, hydrolytic exoribonucleases and phosphorolytic exoribonucleases. Hydrolytic exoribonucleases cleave nucleotide-nucleotide bonds in RNA by hydrolysis (i.e., using water), thereby releasing nucleotide monophosphates (NMPs). In contrast, phosphorolytic exoribonucleases cleave nucleotide-nucleotide bonds in RNA by phosphorolysis (i.e., using inorganic phosphates), thereby releasing nucleotide diphosphates (NDPs). In some cases, nucleosides (without phosphate) may be released as a result of the exoribonuclease activity. For example, after spontaneous RNA hydrolysis (degradation), the 5' fragment often contains a 2',3'-cyclic-phosphate.

[0060] Therefore, the 3' fragment has no phosphate. When exoribonuclease acts on this last fragment, a nucleoside is released.

[0061] Therefore, in an embodiment of the inventive method, the exoribonuclease is a hydrolytic exoribonuclease or a phosphorolytic exoribonuclease.Preferably, the hydrolytic exoribonuclease is an exoribonuclease T or an ribonuclease R.Preferably, the phosphorolytic exoribonuclease is a polynucleotide phosphorylase (PNP enzyme).In an embodiment, the exoribonuclease is an exoribonuclease that produces nucleotides, or can produce one or more nucleotides from the RNA cleavage activity.

[0062] When used in conjunction with the Lucipac A3 assay (as described elsewhere herein), the use of a PNPase is advantageous because the Lucipac A3 assay produces inorganic phosphate (Pi), which in turn stimulates the PNPase to increase its degradation activity. However, an equilibrium is eventually reached where a large amount of NDP (average 25% as ADP) is produced, which inhibits PNPase-mediated degradation. This feedback inhibits the effect of the PNPase and keeps the system from saturating.

[0063] In other cases, the use of PNP enzymes is advantageous because they recognize 2',3'-cyclic phosphates. In certain RNA degradation situations, 2',3'-cyclic phosphates are formed, i.e., the 3' end formed by RNA cleavage is a 2',3'-cyclic phosphate end.

[0064] When the PNP enzyme acts on the 2',3'-cyclic phosphate end, the nucleoside diphosphate will be released normally (i.e., just like when the PNP enzyme acts on the hydroxyl group 3' end or the phosphate group 3' end), which can then be detected by one of several known methods, such as any of the detection methods described elsewhere herein. Therefore, in embodiments of the methods of the present invention, when the exoribonuclease is a 3'->5' exoribonuclease, it is particularly advantageous that the exoribonuclease is an exoribonuclease that recognizes (or is capable of acting on, or cutting or digesting or processing) a 2',3'-cyclic phosphate (alternatively referred to as a 2',3'-cyclic phosphate, or a 2',3'-cyclic phosphate end, or a 2',3'-cyclic phosphate 3' end, or a 2',3'-cyclic phosphate at the 3' end of the ssRNA).

[0065] PNP enzyme was obtained from Sigma.

[0066] However, it should also be noted that when the method of the present invention is performed on an ssRNA sample that includes (or may include or is suspected of including) one or more ssRNA molecules that include a 2',3'-cyclic phosphate end, it is not necessary to limit the specific type of exoribonuclease used. Instead, the 2',3'-cyclic phosphate end can be resolved by "opening" the 2',3'-cyclic phosphate end, that is, converting the 2',3'-cyclic phosphate 3' end into a 3' end that can be recognized by all (or most) exoribonucleases, such as a hydroxyl group 3' end or a phosphate group 3' end as described above. This conversion can be achieved in a variety of ways. In water, 2',3'-cyclic phosphate is in equilibrium with 2'-phosphate and 3'-phosphate, and this equilibrium depends on the reaction conditions. The opening (or conversion) of the 2',3'-cyclic phosphate end can be achieved by chemical methods, for example, by incubating the ssRNA sample with HCl. Alternatively or in addition, opening (or conversion) of the 2',3'-cyclic phosphate end can be achieved enzymatically, for example using T4 polynucleotide kinase-phosphatase in the absence of ATP (Das and Shuman, "Mechanism of RNA 2',3'-cyclic phosphate end healing by T4 polynucleotide kinase-phosphatase", Nucleic Acids Research, 2013, Vol. 41, No. 1, 355-365).

[0067] Therefore, the method of the present invention can be applied to ssRNA samples that include (or may include, or are suspected of including) one or more ssRNA molecules including 2',3'-cyclic phosphate ends. "One or more ssRNA molecules including (or may include) 2',3'-cyclic phosphate ends" refers to one or more ssRNA molecules, wherein in the 3' terminal nucleotide (or modified nucleotide) of the ssRNA molecule, the 2' and 3' positions of the ribose are bridged by phosphate.

[0068] In embodiments where the exoribonuclease is a hydrolytic exoribonuclease, the detection step (i.e., step (c)) includes detecting a nucleoside monophosphate. Thus, in embodiments, the method of the invention includes the following steps: (a) contacting a sample with a probe, wherein the probe binds (e.g., hybridizes) to a target region of ssRNA in the sample; (b) incubating the sample with a hydrolytic single-stranded specific exoribonuclease; and (c) detecting the nucleoside monophosphates generated by step (b), wherein the nucleoside monophosphates include nucleoside monophosphates from one or more RNA regions located outside the target region of ssRNA in the sample.

[0069] In embodiments where the exoribonuclease is a phosphorolytic exoribonuclease, the detection step (i.e., step (c)) includes detecting nucleoside diphosphates. Thus, in embodiments, the methods of the invention include the following steps: (a) contacting a sample with a probe, wherein the probe binds (e.g., hybridizes) to a target region of ssRNA in the sample; (b) incubating the sample with a phosphorolytic single-stranded specific exoribonuclease; and (c) detecting nucleoside diphosphates generated by step (b), wherein the nucleoside diphosphates include nucleoside diphosphates from one or more RNA regions located outside the target region of ssRNA in the sample.

[0070] Alternatively, both hydrolytic and phosphorolytic exoribonucleases may be used in the methods of the invention, in which case the detecting step comprises detecting both nucleoside monophosphates and nucleoside diphosphates.

[0071] In some embodiments, saturated (or excessive) concentration of exoribonuclease can be used. This means that the amount or concentration of the exoribonuclease of ssRNA cutting occurs at the maximum rate. This is generally understood to be equal to or exceed the amount or concentration of the exoribonuclease of the quantity of substrate (in the case of 5'->3' exoribonuclease, the substrate is the 5' end of ssRNA, or in the case of 3'->5' exoribonuclease, the substrate is the 3' end of ssRNA) in the ssRNA sample. The quantity of substrate can be estimated based on the understanding of RNA sample. It is advantageous to use the exoribonuclease of saturated amount or concentration because it can quickly produce nucleotides and / or nucleosides (depending on the one or more exoribonuclease used), thereby quickly determining the level of ssRNA degradation. Saturated RNA samples with exoribonuclease also allow the quantity of free RNA ends to be quantified by measuring the increasing rate of nucleotide and / or nucleosides concentration over time.

[0072] Step (c)

[0073] The method of the present invention comprises a step (c), i.e. detecting (or measuring or observing or monitoring) the nucleotides and / or nucleosides generated by step (b), wherein the nucleotides and / or nucleosides comprise nucleotides and / or nucleosides from one or more RNA regions located outside the target region of the ssRNA in the sample.

[0074] Optionally, the detection step uses an enzyme-reagent mixture (ie, step (c) comprises using an enzyme-reagent mixture to detect (or measure or observe or monitor) the nucleotides and / or nucleosides generated by step (b)).

[0075] The nucleotides and / or nucleosides detected during the detection step can be natural (or standard) nucleotides and / or nucleosides. For example, the nucleotides and / or nucleosides detected during the detection step can be adenosine, uridine, cytidine or guanosine, or a nucleoside monophosphate of one of these nucleosides, or a nucleoside diphosphate of one of these nucleosides, or a combination thereof (i.e., adenosine, adenosine monophosphate (AMP), adenosine diphosphate (ADP), uridine, uridine monophosphate (UMP), uridine diphosphate (UDP), cytidine, cytidine monophosphate (CMP), cytidine diphosphate (CDP), guanosine, guanosine monophosphate (GMP), guanosine diphosphate (GDP), or a combination thereof).

[0076] Alternatively or in addition, the nucleotides and / or nucleosides detected during the detection step can be modified nucleotides and / or nucleosides. For example, the nucleotides and / or nucleosides detected during the detection step can be 5-methoxyuridine; pseudouridine; N1-methyl pseudouridine; 5-methylcytosine; abasic nucleosides; or 5-fluorobenzofuran-2'-deoxyuridine, or a nucleoside monophosphate of one of these nucleosides, or a nucleoside diphosphate of one of these nucleosides, or a combination thereof. Alternatively, the nucleotides and / or nucleosides can be (or can be derived from their degradation) any other modified nucleic acids or combinations thereof described elsewhere herein.

[0077] Preferably, the nucleotide and / or nucleoside detected during the detection step is a nucleoside, a nucleoside monophosphate, a nucleoside diphosphate or a combination thereof; more preferably adenosine, adenosine monophosphate, adenosine diphosphate or a combination thereof.

[0078] Preferably, the nucleotides and / or nucleosides detected during the detection step are nucleoside monophosphates, nucleoside diphosphates and combinations thereof; preferably adenosine monophosphate and / or adenosine diphosphate.

[0079] As will be apparent from the above discussion, the nucleotides and / or nucleosides detected during the detection step can be a mixture of molecules of a single type (or kind) or molecules of multiple types (or kinds). In order to detect multiple types (or kinds) of molecules during the detection step, it may be appropriate to use multiple detection methods simultaneously or sequentially. Therefore, only one base (whether nucleoside or nucleotide form) can be detected, and this is preferred, but detection can be more than one type of base, even all four bases (whether nucleoside or nucleotide form).

[0080] Of course, the nucleotides and / or nucleosides detected during the detection step are single nucleotides and / or nucleosides, as is the normal meaning of these terms, for example in contrast to polynucleotides.

[0081] The output signal generated in step (c) is proportional to the amount (or level) of nucleotides and / or nucleosides generated by step (b).

[0082] Nucleotides and / or nucleosides can be detected by any suitable detection method known in the art.

[0083] Mass spectrometry and nuclear magnetic resonance (NMR) are tools that can be used to detect and quantify any nucleotide and / or nucleoside. However, it may be preferred to use enzyme-based detection methods or immunoassays, and there are many kits and reagents in the art for such methods.

[0084] For example, nucleotides and / or nucleosides can be detected using a method based on luminescence or fluorescence. In the case of AMP and / or ADP, these molecules can be detected using Lucipac A3 enzyme mixtures, such as in Bakke and Suzuki 2018 (Journal of Food Protection, Vol.81, No.5, 2018, Pages 729-737) and Bakke et al. 2020 (Journal of AOAC INTERNATIONAL, 103 (4), 2020, 1090-1104). In the Lucipac A3 scheme, AMP is converted into ATP in a reaction catalyzed by pyruvate phosphokinase (PPDK), and ADP is converted into ATP in a reaction catalyzed by pyruvate kinase. The ATP generated by these two reactions is used in a reaction catalyzed by luciferase to generate light.

[0085] The luciferase-catalyzed reaction converts ATP (i.e., ATP generated by PPDK- and PK-catalyzed reactions) into AMP. The AMP generated by the luciferase-catalyzed reaction is then converted (or "recycled") back into ATP by the PPDK-catalyzed reaction. The generated ATP is then used again in the luciferase-catalyzed reaction, thereby generating more light and AMP. The generated AMP is then recycled back into ATP, and the cycle is repeated.

[0086] This process of AMP cycling results in the generation of a constant light intensity that is proportional to the amount of AMP and ADP in the sample. Thus, the AMP and ADP in the sample can be quantified by measuring the light intensity using a photometer, for example by providing an output of relative light units (RLU) or by measuring the number of photons released per second (p / s).

[0087] Guanosine diphosphate (GDP) can also be detected by luminescence-based methods, such as the Promega GDP-Glo ​​assay (VA1090). Similarly, uridine diphosphate (UDP) can be detected by the Promega UDP-Glo ​​assay (V6961).

[0088] Adenosine can be detected by fluorescence, for example, using the CELLTECHGEN Adenosine Assay Kit or the BIOVISION Adenosine Assay Kit (K327-100).

[0089] Thus, in an embodiment, the detecting step provides a light output. In a preferred embodiment, the detecting step uses an enzyme-reagent mixture, preferably the mixture comprises luciferase, more preferably also comprises pyruvate phosphodikinase and / or pyruvate kinase.

[0090] Alternatively, AMP and / or ADP can be detected using an NAD+ / NADH coupled assay or a NADP+ / NADPH coupled assay. For example, a conventional method for detecting ADP is to use ADP to convert phosphoenolpyruvate (PEP) into pyruvate in a reaction catalyzed by pyruvate kinase, and then convert pyruvate into lactate while oxidizing NADH to NAD+. NADH absorbs light at 340 nm, while NAD+ does not. Therefore, changes in NADH concentration can be detected by measuring the absorbance of a sample at 340 nm. Alternative methods for measuring NAD+ or NADH concentrations are also known in the art.

[0091] Similarly, GDP can be detected by several other methods, including the Profoldin Micromolar GDP Assay Kit (MGD100K-PF), which can also be used to detect ADP.

[0092] Alternatively, immunodetection methods may be used to detect nucleotides and / or nucleosides.

[0093] For example, AMP and / or ADP can be detected using anti-AMP and / or anti-ADP antibodies, such as using TranscreenerAMP 2 Determination or Transcreener ADP 2 Assays (e.g., as described in Kleman-Leyer et al. Characterization and optimization of a red-shifted fluorescence polarization ADP detection assay. Assay Drug Dev Technol 2009; 7(1): 56-67). Transcreener assays use AMP or ADP analogs covalently fused to a fluorescent tracer. The nucleotide analog-tracer fusion molecule is bound to an anti-AMP or anti-ADP antibody. If enzyme activity results in the formation of ADP, the fusion molecule is displaced by ADP. Displacement of the tracer from the anti-ADP or anti-AMP antibody results in a change in the tracer's fluorescent properties, which can then be detected using standard equipment.

[0094] Similarly, GDP can be detected using the Transcreener GDP FP assay (Bellbrook Laboratories 3009-1k).

[0095] Alternatively, enzyme-coupled detection methods can be used to detect nucleotides and / or nucleosides.

[0096] For example, AMP and / or ADP can be detected using enzyme-coupled detection methods, such as using the ADP-Quest assay (e.g. like In Charter et al. A generic, homogenous method for measuring kinase and inhibitor activation y via adenosine 5'-diphosphate accumulation.J Biomol Screen 2006; 11: 390-399). In the ADP-Quest assay, ADP is used to drive a cascade of detection enzymes, which ultimately produce a fluorescent signal. More specifically, ADP is converted to ATP in a reaction catalyzed by pyruvate kinase, while phosphoenolpyruvate is converted to pyruvate. Pyruvate is then converted to hydrogen peroxide by pyruvate oxidase. The hydrogen peroxide then reacts with Amplex Red in a reaction catalyzed by peroxidase to produce the fluorescent compound resorufin. The concentration of resorufin is then determined by fluorescence using standard equipment.

[0097] In some embodiments, the present invention can be used to measure or quantify ssRNA degradation in a sample, as described previously herein. This can be achieved using a 5'->3' exoribonuclease or a 3'->5' exoribonuclease or both.

[0098] In order to measure ssRNA degradation by the method of the present invention using a 3'->5' exoribonuclease, a probe that binds (or hybridizes) to a sequence at or near the 3' end of the ssRNA should be used, i.e., the "target region" of the ssRNA is located at or near (or is a sequence of) the 3' end of the ssRNA. Thus, in an embodiment, the exoribonuclease is a 3'->5' exoribonuclease, and the target region of the ssRNA is located at or near the 3' end.

[0099] Therefore, if the ssRNA to be measured for degradation is an ssRNA including a poly (A) tail, such as an mRNA, degradation can be measured by the method of the present invention using a 3'->5' exoribonuclease and a probe that binds (or hybridizes) to the poly (A) tail or a portion thereof. Therefore, in an embodiment, the exoribonuclease is a 3'->5' exoribonuclease, the ssRNA includes a poly (A) tail, and the target region of the ssRNA is the poly (A) tail. Therefore, the probe is a probe that binds or hybridizes (or is capable of binding or hybridizing) to the poly (A) tail. For example, the probe can be an oligonucleotide DNA probe including or consisting of a poly (T) sequence, preferably consisting of a poly (T) sequence. Alternatively, the probe can be an oligonucleotide RNA probe including or consisting of a poly (U) sequence, preferably consisting of a poly (U) sequence. Thus, incubation of the probe with ssRNA results in binding of the probe to the poly(A) tail to form a double strand, thereby protecting the poly(A) tail from degradation by the single-stranded specific exoribonuclease of the present invention.

[0100] In order to measure ssRNA degradation by the method of the present invention using 5'->3' exoribonuclease, a probe that binds (or hybridizes) to a sequence at or near the 5' end of ssRNA should be used, i.e., the "target region" of ssRNA is located at or near the 5' end of ssRNA (or is a sequence). 5'->3' exoribonuclease activity is usually prevented by the presence of a 5' cap; however, not all mRNAs in a sample can have a 5' cap. Therefore, a probe should be used to protect the 5' end of an mRNA molecule that does not have a 5' cap (i.e., uncapped mRNA) so that such molecules are prevented from being degraded at the 5' end by a 5'->3' exoribonuclease. Therefore, in an embodiment, the exoribonuclease is a 5'->3' exoribonuclease, and the target region of ssRNA is located at or near the 5' end of ssRNA. Alternatively, an additional probe can be used, and the target region of its ssRNA is immediately upstream of the poly (A) tail to prevent the generation of excessive signals.

[0101] The term "upstream" has the normal meaning in the art, ie, "5' of" or "relatively 5'". This term is in contrast to "downstream", which also has the normal meaning in the art, ie, "3' of" or "relatively 3'".

[0102] As used herein, when it is envisioned that the target region of an ssRNA is located "immediately upstream" of the polynucleotide region in question (e.g., of the poly(A) tail), the target region of the ssRNA is considered to include or consist of nucleotides located within 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 or 0 nucleotides of the polynucleotide region in question, preferably 0 nucleotides (i.e., the first nucleotide upstream of the polynucleotide region in question (e.g., of the poly(A) tail)).

[0103] As used herein, when a target region is envisioned to be "proximal" to a polynucleotide region in question (e.g., a poly(A) tail or 5' end), the target region of the ssRNA is considered to be within 50, 40, 30, 20 or 10 nucleotides, preferably within 10 or 5 nucleotides, of the polynucleotide region in question.

[0104] In some embodiments, the methods of the present invention can be used to measure the binding efficiency (or binding affinity or hybridization efficiency or hybridization affinity) of a probe to an ssRNA (a target region of an ssRNA).

[0105] Due to the lack of complete complementarity between the oligonucleotide probe and the target region, the binding efficiency of the probe to the target region of the ssRNA may not be optimal. Therefore, more specifically, in some embodiments, the present invention can be used to determine the degree of complementarity between the probe and the ssRNA (or the target region of the ssRNA), for example, where the complete sequence of the probe (wherein the probe is an oligonucleotide) and / or the ssRNA (or the target region of the ssRNA) has not been fully elucidated (i.e., the sequence of the probe and / or the ssRNA (or the target region of the ssRNA) is only partially elucidated).

[0106] Alternatively or in addition, the binding efficiency of the probe to the target region of the ssRNA may not be optimal due to steric hindrance of the binding of the probe to the target region, for example due to secondary structure formation (e.g., formation of one or more hairpins) in the ssRNA in and / or around (e.g., near, immediately upstream or immediately downstream) the target region of the ssRNA. Therefore, more specifically, in some embodiments, the present invention can be used to determine the degree of secondary structure formation in and / or around the target region of the ssRNA, preferably wherein the secondary structure formation is a hairpin (or stem-loop) formation. In such embodiments, it is preferred to use an exoribonuclease that is not inhibited by the stem-loop, such as RNase R.

[0107] Probes that are not oligonucleotides or their analogs may also have variable binding affinities to target regions within ssRNA molecules, and the methods of the invention can be used to study the binding affinities of candidate probe molecules and / or screen putative probe molecules to identify those with (stronger) affinities.

[0108] The 5' cap is a non-standard nucleotide found at the 5' end of pre-mRNA and other primary RNA transcripts. In eukaryotes, it consists of a methylated guanine nucleotide that is attached to the rest of the mRNA via a non-canonical 5'-5' triphosphate bond.

[0109] The present invention can be used to measure or quantify the mRNA capping efficiency in a sample (i.e., in an mRNA sample), i.e., the proportion of mRNA molecules in the sample that are incorporated with a 5' cap. In such embodiments, a 5'->3' exoribonuclease is used. The 5'->3' exoribonuclease will digest the 5' end of the uncapped mRNA. However, the 5'->3' exoribonuclease will not be able to digest the 5' end of the capped mRNA because such 5' end is protected from degradation by the 5' cap. Preferably, the 5'->3' exoribonuclease is Xrn-1.

[0110] The capping efficiency in mRNA is usually >95%, so an effective assay is needed to detect smaller differences in capping efficiency. Therefore, a probe is required downstream (but not immediately downstream) of the 5' end of the mRNA to prevent the generation of too many signals. Therefore, in an embodiment of the method of the present invention, the exoribonuclease is a 5'->3' exoribonuclease, and the target region of the ssRNA is (or is located at) the downstream of the 5' end of the mRNA but not immediately downstream. Preferably, the target region of the ssRNA is (or is located at) at least 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 nucleotides downstream of the 5' end of the mRNA. Preferably, the target region is located at (starting at) no more than 50, 60, 70, 100, 150, 200 or 250 nucleotides downstream of the 5' end of the mRNA.

[0111] In some embodiments, the present invention can be used to measure or quantify the length of poly (A) tail. In such embodiments, 3'->5' exoribonuclease is used to digest the poly (A) tail. However, in the absence of a blocking probe, the exoribonuclease will additionally digest the mRNA nucleotides upstream of the poly (A) tail, which is undesirable. In order to prevent or reduce this undesirable digestion, a probe (i.e., a probe in the upstream of the target region of ssRNA in the immediate vicinity of the poly (A) tail) can be used. Therefore, in an embodiment, the exoribonuclease is a 3'->5' exoribonuclease, and the ssRNA includes a poly (A) tail, and the target region of the ssRNA is immediately adjacent to the upstream of the poly (A) tail.

[0112] It is understood that if the probe binds only near the last nucleotide before the start of the poly(A) tail, the reading may be distorted by the presence of adenine nucleotides in the RNA between the end of the probe and the start of the poly(A) tail. Such residues may have an effect on the signal generated by the enzyme-reagent mixture. In this case, "immediately adjacent" should be understood to mean that preferably there are no nucleotides between the end of the probe and the start of the poly(A) tail, but if there are several nucleotides in this region, especially if none of them are adenine, the analysis is still useful.

[0113] Alternatively, a portion of the probe may be complementary to an RNA sequence immediately upstream of the poly(A) tail, while another portion of the probe may be complementary to a region of the poly(A) tail. Thus, in other words, the probe binds (or hybridizes) around the 5' end of the poly(A) tail. Thus, in an embodiment, the exoribonuclease is a 3'->5' exoribonuclease, and the target region of the ssRNA is a region spanning the nucleotides at the 5' end of the poly(A) tail and the nucleotides immediately upstream of the poly(A) tail.

[0114] The method of the present invention may comprise carrying out the other method (or other method steps) as described above on the same sample material, wherein step (a) of the method of the present invention is not carried out, but steps (b) and (c) of the method of the present invention are carried out. The results obtained in the two methods may be compared, wherein the second method (without step (a)) is operated as a control step.

[0115] Therefore, optionally, the method of the present invention also includes comparing the nucleotide and / or nucleoside levels detected in the step (c) of the method comprising step (a) with the nucleotide and / or nucleoside levels detected in the step (c) of the method not comprising step (a). The comparison may involve providing (or calculating or determining) the ratio of two levels. Preferably, the nucleotide or nucleoside detected in the control method is the same as the nucleotide or nucleoside detected in the method of the present invention.

[0116] The other method (step) is used as a control or baseline by which the detection level (e.g., luminescence level, e.g., when using the Lucipac A3 protocol) of the nucleotides and / or nucleosides generated by step (b) from the original method step can be normalized. The use of other method steps, while not required, may be advantageous, for example, to achieve a more meaningful output regardless of the specific equipment or parameters used.

[0117] For example, in an embodiment of the method of the invention for measuring or quantifying the efficiency of binding (or hybridization) of a probe to a target ssRNA, an additional method step involves incubating the sample with (i) and without (ii) oligonucleotides. The fraction (i) / (ii) will then inform the user of the efficiency of binding of the probe to the RNA. Specifically, no binding or weak binding will result in a ratio of (or close to) 1, while strong binding will result in a ratio close to (or closer to) 0.

[0118] In an embodiment, it may be desirable to consider background signals in the calculation. Background signals (or "noise") may be generated, for example, by trace contaminant nucleotides. The signal (e.g., luminescent signal) generated by the same protocol in the absence of an mRNA sample can be quantified and therefore considered. Therefore, in the above formula (i) / ii), the values ​​of (i) and (ii) can exclude background signals.

[0119] The percentage degradation can be calculated using the following formula, this time explicitly accounting for the background signal in the equation:

[0120] Degradation percentage = (degradation - background) / (no probe - background)

[0121] Wherein "degraded" is the signal (e.g., luminescent signal) generated following incubation of a degraded sample with an exoribonuclease and subsequent detection (e.g., using a Lucipac A3 assay), "background" is the signal generated in the absence of an mRNA sample (which may be due, for example, to trace contaminant nucleotides), and "no probe" is the signal measured from a degraded sample in the absence of a probe.

[0122] In addition to determining and using as a comparator the signal generated for a ssRNA sample in the absence of the probe, one may alternatively determine and use the signal generated for a version of the ssRNA sample that is (or assumed to be) 100% intact (i.e., has 0% degradation) in the presence of the probe (i.e., all steps (a) to (c) of the invention are performed normally, but using an intact sample). Examples of such a sample may be a freshly thawed or newly generated version or aliquot of the ssRNA sample in question, or a version or aliquot of the ssRNA sample that has not been exposed to degrading conditions.

[0123] In another aspect, the present invention provides a kit for performing the ssRNA analysis method as defined herein, the kit comprising a probe of the present invention and an exoribonuclease of the present invention as defined herein.

[0124] Alternatively, the kit includes a buffer solution. The buffer solution can be a buffer solution for (or suitable for) a probe and / or an exoribonuclease. Alternatively, the kit includes an instrument for detecting nucleotides and / or nucleosides, such as an enzyme-reagent mixture as defined herein.

[0125] The preferred embodiments and additional features of the method of the invention apply where appropriate to this aspect of the invention.

[0126] Throughout this specification, when the terms "comprising," "comprise," "comprises," "has," or "having" or other equivalent terms are used herein, the terms "consisting of," "consist of," and "consists of" may also be considered alternatively. A method comprising certain steps also includes a method consisting of these steps, if appropriate.

[0127] In this specification, the terms "a" and "an" are used to mean "at least one", "at least a first", "one or more" or "more" of the referenced components or steps, unless an upper limit is explicitly stated later.

[0128] The invention will now be further described in the following non-limiting examples with reference to the following figures.

[0129] Figure 1 Shown are the results of Example 1, a graph showing the signal output from the Lucipac A3 assay performed on mRNA samples at varying mRNA concentrations, with or without prior incubation with Exonuclease T.

[0130] Figure 2 Shown are the results of Example 2, a graph showing the signal output from a Lucipac A3 assay performed on mRNA samples having different ratios of digested (degraded) mRNA to intact mRNA.

[0131] Figure 3 Results of Example 3 are shown. The upper portion of the figure contains a graph showing the signal output of the Lucipac A3 assay performed on: freshly thawed mRNA samples ("intact"); freshly thawed mRNA samples that were subsequently incubated with Exonuclease T ("intact exo T"); mRNA samples that were incubated at room temperature for 1 week ("benchmark"); and mRNA samples that were incubated at room temperature for 1 week and then incubated with Exonuclease T ("benchmark exo T"). The lower portion of the figure contains an agarose gel of each sample, in which smears indicate mRNA degradation.

[0132] Figure 4 The results of Example 4 are shown, which is a graph showing the signal output of the Lucipac A3 assay performed on: water; mRNA; mRNA incubated with dT30 (ssDNA consisting of a sequence of 30 thymine residues); mRNA incubated with dT30; mRNA incubated with nuclease T; and mRNA incubated with dT30 and exonuclease T.

[0133] Figure 5 Presented are the results of Example 5, which is a graph showing the signal output of the Lucipac A3 assay performed on: water; dT30; mRNA; and mRNA incubated with dT30; all incubated with or without PNPase.

[0134] Figure 6 The results of Example 6 are presented, which are images of agarose TAE gels showing the molecular weight (and therefore degradation levels) of different mRNA samples in the presence or absence of dT30 (T) or random sequence oligodeoxynucleotides (R1, R2, R3) and with or without the subsequence incubated with PNPase.

[0135] Figure 7Results from Example 7 are shown, showing the output signal from the Lucipac A3 assay as the concentration ratio of dT30 to mRNA increases.

[0136] Figure 8 The results of Example 8 are shown. The upper part of the figure is a chart showing the percentage of degradation calculated from a PNP enzyme-based assay using the following formula: Percentage of degradation = (degradation - background) / (poly (A) - background). The same mRNA was used as input for the degradation assay and also as input for the gel assay. The lower part of the figure is an image of a TAE agarose gel showing the molecular weight (and therefore degradation level) of the original intact mRNA sample after incubation at 95°C for 0, 1, 10, 15, 30 or 60 minutes.

[0137] Fig. 9 Provided are brief schematic diagrams of four embodiments of the present invention as described above, i.e., using 3'->5' exoribonuclease to measure RNA degradation, using 5'->3' exoribonuclease to measure RNA degradation, measuring capping efficiency, and measuring poly (A) tail length. Of course, it should be understood that these schematic diagrams are for illustrative purposes only and are not limiting.

[0138] Fig.10 Provided Fig. 9 A more detailed schematic diagram of one embodiment of the method of measuring RNA degradation using a 3'->5' exoribonuclease. Of course, it should be understood that this schematic diagram is for illustrative purposes only and is not limiting.

[0139] Fig.11 A schematic diagram is provided of how the present invention can be used to determine the secondary structure of ssRNA and also to assess the binding affinity of a probe to ssRNA. A, B and C are oligonucleotide probes that bind to ssRNA containing secondary structure (stem loop). Probe A does not bind very well, so the addition of an exoribonuclease will completely degrade the ssRNA. Probe B binds moderately, so the ssRNA will be partially degraded by the exoribonuclease. Probe C binds very well, so will significantly inhibit degradation and generate the least amount of signal in the detection step (c) of the present invention.

[0140] Figures 12 to 18 Results are shown for Examples 9 to 15, respectively. Additional details of these figures are provided in the corresponding Examples. Example

[0141] Example using Exonuclease T

[0142] Example 1 - Exonuclease activity is required to release nucleosides from mRNA

[0143] FLuc 5moU mRNA (Trilink #L-7602) was thawed at 20ng / μl and stored on ice. Next, the mRNA was removed from the ice and stored on the bench at room temperature for the specified time (0h-2h). Fifty μl of mRNA was then diluted in 50μl Lucipac A3 reagent (Kikkoman #60365) and measured in a Tecan Spark plate reader using a flat-bottomed NUNC 96-well plate. In addition, the freshly thawed mRNA portion was diluted to 100ng / μl and digested with 7μl exonuclease T (NEB #M0265) at 25°C for 30min, followed by Exo T inactivation (at 65°C) 20min). Then 50μl Fifty μl of the obtained sample was diluted with Lucipac A3 reagent and further serially diluted (dilution The ratio is 1:10).

[0144] Exonuclease T releases nucleoside monophosphates from ssRNA in the 3'->5' direction (i.e., primarily digests the poly(A) tail), while Lucipac A3 converts AMP into measurable luminescence.

[0145] The results of this example are Figure 1 . The dotted line represents the signal obtained from 50 μl of nuclease-free water and 50 μl of Lucipac A3 (shown in p / s (photons per second)). As shown in the white column, a small amount of luminescence can be obtained with mRNA even in the absence of exonuclease T incubation. This is suspected to be due to the presence of trace amounts of AMP and / or ADP, either due to slight degradation or slight contamination of the mRNA sample. As shown in the black column, exonuclease T incubation resulted in a significant increase in the luminescent signal. Therefore, this example shows that exonuclease activity is required for releasing nucleosides from mRNA.

[0146] Example 2 - Different ratios of digested mRNA and intact mRNA can be sensitively distinguished

[0147] FLuc 5moU mRNA was digested with Exonuclease T and mixed with intact FLuc 5moU mRNA at different ratios (total mRNA concentration was kept constant at 10pg / μl). Fifty μl of Lucipac A3 reagent was added to 50 μl of this mRNA mixture and luminescence was measured in a Tecan plate reader.

[0148] The results of this example are Figure 2 For example, 1.0 indicates that the RNA mixture contains equal amounts (ie, equal masses) of digested mRNA versus intact mRNA, while 0.0 indicates that the RNA mixture contains only intact mRNA. Figure 2The dashed line in is the same as that in Example 1, ie it represents the signal obtained from 50 μl of nuclease-free water and 50 μl of Lucipac A3.

[0149] Figure 2 It is shown that the Lucipac A3 assay for different ratios of digested mRNA and intact mRNA will produce luminescent signals of different intensities. Therefore, this example shows that different ratios of digested mRNA and intact mRNA can be sensitively distinguished.

[0150] Example 3 - Exonuclease T digestion alone cannot be used to detect mRNA degradation

[0151] FLuc 5moU mRNA (1929 nt in size) was left on the bench at room temperature for 1 week and compared to freshly thawed (i.e. intact) mRNA with / without digestion with Exonuclease T. Fifty μl of mRNA (100 pg / μl) was used and 50 μl, 25 μl or 10 μl of Lucipac A3 reagent was added to each sample.

[0152] The results of this example are Figure 3 . A significant increase in the luminescence signal of the intact mRNA incubated with Exonuclease T was observed compared to the intact mRNA that was not incubated with Exonuclease T. This increase in the luminescence signal is mainly due to the digestion of the poly (A) tail (derived from the original intact mRNA molecule) by Exonuclease T. A similar increase in the luminescence signal of the benchmark mRNA incubated with Exonuclease T was also observed compared to the benchmark mRNA that was not incubated with Exonuclease T. The smear on the 0.8% agarose gel (containing 1% bleach) indicates that the 1-week benchmark mRNA is slightly degraded. However, this degradation does not result in a significant increase in luminescence.

[0153] Therefore, in this embodiment, the luminescent signal generated by exonuclease T digestion of the poly (A) tail dominates the overall luminescent signal of the benchmark exoT sample, so that any luminescent signal generated by exonuclease T digestion of the non-poly (A) tail end (i.e., the end produced by degradation of the benchmark mRNA sample) is not detected.

[0154] Example 4 - Complementary oligonucleotides prevent exonuclease T activity

[0155] Exo T was added to the FLuc 5moU mRNA sample and then incubated at 25°C for 60min to release AMP from the ssRNA fragments. The released AMP was then quantified using the Lucipac A3 assay.

[0156] The results of this example are Figure 4Supplementing the reaction with a 5-fold molar excess of dT30 reduced the amount of AMP released, indicating that much of the AMP is derived from the poly(A) tail.

[0157] Example using PNP enzyme

[0158] Example 5 - Polynucleotide phosphorylase (PNPase) is a 3'->5' exonuclease that releases nucleotide diphosphates from mRNA and is inhibited by double-stranded mRNA

[0159] FLuc 5moU mRNA was placed at room temperature for 1 week. Next, the mRNA was incubated at 80°C for 2 minutes with or without the addition of a 5-fold molar excess of oligodeoxythymidine (dT30). After cooling to room temperature, PNP enzyme (Sigma #N9914) was added (final concentration of 5ng / μl) and incubated at 37°C for 60 minutes. Next, 3μl of this reaction (15ng mRNA) was mixed with 25μl Lucipac A3 reagent and luminescence was measured in a Tecan plate reader.

[0160] The results of this example are Figure 5 The addition of dT30 inhibits the release of ADP from the poly(A) tail.

[0161] Example 6 - Complementary oligonucleotides inhibit exonuclease-mediated mRNA degradation in a sequence-specific manner

[0162] Internal poly(A)-tailed mRNA was synthesized in an in vitro transcription reaction (NEB#E2040S) using linearized pET22b_NEIL2-NLuc-His as template DNA, followed by enzymatic poly(A) tailing (Cellscript#C-PAP5104H) and silica-based purification (NEB#T2040S), all according to the manufacturer’s instructions. Both unmodified and commercially obtained 5moU modified FLuc mRNA were annealed at 80°C for 2 minutes and then cooled to room temperature with a 4-fold molar excess of dT30 oligodeoxynucleotide (T) or one of three oligodeoxynucleotides (R1-R3) with random sequences (R1: TTTACCGCAACTACACCTAACTGAGATACT (SEQ ID NO: 1), R2: TTAGATAACCGGATACAGTGACTTTGATAG (SEQ ID NO: 2), R3: CTGCGTATGGAGGAAGGAACTTTTGCGTGT (SEQ ID NO: 3). These mRNA: oligo mixtures were then incubated with PNPase (final concentration of 10 ng / μl) in PNPase buffer (final concentration of 5 mM MgCl2, 10 mM KCl, 50 mM Tris HCl (pH 8.5) and 10 mM inorganic phosphate) at 37°C for 60 min. Six hundred ng of each reaction was then run on a 0.8% agarose TAE gel containing 1% bleach.

[0163] The results of this example are Figure 6 .For both FLuc 5moU mRNA and NEIL2-NLuc mRNA, the band in the swimming lane without PNP enzyme is roughly located at the same position as the band in the corresponding swimming lane containing PNP enzyme and dT30. This shows that dT30 successfully inhibits PNP enzyme activity.By contrast (also for both FLuc 5moU mRNA and NEIL2-NLucmRNA), the four bands in the swimming lane containing PNP enzyme but lacking dT30 (or there is no oligonucleotide or there is one of the random sequence oligonucleotides of R1 to R3) are roughly in the same position, and are lower than the other two bands (indicating that the degree of degradation is higher than the other two bands). The fact that the bands in these four swimming lanes are in the same position (for two RNA types) shows that oligonucleotides R1 to R3 can not prevent PNP enzyme from degrading mRNA.Therefore, in a word, the gel image shows that only dT30 inhibits the activity of PNP enzyme to mRNA, while random oligodeoxynucleotides will not.

[0164] Example 7 - Luminescent signal generated by phosphorolysis of poly(A) tail can be avoided by adding a large excess of oligonucleotides

[0165] FLuc 5moU mRNA (124ng) was mixed with 0-500-fold molar excess of dT30 in a total of 10μl of nuclease-free The mixture was heated at 80°C for 2 minutes and then cooled to room temperature. Next, mRNA with annealed dT30 (final concentration of 2.9 ng / μl) was mixed with PNP enzyme (final concentration of 1.6 ng / μl) and PNP enzyme buffer. All samples were incubated at 37°C for 60 minutes and then centrifuged at 8000 RPM for 10s. Using a flat-bottomed white NUNC 96-well plate, 5μl of each sample was then mixed with 26μl Lucipac A3 reagent and 25μl nuclease-free water and immediately imaged in a Tecan plate reader (luminescence exposure time for each well was 2s).

[0166] The results of this example are Figure 7 The figure shows that when the dT30:mRNA ratio is 250-500, almost all the signals from poly(A) phosphorylation can be suppressed. The degradation percentage can be calculated using the following formula:

[0167] Degradation percentage = (degradation - background) / (poly (A) - background)

[0168] The "background" value reflects the steady background luminescence from samples containing only dT30 and PNPase. The luminescence remaining upon complete inhibition of poly(A) phosphorolysis originates from RNA degradation fragments ("degradation").

[0169] The "Poly(A)" value and line represent the luminescence from a sample containing PNPase but completely lacking dT30.

[0170] When dT30:mRNA was 500, the formula (degradation - background) / (poly(A) - background) indicated that the input mRNA was degraded by 11.26%.

[0171] Example 8 - Signals obtained from RNA fragments not derived from poly(A) are associated with RNA degradation

[0172] FLuc 5moU mRNA in water is degraded by heating at 95 ° for a specified time (0-60min)-increased incubation time at 95 degrees will increase the degradation of mRNA. One hundred nanograms of mRNA are then loaded onto a TAE agarose gel (1% bleach). Next, 12.4ng mRNA and 500-fold molar excess of dT30 (total volume of 10μl) are denatured / annealed at 70°C for 2min in a thermal cycler and cooled to room temperature. Next, only mRNA, mRNA: dT30 hybrids and only dT30 are incubated with PNP enzyme at 37°C for 60min, with a reaction volume of 30μl (2.49ng sample, PNP enzyme buffer, 1.41ng PNP enzyme, RNase-free water). Finally, 1 μl of this mixture was mixed with 55 μl water and 5 μl Lucipac A3 reagent and then luminescence was measured in a Tecan plate reader using a white NUNCLON 96-well plate. The degradation percentage was calculated using the formula (degradation-background) / (poly(A)-background).

[0173] Figure 8 Results for mRNA:dT30 hybrids are shown in this example. This example shows that the signal obtained from RNA fragments of non-poly(A) origin is associated with RNA degradation. The use of excess dT30 means that there is (essentially) no signal from the poly(A) tail.

[0174] Other embodiments

[0175] Example 9 - Complementary oligonucleotides inhibit PNP enzyme activity

[0176] The results of this example are Fig.12 In the figure. The complete mRNA (12.4 ng) was incubated at 70°C for 2 min with and without 3 different batches of 500-fold molar excess oligomer (T30). After cooling, these samples were incubated at 37°C for 60 minutes in the presence or absence of PNPase and PNPase buffer. A certain volume of the reaction mixture (containing 6.2 ng mRNA) was then transferred to a Nunclon 96-well plate and Lucipac A3 reagent was added. Finally, luminescence was measured after 5 minutes in a Tecan plate reader.

[0177] These results indicate that intact mRNA generates luminescence only in the presence of PNPase, and that the addition of oligo(T30) suppresses signal generation almost to baseline. Furthermore, even when using 3 different lots of oligo(T30), signal variation is limited. These data confirm that Figure 5 , which used a 5-fold molar excess of T30 (this example is similar, but uses a 500-fold molar excess of T30).

[0178] Example 10 - Inhibition of RNase R by annealing oligo(T30) to analyte mRNA, and both LNA or DNA chemistries can be used for T30

[0179] The results of this example are Fig.13 mRNA was thermally degraded at 95°C for 10 min. After cooling, the degraded mRNA was mixed with intact mRNA at different ratios, with and without the addition of locked nucleic acid oligo (T30) (LNA, Fig.13 A) or deoxyribonucleic acid oligomer (T30) (DNA, Fig.13 B). After annealing at 60°C for 2 minutes and then gradually cooling to room temperature, the samples were incubated at 37°C with RNase R (Abcam #ab286929, final concentration 0.023U / μl) in RNase R buffer according to the manufacturer's instructions for 60 min. Five microliters of these samples were then mixed with 15μl Lucipac A3 reagent and 40μl dH2O, and luminescence was measured on a Tecan plate reader. The relative percentage degradation was calculated by dividing the luminescence of the annealed mRNA by the luminescence of the unannealed mRNA. The results show that RNase R, a 3'-5' exoribonuclease, is inhibited by annealing oligo (T30) to the analyte mRNA (Vincent and Deutscher, J Biol Chem (2006) Oct 6; 281(40): 29769-75), and both LNA or DNA chemistries can be used for T30.

[0180] Example 11 - Higher molar excess of oligonucleotide inhibits exonuclease T digestion in a dose-dependent manner

[0181] The results of this example are Fig.14 mRNA was thermally degraded at 95°C for 10 minutes. The degraded mRNA was then annealed (2 minutes at 65°C) to different molar amounts of oligos (T30), including DNA chemistry (T30) and locked nucleic acid chemistry (T30LNA). These mixtures were then subjected to exonuclease T digestion (60 minutes at 25°C, 7min enzyme inactivation at 65°C), followed by supplementation with Lucipac A3 reagent and luminescence read on a Tecan plate reader. The results showed that higher molar excesses of oligonucleotides with different chemistries (i.e., T30 and T30LNA oligonucleotides) inhibited exonuclease T digestion in a dose-dependent manner.

[0182] Example 12 - The present invention is sensitive enough to detect degradation caused by mild conditions

[0183] The results of this example are Fig.15 mRNA was thermally degraded at 70 ° C for 10 minutes, annealed (10 minutes at room temperature) to 1000-fold molar excess oligomerization (T30), mixed with intact mRNA at different ratios, and subjected to PNP enzyme digestion (60 minutes at 37 ° C), then supplemented with Lucipac A3 reagent and read out luminescence on a Tecan plate reader. Even under these very mild thermal degradation conditions, when there is more degraded mRNA in the sample, the results show an increase in luminescent signal. Under these conditions, this difference could not be detected on capillary gel electrophoresis using the method of Raffaele et al. Electrophoresis 2022 May; 43 (9-10): 1Id-1106.

[0184] Example 13 - Luminescence in a PNP enzyme-based assay using various excesses of T30 and mild degradation conditions

[0185] The results of this example are Fig.16 Shown in . mRNA was heat degraded at 70°C for 10 minutes and mixed with intact mRNA at different ratios (12ng input mRNA total per sample). Next, 1000-fold, 2000-fold, or 3000-fold molar excess of oligo(T30) was added to the mRNA samples and annealed at room temperature for 10 min. After a brief centrifugation, PNPase was added to PNPase buffer and incubated at 37°C for 10 minutes, then Lucipac A3 reagent was added and luminescence was measured with a Tecan plate reader. These results confirm (a) the difference in luminescence output between intact mRNA and mRNA mildly heat degraded at 70°C, (b) the difference in luminescence can be obtained by digesting the mRNA samples for only 10 minutes, and (c) no significant signal improvement can be seen when >1000-fold T30 is added.

[0186] Example 14 - The assay outputs higher luminescence when more tailless mRNA fragments are present and available for digestion

[0187] The results of this example are Fig.17 Displayed in. Fig.17 A: Twelve nanograms of mRNA were mixed with 60nt RNA oligonucleotides at different molar ratios in the presence of 1000-fold molar excess oligo (T30) and allowed to anneal to mRNA over 10 minutes at room temperature. Next, PNPase in PNPase buffer was added to each mRNA sample and incubated at 37°C for 5 minutes before adding Lucipac A3 reagent and measuring luminescence on a Tecan plate reader. Fig.17B: Various molar excesses of RNA oligonucleotides were mixed with intact mRNA and treated in the same manner as the RNA in the left panel. In summary, these experiments simulate the increase in the number of RNA fragments generated due to mRNA degradation. The results show that, as with thermally degraded mRNA, the assay outputs higher luminescence when more tailless mRNA fragments are present.

[0188] Example 15 - 5'->3' exoribonuclease XRN-1 can be used to release AMP from decapped mRNA

[0189] The results of this example are Fig.18 . DCP-1 was used to decap mRNA, thereby generating 5' monophosphate mRNA. The decapped mRNA was mixed with capped mRNA at different ratios (0-16%). Next, an oligonucleotide complementary to the 5'UTR (GGGTTCTCTCTGAGTCTGT (SEQ ID NO: 4)) was annealed (2 minutes at 60°C) to the analyte mRNA to prevent excess signal generation. The mixture was then incubated with 5'-3' exoribonuclease 1 (XRN-1) at 37°C for 10 minutes according to the manufacturer's instructions (NEB#M0338S). Finally, Lucipac A3 reagent was added and luminescence was measured on a Tecan plate reader. These results indicate that XRN-1 can be used to release AMP from uncapped mRNA. In turn, this AMP can be converted into measurable luminescence and correlated with the percentage of decapped mRNA in the sample.

Claims

1. A method for analyzing ssRNA in a sample, the method comprising: (a) contacting the sample with a probe, wherein the probe binds to a target region of ssRNA in the sample; (b) incubating the sample with a single-stranded specific exoribonuclease; and (c) detecting the nucleotides and / or nucleosides generated by step (b), wherein the nucleotides and / or nucleosides are derived from one or more RNA regions located outside the target region of the ssRNA in the sample.

2. The method according to claim 1, wherein: The nucleotide and / or nucleoside is adenosine, adenosine monophosphate, adenosine diphosphate or a combination thereof, preferably adenosine monophosphate, adenosine diphosphate or a combination thereof.

3. The method according to claim 1 or claim 2, wherein: The detection step relies on light output.

4. A method according to any one of the preceding claims, wherein: The detection step uses an enzyme-reagent mixture, preferably, wherein the enzyme-reagent mixture comprises luciferase, and more preferably further comprises pyruvate phosphokinase and / or pyruvate kinase.

5. A method according to any one of the preceding claims, wherein: The probe is an oligonucleotide probe, preferably a DNA or RNA oligonucleotide probe, more preferably a DNA oligonucleotide probe.

6. The method according to claim 5, wherein: The oligonucleotide has a length of 15 to 100 nucleotides, preferably 20 to 60 nucleotides.

7. The method according to any one of claims 1 to 4, wherein: The probe is an RNA binding protein.

8. A method according to any one of the preceding claims, wherein: The exoribonuclease is a 3'->5' exoribonuclease.

9. The method according to claim 8, wherein: The ssRNA includes a poly(A) tail, and the target region of the ssRNA is the poly(A) tail.

10. The method according to claim 8, wherein: The ssRNA includes a poly(A) tail, and the target region of the ssRNA is immediately upstream of the poly(A) tail or spans the 5' end of the poly(A) tail.

11. The method according to any one of claims 1 to 7, wherein: The exoribonuclease is a 5'->3' exoribonuclease.

12. The method according to claim 11, wherein: The target region of a ssRNA is located at or near the 5' end of the ssRNA.

13. A method according to any one of the preceding claims, wherein: The exoribonuclease is a hydrolytic exoribonuclease or a phosphorolytic exoribonuclease.

14. A method according to any one of the preceding claims, comprising carrying out a further method on the same sample material, wherein: Step (a) as defined in any one of the preceding claims is not performed, but steps (b) and (c) as defined in any one of the preceding claims are performed.

15. A method according to any one of the preceding claims, wherein: The method is used to measure the binding efficiency of the probe to the ssRNA.

16. A method according to any one of the preceding claims, wherein: The method is used to analyze secondary structures within the ssRNA, preferably stem-loop or hairpin formation in the ssRNA.

17. A method according to any one of the preceding claims, wherein: The ssRNA comprises one or more modified nucleotides, preferably wherein the one or more modified nucleotides comprise N1-methylpseudouridine.

18. A kit for performing the ssRNA analysis method according to any of the preceding claims, the kit comprising a probe as defined in any of the preceding claims and an exoribonuclease as defined in any of the preceding claims, optionally together with an enzyme-reagent mixture for detecting nucleotides and / or nucleosides.

Images