Mapping method of compound binding sites

Abstract

The invention relates to mapping binding sites of a test compound within a nucleic acid. The nucleic acid is contacted with a tagged test compound that binds to the nucleic acid or a protein associated with the nucleic acid at one or more positions. The tagged test compound is in contact with a first binding member that specifically binds to the tag and a second binding member that specifically binds to the first binding member and is linked to an activatable nuclease, such that the second binding member binds to the first binding member that binds the tagged test compound at the one or more binding sites. The nuclease is then activated to cleave the nucleic acid at the binding site to produce a fragment. The sequence of the resulting fragment is indicative of the binding site of the test compound.

Description

Technical Field

[0001] The present invention relates to methods and kits for mapping the location of chemical compounds within nucleic acid sequences and binding sites of nucleic acids or nucleic acid-associated proteins. Background Art

[0002] Small molecules that directly target DNA in cells formed the basis for the development of early, widely used anticancer and antibiotic drugs (1). Over the past two decades, our understanding of the structure and function of the genome, including the interacting chromatin proteins, has greatly improved, creating more opportunities for small molecule interventions in biology and disease states. An important aspect of developing small molecule probes or therapeutics is the ability to validate target engagement at the molecular level (2). When the genome itself or chromatin structure is the target, this requires molecular mapping of where the drug molecule binds throughout the genome.

[0003] Mapping inhibitors to chromatin has proven challenging and has been mostly limited to a few high-affinity ligands for chromatin-binding proteins, including the bromodomain inhibitor JQ1 and the CDK9 inhibitor AT7519 (3–5). Whole-genome mapping involves immobilization of small molecules using affinity tags followed by pull-down of cleaved chromatin and DNA sequencing. These approaches are not amenable to many probes because of the high binding affinity and slow dissociation rates required and are often subject to low signal, high background, and the potential for epitope masking due to formaldehyde cross-linking. Furthermore, relatively low yields in DNA recovery must be overcome with large amounts of input material (4), which limits their application to rare cell populations.

[0004] The binding preferences of DNA minor groove binding molecules have been biophysically mapped using pools of randomly synthesized DNA oligonucleotides (6,7), which do not take into account differences in native chromatin accessibility. Alternatively, the DNA binder psoralen can be UV-crosslinked to DNA and its binding site mapped, or similarly, the binding site of a small molecule with a psoralen moiety can be mapped (3,8). A practical challenge to be overcome by traditional methods is that the strength of the non-covalent interaction needs to overcome any dissociation between the DNA and the small molecule during subsequent DNA processing. In addition, DNA-targeted chemotherapeutic agents such as doxorubicin have been widely used in the clinic for decades. However, their binding location and extent in the human genome cannot be measured. Therefore, a general method for in situ mapping of small molecule-DNA interactions in intact cells will provide valuable insights into the pharmacogenetics of DNA binder action and enhance our ability to use the genome as a therapeutic target. Summary of the invention

[0005] The inventors of the present application have developed methods that can map the locations of binding sites of compounds (such as drugs) within nucleic acid sequences (such as genomes) efficiently and at high resolution.

[0006] A first aspect of the invention provides a method of mapping the location of one or more binding sites of a test compound within a nucleic acid, comprising;

[0007] (i) contacting the nucleic acid with a tagged test compound comprising a test compound covalently linked to a tag, wherein the tagged test compound binds to the nucleic acid or a protein associated with the nucleic acid at one or more locations within the nucleic acid,

[0008] (ii) contacting the tagged test compound with a first binding member that specifically binds to the tag, such that the first binding member binds to the tagged test compound,

[0009] (iii) contacting the nucleic acid with a second binding member that specifically binds to the first binding member and is linked to an activatable nuclease, such that the second binding member binds to the first binding member that binds to the tagged test compound at one or more binding sites,

[0010] (iv) activating the nuclease such that the nuclease cleaves the nucleic acid at the one or more binding sites to generate fragments, and;

[0011] (v) Determining the sequence of the generated fragment.

[0012] The sequence of the nucleic acid fragment may indicate the location of the one or more binding sites for the test compound within the nucleic acid.

[0013] Steps (i) and (ii) of the method of the first aspect may be performed simultaneously or sequentially in any order. In some embodiments, the method of the first aspect may include contacting the labeled test compound with a first binding member that specifically binds to the label, such that the first binding member binds to the labeled test compound to form a complex comprising the first binding member and the labeled test compound, and contacting the nucleic acid with the complex. In other embodiments, the method of the first aspect may include contacting the nucleic acid with the labeled test compound, and then contacting the nucleic acid with the first binding member that specifically binds to the label, such that the first binding member binds to the labeled test compound that binds to the nucleic acid,

[0014] In some preferred embodiments of the first aspect, the nuclease may be a transposase. For example, the method of the first aspect may include:

[0015] (i) contacting the nucleic acid with a tagged test compound comprising a test compound covalently linked to a tag, wherein the tagged test compound binds to the nucleic acid or a protein associated with the nucleic acid at one or more locations within the nucleic acid,

[0016] (ii) contacting the tagged test compound with a first binding member that specifically binds to the tag, such that the first binding member binds to the tagged test compound,

[0017] (iii) contacting the nucleic acid with a second binding member that specifically binds to the first binding member and is linked to an activatable transposase carrying an oligonucleotide linker, such that the second binding member binds to the first binding member that binds to the tagged test compound at the one or more binding sites,

[0018] (iv) activating the transposase so that the transposase cleaves the nucleic acid at the one or more binding sites to generate fragments tagged with an oligonucleotide adapter at each end, and;

[0019] (v) Determining the sequence of the labeled fragment.

[0020] In some embodiments of the first aspect, the sequence of the generated or labeled fragment can be determined by sequencing. For example, the method of the first aspect can include:

[0021] (i) contacting the nucleic acid with a tagged test compound comprising a test compound covalently linked to a tag, wherein the tagged test compound binds to the nucleic acid or a protein associated with the nucleic acid at one or more locations within the nucleic acid,

[0022] (ii) contacting the tagged test compound with a first binding member that specifically binds to the tag, such that the first binding member binds to the tagged test compound,

[0023] (iii) contacting the nucleic acid with a second binding member that specifically binds to the first binding member and is linked to an activatable transposase carrying a sequencing adapter, such that the second binding member binds to the first binding member that binds to the tagged test compound at the one or more binding sites,

[0024] (iv) activating the transposase so that the transposase cleaves the nucleic acid at the one or more binding sites to generate fragments tagged at each end with a sequencing adapter, and

[0025] (v) Sequencing the labeled fragments.

[0026] In other embodiments of the first aspect, the sequence of the generated or labeled fragments may be determined by hybridization-based techniques, preferably sequence-specific amplification.

[0027] The test compound may bind to the nucleic acid or a protein associated with the nucleic acid at multiple locations within the nucleic acid. The method of the first aspect may be useful in identifying or mapping these multiple locations.

[0028] The method of the first aspect can include mapping the positions of the binding sites of a plurality of test compounds. For example, a method of mapping the positions of the binding sites of a population of test compounds within a nucleic acid can include:

[0029] (i) contacting the nucleic acid with a population of tagged test compounds, each tagged test compound in the population comprising a test compound covalently attached to a tag,

[0030] wherein the labeled test compounds in the population bind to the nucleic acid or a protein associated with the nucleic acid at one or more sites within the nucleic acid,

[0031] (ii) contacting the labeled test compound with a population of first binding members such that each first binding member in the population specifically binds to a different labeled test compound in the population,

[0032] (iii) contacting the nucleic acid with a population of second binding members linked to activatable nucleases such that each second binding member in the population specifically binds to a different first binding member that binds to the tagged test compound at a binding site in the nucleic acid,

[0033] (iv) activating the nuclease so that the nuclease cleaves the nucleic acid at the one or more binding sites to generate fragments, and

[0034] (v) Determining the sequence of the generated fragment.

[0035] The sequence of nucleic acid fragments generated by the nuclease that binds the tagged test compound in the population via the second and first binding members can indicate the location of one or more binding sites for the test compound within the nucleic acid.

[0036] The method of the first aspect can include mapping the position of the binding site of the test compound in the first nucleic acid and the second nucleic acid with the same or different nucleotide sequence, and identifying the position present in the first nucleic acid and not in the second nucleic acid or the position present in the second nucleic acid and not in the first nucleic acid. One of the first and second nucleic acids may have been processed. The influence of the position of the processing on the binding site can be determined.

[0037] In some embodiments of the first aspect, the effect of an unlabeled second test compound on the position of the test compound on the one or more binding sites within the nucleic acid or on the binding of the test compound to the one or more binding sites can be determined. For example, step (i) of the method can further include contacting the nucleic acid with an unlabeled second test compound, optionally wherein the unlabeled second test compound binds to the nucleic acid or a protein associated with the nucleic acid at one or more locations within the nucleic acid.

[0038] A second aspect of the present invention provides a kit for mapping the location of one or more binding sites of a test compound within a nucleic acid; the kit comprising:

[0039] a label, which is covalently attached or attachable to the test compound,

[0040] a first binding member which specifically binds to said tag,

[0041] a second binding member that specifically binds to the first antibody; and

[0042] A nuclease which is or can be linked to the second binding member.

[0043] Other aspects and embodiments of the invention are described in more detail below. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 shows that the Chemmap approach revealed genomic binding sites for the BET bromodomain-targeted drug JQ1. (A) Chemmap experimental workflow: In permeabilized cells, the pre-complex of the biotinylated drug and anti-biotin antibody binds to the chromatin target (protein or DNA structure). Then, the secondary antibody linked to the pA-Tn5 transposon is recruited to the drug binding site. Addition of Mg 2+The transposon was activated and an adapter was integrated at the drug binding site. After DNA purification, genomic fragments with adapters at both ends were enriched by PCR, which allowed genome-wide identification of drug binding sites by next-generation sequencing. (B) Chemical structure of biotinylated JQ1 conjugate. (C) Pairwise intersection shows high overall consistency of enriched peaks in five technical replicates of the JQ1-biotin Chemmap in K562 cells. (D) Venn diagram shows high-confidence binding sites for JQ1 (Chemmap, top) and its protein target BRD4 (CUT&Tag, bottom) in five technical replicates and two biological replicates in K562 cells. JQ1 and BRD4 have 19,693 consensus peaks (93%). (E) Gene browser view of JQ1 Chemmap (track 1; biotin Chemmap, track 2) and BRD4 CUT&Tag (track 3; no primary antibody CUT&Tag as control, track 4) compared to published JQ1 Chem-Seq (track 5; input Click-Chem-Seq, track 6) and BRD4 ChIP-Seq (track 7; input ChIP-seq, track 8) data at the CCND2 locus. Boxes highlight the respective close-up view regions at 50 kb and 5 kb scales, respectively. (F) Comparison of fraction-in-peak reads (FRiP) analysis of JQ1 Chemmap, BRD4 CUT&Tag, JQ1 Click-Chem-seq (different JQ1 derivatives, JQ1-TCO and JQ1-PA), and BRD4 ChIP-seq in K562 cells. (G) Comparison of the average values ​​of JQ1 Chemmap and published JQ1 Chem-seq signals at high confidence loci detected with BRD4CUT&Tag in K562 cells. The two JQ1 Chemmaps are highly similar curves that almost merge together, as shown by the peaks with a maximum peak height of 8. JQ1-TCO Click-seq and JQ1-PA Click-seq are close to the baseline. Data are normalized by sequencing depth.

[0046] Figure 2 shows the characterization of the Chemmap of JQ1. (A) Spearman correlation matrix hierarchical clustering of two biological replicates (B1 and B2) of the JQ1 Chemmap in K562 cells, each with 5 technical replicates (t1 to t5). (B) Pairwise intersection of the enriched peaks of the JQ1 Chem-map from K562 cells containing the second biological replicate of five technical replicates. (C) Principal component analysis (PCA) comparing JQ1 Chemmap, biotin Chemmap and BRD4 CUT&Tag in K562 cells. (D) Venn diagram showing high confidence binding sites for JQ1 (Chem-map, left) and its protein target BRD4 (CUT&Tag, right) in U2OS cells. JQ1 and BRD4 have 9001 consensus peaks (93%).

[0047] Figure 3 shows genome-wide binding sites for DNA G-quadruplex binders. (A) Chemical structures of biotinylated G4 ligands PDS (left) and PhenDC3 (right). (B) Gene browser view of Chemmaps of PDS-biotin (first track) and PhenDC3-biotin (second track) compared with CUT&Tag data of the G4 antibody BG4 (fourth track) at the KRAS locus. Sites that fold into G4 structures in vitro (called observed quadruplex sequences, OQS) are highlighted (OQS+ is the positive strand, fifth track; OQS- is the reverse strand, sixth track). Boxes highlight close-up view areas at a scale of 5 kb. (C) Venn diagram showing the overlap of binding sites for the G4 ligands PDS-biotin (left) and OQS (right). (D) Hierarchical clustering of Spearman correlation matrices for PDS, PhenDC3, and BG4. (E) Venn diagram showing the overlap of binding sites for the G4 ligands PDS-biotin (upper left) and PhenDC3-biotin (lower), and BG4 CUT&Tag (upper right).

[0048] Figure 4 shows the Chemmap representation of G4 ligands (PDS and PhenDC). (A) G4 ligands bound to G4 forming oligonucleotides (c-Kit on the left, Myc in the middle, and Telo on the right) and negative control dsDNA induced thermal stability (ΔT m ) FRET-melting assay. Four compounds, PDS, PDS-biotin, PhenDC3, and PhenDC3-biotin, were evaluated. The ΔT of the four probes at 1 μM on dsDNA was m=0. Mean values ​​are from two independent experiments (n=2). (B) Venn diagram showing the overlap of binding sites for the G4 ligand PhenDC3-biotin (left) and OQS (right). (C) Principal component analysis (PCA) comparing Chemnmap experiments using G4 ligand and biotin control in K562 cells. (D) Differential binding analysis of PDS Chemmap and PhenDC3 Chemmap.

[0049] Figure 5 shows the genomic binding sites of doxorubicin identified by Chemmap. (A) Chemical structures of biotinylated doxorubicin derivatives Dox-biotin 1 (left) and Dox-biotin 2 (right). (B) Microscopic analysis of U2OS cells, visualizing the nuclear enrichment of doxorubicin (top), Dox-biotin 1 (middle), and Dox-biotin 2 (bottom). Three imaging channels: Hoechst for nuclei (left), RFP for doxorubicin and its derivatives (middle), and the merged mode of Hoechst / RFP (right). (C) Principal component analysis (PCA) comparing Chemmaps of different small molecules JQ1-biotin, PhenDC3-biotin, Dox-biotin 1, and PDS-biotin in K562 cells. (D) Venn diagram showing the overlap of Dox-biotin 1 binding sites (left) with open chromatin mapped by ATAC-seq (right). There are 12,896 consensus peaks (95%) between Dox-biotin 1 and ATAC-seq. (E) Gene browser view of Dox-Biotin 1 Chemmap binding sites (first track) compared to the biotin control (second track) and ATAC-seq (third track). The biotin Chemmap is the control (second track).

[0050] Figure 6 shows the characterization of Chemmap datasets for different small molecules. (A) Tapestation analysis comparing the relative DNA recovery of Dox-biotin 1, JQ1-biotin, and Dox-biotin 2 using Chemmap. (B) Random enrichment of JQ1-biotin, PDS-biotin 1, PDS-biotin 2, PhenDC3-biotin 1, PhenDC1-biotin 2, Doxorubicin-biotin 1, and Doxorubicin-biotin 2 on genomic features referenced to human annotation GENECODE v.28 (n=1000 permutations). UTR untranslated region: promoter defined as 1 kb upstream of the transcription start site. Peak distribution of Chemmap experiments for JQ1-biotin, PDS-biotin 1, PDS-b-biotin 2, PhenDC3-biotin 1, PhenDC1-biotin 2, Doxorubicin-biotin 1, and Doxorubicin-biotin 2 on different genomic features. (C) FRiP analysis of Chemmaps of two biological replicates of different small molecules JQ1-Biotin 1, PDS-Biotin 1, PDS-Biotin 2, PhenDC3-Biotin 1 and PhenDC3-Biotin 2 in K562 cells. (D) Gene browser view of peak patterns of JQ1-Biotin Chemmap (first track), BRD4 CUT&Tag (second track), PDS-Biotin Chemmap (third track), PhenDC3-Biotin Chemmap (fourth track), BG4 CUT&Tag (fifth track) and Doxorubicin-Biotin Chemmap (sixth track). (E) Differential binding analysis (FDR<0.05) comparing Chemmaps of binding sites of different small molecules in K562 cells. Light grey dots indicate sites where the binding of the two molecules is significantly different (considering two biological replicates with five technical replicates each).

[0051] Figure 7 shows the response to the combined drug treatment characterized by Chemmap. (A) Differential binding analysis shows the difference in Dox-biotin 1 Chemmap peaks for Tucidinostat treatment (1 μM, 72 hours) and solvent treatment (0.1% DMSO, 72 hours) in K562 cells. Light gray points indicate sites where the binding of the two molecules is significantly different (FDR<0.05) (considering two biological replicates, five technical replicates each). Positive fold changes indicate increased Dox-biotin 1 binding. (B) Venn diagram shows the overlap of high-confidence Dox-biotin 1 binding sites in K562 cells, solvent treatment (upper right) and Tucidinostat treatment (lower right) with ATAC-seq (upper left and lower left). (C) Random enrichment of Dox-biotin 1 Chemmap peaks on genomic features with reference to human annotation GENECODE v.28 (n=1000 permutations). Up / down, peaks significantly upregulated or downregulated in Tucidinostat-treated K562 cells. UTR untranslated region: The promoter is defined as 1 kb upstream of the transcription start site. (C) Gene browser view showing the differences in K562 cells treated with Dox-Biotin 1 combined with Tucidinostat (first track) or vehicle (second track) compared to a no antibody control (third track) and ATAC-seq (fourth track).

[0052] Figure 8 An example of a competitive Chemmap assay workflow is shown.

[0053] Fig. 9 Shown are Venn diagrams showing the overlay of PDS Chemmap high confidence peaks for K562 cells dosed with unmodified PDS (4 μM, 3 hours in 3 / 5 technical replicates) (left panel) and the overlay of these peaks with OQS (right panel).

[0054] Fig.10 Shown is a FRiP analysis comparing untreated and treated (unmodified PDS, 4 μM, 3 hours) PDS Chemmap in K562 cells.

[0055] Fig.11 Shown is a genome-wide mapping of biotinylated doxorubicin using pA-Tn5 and pA-MNase. Doxorubicin mapping using pA-Tn5 and MNase shows similar peak distributions, such as peaks 1, 2, and 3 highlighted in the dashed box. Lane 1 is the DoxChemmap and Lane 2 is the Dox mapping using pA-MNase.

[0056] Fig.12The chemical structures of PIP1-biotin, PIP2-biotin, and PIP3-biotin are shown.

[0057] Fig.13 The genome-wide mapping of the three biotinylated PIPs is shown. The results were also compared with biotinylated doxorubicin and the genomic accessible regions using ATAC-seq. As shown in Peak 1, all three PIPs bind to open chromatin as exemplified by ATAC-seq and Dox-biotin1 Chemmap. At the same time, as shown in Peak 2, PIP1-biotin and PIP2-biotin can also enter heterochromatin and are enriched in WGCWGCW regions. Lane 1: PIP1-biotin Chemmap; Lane 2: PIP2-biotin Chemmap; Lane 3: PIP3-biotin Chemmap; Lane 4: Dox-biotin1 Chemmap; Lane 5: ATAC-seq in K562 cells; Lane 6: Biotin Chemmap as a negative control; Lane 7: Motif search of WGCWGCW, W represents A / T. DETAILED DESCRIPTION OF THE INVENTION

[0059] The present invention relates to a method and a kit for mapping the position of a site of a test compound such as a chemotherapeutic drug in a nucleic acid that binds to the nucleic acid or a protein associated with the nucleic acid (i.e., a nucleic acid-associated protein). The nucleic acid is contacted with a test compound covalently attached to a label (i.e., a labeled test compound). The labeled test compound binds to the nucleic acid or a protein associated with the nucleic acid at one or more positions in the nucleic acid. The nucleic acid is also contacted with a first or primary binding member that specifically binds to the label so that the first binding member binds to the labeled test compound. Then, the nucleic acid is contacted with a second or secondary binding member that specifically binds to the first binding member. The second binding member binds to the first binding member that binds to the labeled test compound at the one or more binding sites. Then, a nuclease attached to the second binding member is activated to cut the nucleic acid to produce a nucleic acid fragment containing the one or more binding sites. The sequence of the nucleic acid fragment produced can then be determined, for example, by sequencing or site-specific amplification. The position of the one or more binding sites in the nucleic acid in the sample can be identified or mapped by the sequence of the fragment produced.

[0060] The nucleic acid can be RNA. For example, the position of the binding site of the labeled test compound in a population of RNA molecules such as a cell transcriptome or a portion or fragment thereof can be determined. Suitable RNA molecules can include nuclear RNA molecules, such as pre-mRNA and miRNA.

[0061] The nucleic acid can be DNA. For example, the location of the binding site of the labeled test compound in the cell genome or a portion or fragment thereof can be determined. In some embodiments, the nucleic acid can be a population of DNA molecules, for example, a product produced by amplifying all or part of a genome, such as one or more regions of interest or loci.

[0062] In some embodiments, the nucleic acid can be in the form of chromatin. Chromatin is a complex of DNA and protein that forms the chromosome of a eukaryotic cell. Chromatin for use as described herein can include part of a chromosome, a whole chromosome, or more than one chromosome. In a preferred embodiment, chromatin for use as described herein can include part or all of the nuclear and / or mitochondrial genome of a eukaryotic cell, for example, preferably the whole genome of a eukaryotic cell. Chromatin can include heterochromatin and euchromatin.

[0063] In some embodiments, the nucleic acid may be within a sample. Suitable samples may include tissues, organoids, cells, cell extracts, or cell components, such as organelles, such as nuclei or mitochondria.

[0064] In some preferred embodiments, the nucleic acid can be in a cell or a cell extract. For example, a sample comprising one or more cells can be contacted with a labeled test compound as described herein so that the labeled test compound contacts the nucleic acid in the cell. In some embodiments, the nucleic acid can be in a single cell or an extract from a single cell. In other embodiments, the nucleic acid can be in a cell population or an extract from a cell population.

[0065] This can map the location of the binding site of the test compound within the cell genome or transcriptome. For example, a method of mapping the location of one or more binding sites of a test compound within a cell genome or transcriptome may include:

[0066] (i) contacting a cell with a tagged test compound comprising a test compound covalently linked to a tag, wherein the tagged test compound binds to a nucleic acid or a protein associated with a nucleic acid at one or more locations within the genome or transcriptome of the cell,

[0067] (ii) contacting the tagged test compound with a first binding member that specifically binds to the tag, such that the first binding member binds to the tagged test compound,

[0068] (iii) contacting the cell with a second binding member that specifically binds to the first binding member and is linked to an activatable nuclease, such that the second binding member binds to the first binding member that binds to the tagged test compound at the one or more binding sites,

[0069] (iv) activating the nuclease so that the nuclease cleaves the nucleic acid at the one or more binding sites to generate fragments, and

[0070] (v) Determining the sequence of the generated fragment.

[0071] The cells may be permeabilised before, after or during step (i).

[0072] The sequence of the nucleic acid fragment may indicate the location of the one or more binding sites of the test compound within the genome or transcriptome of the cell.

[0073] In some embodiments, the cell can be a prokaryotic cell. For example, a prokaryotic cell can be contacted with an antimicrobial agent covalently attached to a tag as described herein. Suitable antimicrobial agents include compounds that bind to nucleic acid-associated proteins such as DNA gyrase.

[0074] In other embodiments, the cell can be a eukaryotic cell. The eukaryotic cell can be isolated, for example, as an immortalized cell line or a primary cell obtained from an individual, or can be in the form of a tissue or organoid. For example, the eukaryotic cell can be in a sample obtained from an individual, such as a biopsy or xenograft sample.

[0075] Suitable eukaryotic cells may include mammalian cells, preferably human cells. For example, eukaryotic cells may include somatic cells and germline cells, and may be at any stage of development, including fully or partially differentiated cells or undifferentiated or pluripotent cells, including stem cells, such as adult stem cells or somatic stem cells, fetal stem cells or embryonic stem cells. Suitable eukaryotic cells also include induced pluripotent stem cells (iPSCs), which may be derived from any type of somatic cells according to standard techniques. Eukaryotic cells may also include neural cells, including neurons and glial cells; contractile muscle cells; smooth muscle cells; hepatocytes; hormone-synthesizing cells; sebaceous gland cells; islet cells; adrenal cortical cells; fibroblasts; mesenchymal cells; epithelial cells; keratinocytes; endothelial cells; urothelial cells; osteocytes; chondrocytes; immune cells, such as leukocytes; mesothelial cells and adipocytes.

[0076] Suitable eukaryotic cells also include normal cells or cells associated with a disease state, such as cancer cells, e.g., carcinoma, sarcoma, lymphoma, blastoma, or germline tumor cells, and cells with a genetic disease genotype, such as Huntington's disease, cystic fibrosis, sickle cell disease, phenylketonuria, Down syndrome, or Marfan syndrome.

[0077] The cells may be permeabilized to allow the first and second antibodies to enter and reach nucleic acids within the cells. Suitable methods for permeabilization of cells are well known in the art and include contacting the cells with a detergent, such as 2-[4-(2,4,4-trimethylpentan-2-yl)phenoxy]ethanol (e.g., Triton X-100). TM ), nonylphenoxypolyethoxyethanol (e.g., NP-40 TM ), polyoxyethylene sorbitan monolaurate (e.g., Tween TM ), saponin, or digitonin. For example, cells can be permeabilized by exposure to digitonin (e.g., 0.05% digitonin).

[0078] In some embodiments, the cell can be an active cell or a living cell. For example, the step (i) of the method described herein can include contacting the active cell with a labeled test compound. The active cell can be, for example, treated with the labeled test compound or exposed to the labeled test compound in a determined time period (e.g., 1 to 48 hours, 2 to 36 hours, or 3 to 24 hours) in a culture medium so that the labeled test compound binds to the nucleic acid or nucleic acid-related protein in the cell. After being treated with the labeled test compound, before contacting the first binding member in step (ii), the cell is permeabilized.

[0079] In some embodiments, the nucleic acid or cells containing the nucleic acid can be fixed prior to contact with the test compound. Suitable methods for fixing cells are well known in the art and include contacting the cells with an aldehyde fixative such as formaldehyde, formalin, or glutaraldehyde; or an alcohol fixative such as methanol, ethanol, or acetone. For example, cells can be fixed by exposure to 0.1% formaldehyde.

[0080] In some embodiments, in the methods described herein, the nucleic acid or the cell containing the nucleic acid can be in solution. For example, the nucleic acid or the cell containing the nucleic acid can be contacted with the labeled test compound, the first binding member and / or the second binding member in solution. The nucleic acid or the cell containing the nucleic acid can be washed between steps, for example, by centrifugation and resuspension.

[0081] In other embodiments, nucleic acid or cells containing nucleic acid can be fixed on a solid support. Solid supports are insoluble non-colloidal bodies, on which capture molecules can be fixed to capture the surface of eukaryotic cells. Examples of suitable supports include slides, micropores, membranes or microbeads. The support can be in particle or solid form, including, for example, plates, test tubes, beads, balls, filters, fabrics, polymers or membranes. Capture molecules can bind to proteins, glycoproteins or other molecules on the surface of the eukaryotic cells. Suitable capture molecules for eukaryotic cells are well known in the art and include lectins that bind to extracellular glycoproteins on the cells, such as concanavalin A. In a preferred embodiment, the solid support is a magnetic bead, for example, a magnetic bead coated with a lectin (such as concanavalin A).

[0082] The sequence of the nucleic acid fragment can indicate the nucleic acid sequence at the position of the binding site of the test compound. In some embodiments, the test compound can bind nucleic acid or nucleic acid-related protein at multiple positions within the nucleic acid. The sequence of the nucleic acid fragment can indicate the nucleic acid sequence at the position of the binding site of the test compound.

[0083] The test compound can be a compound or molecule that binds to a nucleic acid or a nucleic acid-associated protein.

[0084] In some embodiments, the test compound can bind to a nucleic acid, such as RNA or DNA. The nucleic acid can be present in or extracted from a cell, organelle, or tissue; or it can be an amplification product of one or more target regions or loci in the nucleic acid.

[0085] In some embodiments, the test compound can bind to DNA, that is, the test compound can be a DNA binding compound. Suitable DNA binding compounds can include: compounds that are embedded between chromatin DNA base pairs; compounds that bind to the major or minor grooves of chromatin DNA; compounds that bind to specific secondary structures of chromatin DNA, such as G-quadruplexes, Z-DNA, H-DNA, i-motifs, and higher-order structures, such as loop interactions between enhancers and promoters; and compounds that bind to other nucleic acid features, such as repeat elements, DNA mismatches, and DNA damage sites. In other embodiments, the test compound can bind to RNA, that is, the test compound can be an RNA binding compound. Suitable RNA binding compounds can include RNA splicing modifiers, such as lisporam and its analogs.

[0086] In other embodiments, the test compound can bind to nucleic acid-associated proteins, such as DNA-associated proteins or RNA-associated proteins. The binding position of the test compound within the nucleic acid of the nucleic acid-associated protein can be determined by the methods described herein. Nucleic acid-associated proteins can include histones; transcription factors, such as Sox2 and c-Myc; nucleases, such as DNA enzymes and RNA enzymes; polymerases; helicases; gyrase; DNA damage repair enzymes, such as PARP, ATM and Rad51; epigenetic regulators, such as histone deacetylases (HDACs), histone acetyltransferases, histone acetyltransferases, histone demethylases, histone methyltransferases, EZH2, DOT1L, protein arginine deiminases, and epigenetic recognition protein domains, These include bromodomains (BRDs), such as BRD2 and BRD4; DNA methyltransferases; kinases, such as CDK4, CDK6, CDK7, CDK9, AMP-activated protein kinase (AMPK), Aurora kinases; Janus kinases (JAKs) and protein kinase C; nuclear receptors, such as retinoic acid receptors, thyroid hormone receptors, progesterone receptors, glucocorticoid receptors, androgen receptors and estrogen receptors; transcriptional cofactors, epigenetic transcriptional cofactors and deacetylases (Sirtuins).

[0087] In some preferred embodiments, the test compound can bind to histones. Histones include histones H2A, H2B, H3, H4 (so-called core histones), H1 / H5 (so-called linker histones). The core histones bind to form octamers, which bind to nucleosome DNA to form nucleosomes, wherein the linker histone H1 binds to the nucleosomes at the entry and exit sites of the DNA. Histone binding compounds can bind to unmodified histones or histones modified by histone marks, such as methylated (which can be monomethylated, dimethylated or trimethylated), glycosylated, phosphorylated, ADP ribosylated, acetylated, ubiquitinated, SUMOylated or citrullinated histones (Luger, K. et al (1997) Nature 389, 251–260; (Ausio J (2001) Biochem Cell Bio 79, 693).

[0088] The test compound may bind to the nucleic acid or nucleic acid-associated protein covalently or non-covalently.

[0089] In some preferred embodiments, the test compound binds non-covalently. For example, the test compound can bind non-covalently to chromatin with a Kd of 0.001 nM or more, 0.01 nM or more, 0.1 nM or more, 1 nM or more, 5 nM or more, 10 nM or more, 15 nM or more, or 20 nM or more. In some embodiments, the test compound can bind with an affinity of 0.1 nM to 20 μM, such as 1 nM to 10 μM or 5 nM to 1 μM.

[0090] In the methods described herein, the test compound can non-covalently bind to a nucleic acid or nucleic acid-associated protein without the need for subsequent covalent cross-linking to the nucleic acid or nucleic acid-associated protein.

[0091] Suitable test compounds may include peptides, such as peptides of 50 amino acids or less, and organic small molecules less than 5KDa or less than 1kDa, such as drugs, such as anticancer drugs. For example, the test compounds may include: nuclear receptor inhibitors, such as estradiol, tamoxifen, raloxifene, dihydrotestosterone, bicalutamide, dexamethasone, retinoic acid, triiodothyronine, progesterone, mifepristone and rosiglitazone; pyrrole-imidazole polyamides, such as PIP1, PIP2 and PIP2( Fig.12 ); kinase inhibitors such as PD0332991, LEE011, THZ, AT7519, flavopiridol and genistein; BET bromodomain inhibitors such as JQ1 and iBET151; CDK9 inhibitors such as AT7519; nitrogen mustard, doxorubicin, actinomycin, bleomycin, etoposide, thalidomide, carboplatin, oxaliplatin, mitomycin C, intercalators such as cisplatin, bleomycin and doxorubicin; G-quadruplex binding compounds such as PDS and PhenDC; HDAC inhibitors such as FK228, SAHA, LBH589 and valproic acid; Dot1L inhibitors such as EPZ004777; PARP inhibitors such as olaparib, iniparib, rucaparib and veliparib; and DNA polymerase inhibitors such as aphidicolin.

[0092] The test compound may bind to the nucleic acid or nucleic acid-associated protein at one or more positions in the nucleic acid. The test compound may directly bind to the nucleic acid at one or more positions within the nucleic acid sequence; or the test compound may bind to a nucleic acid-associated protein at one or more positions within the nucleic acid sequence. For example, a nucleic acid-associated protein containing a binding site for the test compound may bind to the nucleic acid at one or more positions within the nucleic acid sequence.

[0093] The test compound is covalently linked to a label to form a labeled test compound. The label can be any marker, molecule or group that allows a binding member to specifically bind to the test compound to which it is linked. The label can allow covalent or non-covalent binding of the binding member. Suitable labels include immunogens, such as digoxin; short peptides, such as glutathione and FLAG TM ; or small organic compounds, such as biotin and trimethoprim (TMP).

[0094] In some embodiments, suitable tags can allow covalent binding of binding members. Suitable tags can include click-based tags that react with binding members through click chemistry reactions. For example, click-based tags can include a first click chemistry group. Suitable click chemistry groups are well known in the art and can include one of an azide group or an alkyne group. The tag can react with a first binding member comprising a second click chemistry group, which reacts with the first click chemistry group (e.g., another of an azide group or an alkyne group) to covalently attach the binding member to the tag. Other suitable tags can include HaloTag TM Ligand, SNAP TM Ligand or CLIP TM ligand, and can respectively bind to the first binding member HaloTag TM Tags, SNAP TM Tags or CLIP TM Label covalently.

[0095] Preferably, the tag is biotin, and the tagged test compound may be a biotinylated test compound.

[0096] The tag may be directly linked to the test compound, or may be linked to the test compound via a linker. Suitable linkers may include alkyl chains, PEG chains, and combinations thereof. Suitable linkers may also include cleavable linkers, such as disulfides, and suitable linkers and methods for covalently linking the test compound and the tag are well known in the art.

[0097] The first binding member (also referred to as primary binding member) specifically binds to the label portion of the labeled test compound. For example, when the label is biotin; the first binding member can specifically bind to biotin. Suitable first binding members for binding to the biotin label can include anti-biotin antibodies, avidin and streptavidin.

[0098] A binding member is a molecule that specifically binds to a target molecule or ligand (such as a tag). The binding member may be covalently bound or more preferably non-covalently bound to the tag of the labeled test compound. A binding member that specifically binds to a tag may not show any significant binding to molecules other than the tag. In particular, the binding member may not show significant binding to proteins, DNA or other antigens that may be present in cells or cell extracts. Typically, an antibody or other binding member that specifically binds to a tag may have a specific binding affinity greater than about 10 5 mol / L (e.g., 10 6 or higher, 10 7 or higher, 10 8 or higher, 10 9 or higher, 10 10 or higher, 10 11 or higher or 10 12 or higher mol / L) binding affinity (Ka).

[0099] Suitable binding members can include antibody, nucleic acid aptamer, enzyme, peptide or other binding modes. In some preferred embodiments, binding members can be antibody, such as full antibody (such as IgG, such as IgG4) or antibody fragment (such as single-chain variable fragment (scFv), Fab, dAb, nano antibody, single-chain antibody, F (ab) 2 fragment, VHH fragment, VNAR fragment or single-chain Fab fragment (scFab)).

[0100] In the present method, antibodies suitable for use as the first binding member or the second binding member (also referred to as primary binding member and secondary binding member, respectively) can be monoclonal or polyclonal and can be produced using conventional techniques. For example, antibodies can be produced by immunizing mammals (e.g., mice, rats, rabbits, horses, goats, sheep or monkeys) with the label. Antibodies can be obtained from the immunized animals using any of the various techniques known in the art, and are preferably screened using the combination of antibodies and the label. For example, protein blotting techniques or immunoprecipitation (Armitage et al. (1992) Nature 357: 80-82) can be used. Isolation of antibodies and / or antibody-producing cells from animals may be accompanied by the step of sacrificing animals.

[0101] Monoclonal antibodies can be produced by isolating antibody-producing cells from immunized mammals and fusing them with immortalized cells to produce antibody-producing hybridoma cell populations. The population can then be screened to identify hybridoma cells that produce antibodies that exhibit the best binding properties. Methods for producing hybridoma cells and monoclonal antibodies are well known in the art (see, for example, Harlow et al Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory (Cold Spring Harbor, NY, 1988) pp. 353-355). As an alternative or supplement to immunizing mammals with peptides, antibodies specific to tags can be obtained from recombinantly produced libraries expressing immunoglobulin variable domains, for example, using lambda phages or filamentous phages that display functional immunoglobulin binding domains on their surfaces; for example, see WO92 / 01047. The library can be natural, constructed from sequences obtained from organisms that have not been immunized with peptides containing epitopes, or can be a library constructed using sequences obtained from organisms that have been exposed to the antigen of interest.

[0102] Suitable binding members for use as first binding member or second binding member in the present methods are well known in the art and can be produced using standard techniques or obtained from commercial sources.

[0103] The first binding member and the labeled test compound may be contacted with the nucleic acid sequentially or simultaneously.

[0104] In some embodiments, the labeled test compound can be contacted with a nucleic acid so that the binding of the labeled test compound occurs at one or more positions within the nucleic acid sequence. As described above, this may be useful, for example, when the nucleic acid is present in a living cell. The first binding member can then be contacted with the nucleic acid so that it binds to the labeled test compound bound at the one or more positions.

[0105] In other embodiments, the labeled test compound and the first binding member can be contacted with the nucleic acid at the same time. For example, a complex comprising the labeled test compound and the first binding member can be contacted with the nucleic acid. The methods described herein may also include contacting the labeled test compound with the first binding member to form the complex before contacting the complex with chromatin. Methods for mapping the position of one or more binding sites of a test compound in a nucleic acid may include:

[0106] contacting the nucleic acid with a complex comprising a tagged test compound and a first binding member, wherein the tagged test compound comprises a test compound covalently linked to a tag and binds to the nucleic acid or a protein associated with the nucleic acid at one or more locations within the nucleic acid; and the first binding member specifically binds to the tag;

[0107] contacting the nucleic acid with a second binding member that specifically binds to the first binding member and is linked to an activatable nuclease, such that the second binding member binds to the first binding member that binds to the tagged test compound at the one or more binding sites;

[0108] activating the nuclease such that the nuclease cleaves the nucleic acid at the one or more binding sites to generate fragments, and;

[0109] The sequence of the resulting fragment is determined.

[0110] Washing steps can be performed as needed to remove unbound reagents. For example, test compounds that are not bound to chromatin after the contacting step can be removed by washing. Similarly, the first binding member that is not bound to chromatin by the test compound after the contacting step can also be removed by washing. Suitable washing methods are well known in the art. For example, as described herein, washing can be performed using a buffer such as 20mM HEPES pH7.5, 150mM NaCl and 0.5mM spermidine.

[0111] The second binding member (also referred to as secondary binding member) specifically binds to the first binding member. For example, the second binding member can be an antibody. Suitable anti-immunoglobulin (Ig) antibodies are well known in the art. For example, the first antibody can be from a first species, such as a mammalian species, such as a rabbit, and the second antibody can bind to the antibody from the first species. For example, the second antibody can be from a second species, such as a different mammalian species, such as a guinea pig.

[0112] The second binding member can be covalently or non-covalently attached to the nuclease. In some embodiments, the second binding member can be non-covalently bound to the transposase. Suitable methods for non-covalent binding of nucleases to binding members are well known in the art. For example, the second binding member can be an antibody, and the nuclease can be fused to the immunoglobulin binding portion in the fusion protein. The fusion protein can be non-covalently bound to the second antibody through the immunoglobulin binding portion. Suitable Ig binding portions are well known in the art and can include protein A, protein G, protein L, protein Y or any binding domains of these, anti-Ig antibodies or antibody molecules, such as single-chain antibodies, Fab fragments, F(ab)2 fragments, VHH fragments, VNAR fragments, nano antibodies, single-chain variable fragments (scFvs) or single-chain Fab fragments (scFabs). In other embodiments, the second binding member can be covalently bound to the nuclease. For example, the second binding member and the transposase can be contained in a single fusion protein.

[0113] Nucleases are enzymes that can cleave phosphodiester bonds between nucleotides in nucleic acids. Suitable nucleases may include transposases. The nuclease may be an activatable nuclease. An activatable nuclease may be converted from an inactive state to an active state by changing conditions. For example, the activation of a nuclease may be achieved by increasing the amount of magnesium ions (Mg 2+ ) or manganese ion (Mn 2+ ) concentration (e.g., to a concentration of about 0.1 mM to about 10 mM), converting the magnesium-activated transposase to an activated state. 2+ ) concentration converts the calcium-activated micrococcal nuclease into an activated state. Suitable activatable nucleases are available in the art (see, for example, US9005935B2 and WO2022056309A1).

[0114] Suitable activatable nucleases are well known in the art and include micrococcal nuclease (MNase) and transposases, such as Tn5, Tn7, Mu, IS5 and IS91 (e.g., US9005935B2, Mizuuchi, K., Cell, 35:785, 1983; Savilahti, H, et al, EMBO J., 14:4893, 1995, Goryshin and Reznikoff, J. Biol. Chem, 273:7367 (1998) and WO2022056309A1). In some preferred embodiments, the nuclease may be a transposase, such as Tn5 transposase. One or more oligonucleotide adapters may be loaded to the transposase. For example, an oligonucleotide adapter may be non-covalently bound to the transposase to form a complex comprising the transposase and the one or more oligonucleotide adapters. Oligonucleotide adapters are described below. Suitable methods for loading the transposase with oligonucleotide adapters are well known in the art. For example, the oligonucleotide adapters can be incubated with the transposase for 1 hour at room temperature. In some embodiments, the sequence of the labeled fragment can be determined by sequencing, and the oligonucleotide adapters can be sequencing adapters. One or more sequencing adapters can be loaded to the transposase. For example, a sequencing adapter can be non-covalently bound to the transposase to form a complex comprising the transposase and the one or more sequencing adapters. Sequencing adapters are described below. Suitable methods for loading the transposase with sequencing adapters are well known in the art. For example, the sequencing adapters can be incubated with the transposase for 1 hour at room temperature.

[0115] The second binding member not bound to the first binding member after the contacting step can be removed by washing.

[0116] After the second binding member binds to the first binding member, the nuclease can be activated. Suitable methods for activating nucleases are well known in the art. For example, nucleases can be activated by increasing the concentration of suitable ions (e.g., magnesium ions or manganese ions for transposases and calcium ions for micrococcal nucleases). The activated nuclease cuts the nucleic acid at the position where the labeled test compound binds to the nucleic acid or nucleic acid-associated protein in the nucleic acid to produce nucleic acid fragments. For example, the nuclease can cut the nucleic acid within 10bp to 1000bp, preferably within 50bp to 500bp of the position of the binding site. The nucleic acid fragment contains the nucleic acid sequence at the position where the labeled test compound binds to the nucleic acid or nucleic acid-associated protein.

[0117] The nucleic acid is specifically cut by the nuclease at the position where the labeled test compound binds, generating a specific fragment population containing the nucleic acid sequence at these positions. This allows the nucleic acid sequence at these positions to be determined by subsequent analysis. When the nucleic acid is randomly fragmented (low signal-to-noise ratio), the sequence at these positions may be indistinguishable from other sequences.

[0118] In some embodiments, oligonucleotide adapters, such as sequencing adapters, can be connected to the ends of the nucleic acid fragments, such as by ligation, to produce nucleic acid fragments labeled with oligonucleotide adapters at each end. Suitable ligation methods are well known in the art.

[0119] The oligonucleotide adapter can be a double-stranded oligonucleotide, a partially double-stranded oligonucleotide or a single-stranded oligonucleotide, which is connected to a nucleic acid molecule to allow the sequence of the nucleic acid molecule to be determined. The oligonucleotide adapter can include an amplification adapter and a sequencing adapter. An amplification adapter is a double-stranded, partially double-stranded or single-stranded oligonucleotide, which is connected to a nucleic acid molecule to allow the molecule to be amplified, such as by PCR. Suitable amplification adapters can specifically hybridize with amplification primers and are easily available in the art. Sequencing adapters are double-stranded, partially double-stranded or single-stranded oligonucleotides, which are connected to a nucleic acid molecule to sequence. Suitable sequencing adapters for any sequencing method are available in the art. In some embodiments, a sequencing adapter can include a primer recognition sequence. A primer recognition sequence is a nucleotide sequence complementary to an amplification primer sequence. The presence of a primer recognition sequence allows the marked fragment to be amplified, such as by using a PCR of an amplification primer targeting the primer recognition sequence. The primer recognition sequence can be a non-naturally occurring heterologous sequence in a chromatin DNA sequence. Suitable primer recognition sequences are well known in the art and include the barcoded i7 / i5 primers of Illumina compatibility.

[0120] In some embodiments, the sequencing adapter may include a first sequencing adapter and a second sequencing adapter. The first sequencing adapter may include a first primer recognition sequence. The second sequencing adapter may include a second primer recognition sequence.

[0121] In some embodiments, the sequencing adapter may further include a barcode. The barcode is a nucleotide sequence that is unique to the sample from which the nucleic acid population is obtained. A suitable barcode sequence may be 6 to 10 nucleotides. The barcode allows the sequence reads to be clearly identified from a specific sample in a merged multiple sequencing reaction. Each sample may have a unique barcode so that all nucleic acids from the same sample receive the same barcode. Once prepared, nucleic acid populations from different samples may be mixed into a single pool and sequenced. Samples of sequence reads from the pool may then be identified from the barcode. For example, a suitable barcode for 24 sample multiple sequencing (24-plex reaction) may consist of at least 6 nucleotides, preferably 6 nucleotides (Craig DW et al. 2008. Nat Methods 5, 887; Cronn Ret al. 2008. Nucleic Acids Res, 36, e122). The use of barcodes in sequencing reactions is well known in the art. For example, Illumina sequencing 8-mer barcodes i5 and i7 may be used.

[0122] In embodiments where the nuclease is an endonuclease such as MNase, oligonucleotide adaptors such as sequencing adaptors can be ligated to the ends of the nucleic acid fragments, for example by ligation.

[0123] In the embodiment where the nuclease is a transposase, the transposase can be loaded with an oligonucleotide adapter, such as a sequencing adapter. The transposase can cut the nucleic acid and insert the oligonucleotide adapter at the end of the nucleic acid fragment. This produces a nucleic acid fragment labeled with an oligonucleotide adapter at each end, and can be referred to as "labeling" in this article. The oligonucleotide adapter suitable for attachment to the transposase can be a double-stranded oligonucleotide comprising a transposase recognition sequence and a primer recognition sequence. The transposase recognition sequence is a sequence that targets the transposition of the transposase. For example, the transposase recognition sequence can comprise a transposon sequence inserted by the transposase. The sequence of the transposase recognition sequence can depend on the transposase. Suitable transposase recognition sequences for transposase are well known in the art. For example, suitable transposase recognition sequences for Tn5 may include 19-mer terminal sequences, such as outer end (OE) sequences, such as 5'-CTG ACT CTT ATACAC AAG T-3' and inner end (IE) sequences, such as 5'-CTG TCT CTT GAT CAG ATC T-3', and chimeric end sequences, such as 5'-CTG TCT CTT ATA CAC ATC T-3'. In some preferred embodiments, 19-mer ME sequences may be used. In some embodiments, the oligonucleotide adapter may include a first oligonucleotide adapter and a second oligonucleotide adapter. The first oligonucleotide adapter may include a first transposase recognition site and a first primer recognition sequence. The second oligonucleotide adapter may include a second transposase recognition site and a second primer recognition sequence. For example, the sequencing adapter may include a first sequencing adapter and a second sequencing adapter. The first sequencing adapter may include a first transposase recognition site and a first primer recognition sequence. The second sequencing adapter may include a second transposase recognition site and a second primer recognition sequence.

[0124] In some embodiments, the labeled nucleic acid fragments produced as described above can be amplified to directly determine the sequence of the fragments. The labeled nucleic acid fragments can be amplified using one or more primers that hybridize to a nucleic acid sequence known to contain the binding site of the test compound. The labeled nucleic acid fragments are amplified with the primers to produce an amplified fragment indicating that the labeled nucleic acid fragment contains the nucleic acid sequence. For example, the labeled nucleic acid fragments can contain: a nucleotide sequence that the compound directly binds to within the nucleic acid; or a nucleotide sequence that is associated with a nucleic acid-associated protein that binds to the compound (or contained within the same or adjacent nucleosome).

[0125] Suitable nucleic acid sequences include RNA sequences, such as nuclear RNA, such as pre-mRNA and miRNA, and genomic DNA, such as chromosomes or mitochondrial DNA. Nucleic acid sequences can include binding sites, genes and transcripts related to biological responses and / or off-target toxicity to the test compound. Suitable binding sites, genes and transcripts can be, for example, known in the art, or can be predetermined by the methods described herein. Preferably, multiple groups of () primers are used to amplify the labeled nucleic acid fragments, and the multiple groups of primers are each hybridized with different nucleic acid sequences known to contain the binding sites of the test compound. This allows the presence of multiple nucleic acid sequences in the labeled nucleic acid fragments to be determined. Multiple nucleic acid sequences hybridized by the primer set can form a combination (panel). For example, the combination targeted by the primer set can include 2, 3, 4, 5, 6, 7, 8, 9, 10 or more, 100 or more or 1000 or more nucleic acid sequences. The combination may be useful, for example, as a "fingerprint" or "signature", to allow rapid identification of test compounds with desired characteristics and reduced off-target toxicity. Preferably, the nucleic acid fragments of quantitative amplification labeling make it possible to determine the copy amount or quantity of the nucleic acid sequence in the labeled nucleic acid fragments. This can, for example, determine the binding amount of the test compound to each nucleic acid sequence. Suitable amplification methods are fully established in the art and include quantitative polymerase chain reaction (qPCR), reverse transcription PCR (RT-PCR) and isothermal amplification.

[0126] The sample binding spectrum can be generated by the distribution of the nucleic acid sequences amplified by the multiple sets of primers. The sample binding spectrum can include a set of scores or values ​​indicating the number or density of each amplified nucleic acid sequence. The number or density of nucleic acid sequences comprising binding sites can indicate the amount or degree of binding of the test compound at the site, or the occupancy of the test compound at the site. Therefore, the sample binding spectrum can reflect the binding, occupancy or distribution of the test compound within the binding site range defined by the nucleic acid sequence groups amplified by the multiple sets of primers. The sample binding spectrum can be represented in any convenient format (e.g., digital or graphical).

[0127] In other embodiments, the marker nucleic acid fragments produced as described above can be amplified to produce amplified fragments for sequencing. The labeled nucleic acid fragments can be amplified using primers hybridized to the primer recognition sequence of the sequencing adapter. Suitable amplification methods are well established in the art and include polymerase chain reaction (PCR) (e.g., in PCR protocols; A Guide to Methods and Applications", Eds. Innis et al, 1990, Academic Press, New York, Mullis et al, Cold Spring Harbor Symp. Quant. Biol., 51: 263, (1987), Ehrlich (ed), PCR technology, Stockton Press, NY, 1989, and Ehrlich et al, Science, 252: 1643-1650, (1991) in review).

[0128] In some embodiments, the nucleic acid fragments or amplified nucleic acid fragments can be, for example, extracted from the sample. Suitable methods for extracting and isolating nucleic acids from biological fluid samples are well known in the art and include phenol / chloroform extraction and alcohol precipitation, cesium chloride density gradient centrifugation, solid phase anion exchange chromatography, and silica membrane-based techniques (e.g., Quick-cfDNA TM , Zymo Research Corp). Many known techniques and protocols for nucleic acid extraction, amplification and sequencing as described herein are well known in the art, for example, Molecular Cloning: a Laboratory Manual: 3rd edition, Russell et al., 2001, Cold Spring Harbor Laboratory Press; Protocols in Molecular Biology, Second Edition, Ausubel et al. eds. John Wiley & Sons, 1992); Next-generation Sequencing: Current Technologies and Applications; ed Jianping Xu Caister Academic Press (2014).

[0129] Amplification can produce a population or library of amplified fragments for sequencing. Each amplified fragment in the population or library can contain a nucleic acid sequence at the location of the binding site of the test compound. The population or library of amplified fragments produced as described herein can be purified using standard techniques before sequencing, including spin column chromatography (e.g., AmpureXP TM beads).

[0130] The labeled fragments or amplified fragments can be sequenced using standard sequencing techniques. Suitable techniques include the use of any convenient low-throughput or high-throughput sequencing technology or platform, including Sanger sequencing, Solexa-Illumina sequencing, ligation-based sequencing (SOLiD TM ), pyrosequencing; single-molecule real-time sequencing (SMRT TM ); PacBioscience sequencing; and semiconductor array sequencing (Ion Torrent TM ). Preferably, sequencing is performed by next generation sequencing techniques. Suitable protocols, reagents and apparatus for nucleic acid sequencing are well known in the art and are commercially available.

[0131] The sequence of the nucleic acid fragment can indicate the nucleic acid sequence of the position of the test compound binding site. For example, the sequence of the amplified fragment can include: a nucleotide sequence to which the compound directly binds within the nucleic acid; or a nucleotide sequence associated with a nucleic acid-associated protein to which the compound binds (or contained within the same or adjacent nucleosome). The position of one or more binding sites within the nucleic acid can be identified or mapped. For example, the position of one or more binding sites in the genome of a cell (such as a eukaryotic cell, a mammal, or a human cell) can be identified or mapped by the methods described herein.

[0132] In some embodiments, a set of sequence reads of a nucleic acid fragment can be generated by sequencing, for example, 1,000 or more, 10,000 or more, 100,000 or more, 1,000,000, 10,000,000 or more, or 100,000,000 or more, or 1,000,000,000 or more sequence reads can be generated. The sequence reads can be analyzed by conventional bioinformatics techniques. Suitable techniques are well known in the art. For example, duplicate reads, low-quality sequence reads, and reads caused only by sequencing adapters can be removed.

[0133] In some embodiments, the nucleic acid fragment sequence reads in the population can be analyzed for the presence of binding sites and / or patterns of binding sites. The nucleic acid fragment sequence reads in the population can be further analyzed for the presence of other features (such as mutations, epigenetic modifications, or sequence motifs) associated with binding sites and / or patterns of binding sites.

[0134] The nucleic acid fragment sequence reads in the population can be mapped to one or more positions in the reference genome. Suitable reference genomes are available in the art. For example, the human nucleic acid fragment sequence reads in the population can be mapped to positions in the human genome sequence. In some embodiments, the reference genome can be matched with the sex, race and / or other characteristics of the individual from which the sample is derived.

[0135] The nucleic acid fragment sequence reads in the population can be mapped by comparing the sequence reads in the population with the sequence of the reference genome such as the human genome. The position of the sequence reads in the reference genome can be identified. Suitable software tools for mapping sequence read populations within the genome are readily available in the art.

[0136] The distribution of nucleic acid fragment sequence reads in the population within the genome or at a set of sites or loci within the genome (i.e., the number of sequence reads mapped to each position or set of sites or loci within the genome) can be determined from the position of the sequence reads in the population. Optionally, the distribution of the amplified fragment sequence reads can be mathematically transformed. Suitable transformations include Fourier transforms.

[0137] The sample binding spectrum can be generated by the distribution or transformation distribution of the nucleic acid fragment sequence reads. The sample binding spectrum can include a set of scores or values, which indicate the quantity or density of the nucleic acid fragment sequence reads of each position or place (that is, full genome map) in the genome or a set of sites or loci in the genome. The quantity or density of the nucleic acid fragment sequence reads mapped to the position or place in the genome can indicate the binding amount or degree of the test compound in the position or place, or the occupancy of the test compound in the position or place. Therefore, the sample binding spectrum can reflect the combination, occupancy or distribution of the test compound in the target locus in the genome or the genome. The sample binding spectrum can be represented by any convenient format (such as digital or graphical).

[0138] In some embodiments, the sample binding profile can be used to identify the location of binding sites associated with the biological response to the test compound and may be useful in determining or predicting an individual's response to treatment with the test compound. The sample binding profile can be used for treatment stratification, optimization of combination therapy, diagnosis of disease conditions, or determination of side effects of treatment with a test compound.

[0139] A marker position is a location in the genome where the binding of the test compound varies between different sources, i.e., the binding of the test compound at the marker position is source-specific, e.g., from different individuals, tissues, or cell types. The binding of the compound at a set of marker positions in a sample binding profile can provide a signature that can characterize the source.

[0140] In some embodiments, suitable marker positions can be identified by determining the combination at multiple candidate positions in a reference binding spectrum from a set of reference sources. The reference binding spectrum may include a set of scores or values ​​indicating the combination at a set of marker positions in genomic DNA from a known source (such as a specific known tissue or cell type). The reference binding spectrum may reflect the combination at the position in the genomic DNA from a known source. Suitable reference binding spectrums can be obtained or generated by conventional experiments using known tissues or cell types, or generated from publicly available data sources (such as genomic information databases).

[0141] If the binding occupancy at the site is higher or lower for one reference source in the group than for the other sources in the group, the candidate position can be identified as a marker binding position. For example, the binding at the position can be higher or lower than the average binding at the position in the other reference sources in the group. In some embodiments, the binding at the position in one reference source can be higher or lower than a predetermined threshold relative to the average binding at the position in the other reference sources in the group.

[0142] In other embodiments, suitable marker positions can be identified by providing a first set of sample binding spectra from control individuals (e.g., healthy individuals) and a second set of sample binding spectra from test individuals (e.g., individuals with a disease condition such as a specific cancer or individuals known to respond or not respond to the test compound). The binding or occupancy of the compound at multiple candidate positions in the first set of sample binding spectra and the second set of sample binding spectra can be compared. If the binding or occupancy of the compound at the position is higher or lower in the first set of sample binding spectra than in the second set of sample binding spectra, the candidate position can be identified as a marker position. For example, the average binding or occupancy of the compound at the position can be higher or lower in the first set than in the second set. In some embodiments, the average binding or occupancy of the test compound at the position in the first set can be higher or lower than a predetermined threshold relative to the average binding or occupancy of the compound at the position in the second set.

[0143] If a candidate position is found to be in linkage disequilibrium with a site where binding or occupancy of the test compound to one reference source in the panel is higher or lower than to other sources in the panel, then the candidate position can also be identified as a marker position.

[0144] The sample binding profile from an individual can be used to determine the binding or occupancy of the test compound to a set of marker positions in the individual. This may be useful in determining the effect of the test compound on the individual or the responsiveness of the individual to the test compound, for example, to determine the effectiveness of treating the individual with the test compound, or to determine the suitability of the individual for treatment with the test compound. The sample binding profile from an individual can also be used to demonstrate the mechanism of action of the test compound; as part of a clinical trial; or as evidence of off-target toxicity, where the toxicity is caused by binding to other / alternative binding positions within a nucleic acid.

[0145] In some embodiments, the methods described above can be used for multiplex assays to map the location of binding sites for more than one test compound. For example, a method for mapping the location of binding sites for a population of test compounds within a nucleic acid can include:

[0146] (i) contacting the nucleic acid with a population of tagged test compounds, each tagged test compound in the population comprising a test compound covalently attached to a tag,

[0147] wherein the labeled test compounds in the population bind to the nucleic acid or a protein associated with the nucleic acid at one or more sites within the nucleic acid;

[0148] (ii) contacting the labeled test compound with a population of first binding members such that each first binding member in the population specifically binds to a different labeled test compound;

[0149] (iii) contacting the nucleic acid with a population of second binding members linked to activatable nucleases such that each second binding member in the population specifically binds to a different first binding member that binds to the tagged test compound at a binding site in the nucleic acid;

[0150] (iv) activating the nuclease such that the nuclease cleaves the nucleic acid at the one or more binding sites to generate fragments; and

[0151] (v) Determining the sequence of the generated fragment.

[0152] The sequence of nucleic acid fragments generated by the nuclease binding of the second and first binding members to the tagged test compounds in the population may indicate the location of the one or more binding sites for the test compound within the nucleic acid.

[0153] A group may include two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more or ten or more members.

[0154] In some embodiments, each labeled test compound in the population can be contacted with the first binding member individually to form a complex, and the complex is combined to produce a complex population comprising the first binding member and the labeled test compound. Different first binding members can be connected to each labeled test compound in the population. Then, the complex population can be contacted with the nucleic acid.

[0155] In other embodiments, each labeled test compound in the population can have a different label. The first binding member population can include first binding members with different labels that specifically bind to labeled test compounds in the population, such that different first binding members are attached to each labeled test compound in the population.

[0156] The second binding member population may comprise second binding members that specifically bind to respective different first binding members in the first binding member population, such that a different second binding member is linked to respective labeled test compounds in the population via the first binding member.

[0157] In some embodiments, different nucleases may be linked to each different second binding member, such that fragments produced by each nuclease can be distinguished.

[0158] In other embodiments, different oligonucleotide adapters can be loaded to the nucleases connected to the various second binding members, so that the fragments produced by each nuclease are marked with different adapters and can be distinguished. For example, the nuclease can be a transposase, and the transposase connected to the various second binding members can be loaded with different oligonucleotide adapters. The transposase connected to the labeled test compound via the first binding member and the second binding member can cut the nucleic acid at the binding site of the labeled test compound and insert the oligonucleotide adapter at the end of the nucleic acid fragment. This produces nucleic acid fragments labeled with oligonucleotide adapters at each end. Because the various second binding members are loaded with different oligonucleotide adapters, the sequence of the oligonucleotide adapter connected to each nucleic acid fragment can be used to identify the labeled test compound indicated by the nucleic acid fragment sequence binding site.

[0159] In some embodiments, the methods described above can be used in competitive assays. Examples of competitive assays described herein are Figure 8 A suitable assay may include contacting the nucleic acid with a labeled test compound and an unlabeled second test compound. For example, a method of mapping the location of one or more binding sites of a test compound within a nucleic acid may include:

[0160] (i) contacting the nucleic acid with a tagged test compound comprising a test compound covalently linked to a tag and an untagged second test compound, wherein the tagged test compound and optionally the untagged second test compound bind to the nucleic acid or a protein associated with the nucleic acid at one or more locations within the nucleic acid;

[0161] (ii) contacting the nucleic acid with a first binding member that specifically binds to the tag, such that the first binding member binds to the labeled test compound;

[0162] (iii) contacting the nucleic acid with a second binding member that specifically binds to the first binding member and is linked to an activatable nuclease, such that the second binding member binds to the first binding member that binds to the tagged test compound at the one or more binding sites;

[0163] (iv) activating the nuclease such that the nuclease cleaves the nucleic acid at the one or more binding sites to generate fragments; and

[0164] (v) Determining the sequence of the generated fragment.

[0165] The labeled test compound and the unlabeled second test compound can be contacted with the nucleic acid simultaneously or sequentially. For example, the nucleic acid can be contacted with the unlabeled second test compound, followed by the labeled test compound; the nucleic acid can be contacted with the labeled test compound, followed by the unlabeled second test compound; or the nucleic acid can be contacted with the unlabeled second test compound and the labeled test compound simultaneously.

[0166] The test compound and the second test compound can be the same or different (ie, they can be the same chemical compound or different chemical compounds).

[0167] In some embodiments, the test compound and the second test compound can be peptides or small organic molecules as described above. In other embodiments, the test compound can be a peptide or small organic molecule as described above, and the second test compound can be a protein, such as an antibody, nucleic acid or other macromolecule. For example, the second test compound can be a polypeptide of more than 50 amino acids or an organic molecule greater than 5KDa.

[0168] Also provided are kits for using the methods described herein, and the use of these kits in these methods. The kit may include;

[0169] (i) a label, which is covalently attached or can be attached to the test compound,

[0170] (ii) a first binding member which specifically binds to said tag,

[0171] (iii) a second binding member which specifically binds to said first binding member,

[0172] (iv) a nuclease which is or can be linked to the second binding member.

[0173] Suitable kit components are described above. A connectable label is a label that can be covalently attached to a test compound. Suitable connectable labels include labels comprising a first click chemistry group. Suitable click chemistry groups are well known in the art and may include one of an azide group or an alkyne group. The connectable label can react with a test compound comprising a second click chemistry group, and the second click chemistry group reacts with the first click chemistry group (e.g., another of an azide group or an alkyne group) to covalently attach the compound to the label.

[0174] The kit may further include (v) one or more sequencing adapters. The sequencing adapters may be connected or connectable to a transposase.

[0175] The kit may also include appropriate buffer and wash solutions; fixatives and permeabilization agents.

[0176] The kit may further comprise a solid support. Suitable solid supports may comprise capture molecules that bind eukaryotic cells, such as lectins.

[0177] The kit may also include nucleic acid extraction and purification reagents. Suitable reagents are well known in the art and include spin chromatography columns.

[0178] The kit may also include an amplification reagent. Suitable reagents are well known in the art and include primers, dNTPs and a thermostable polymerase. In some embodiments, the kit may include an amplification primer for amplifying one or more regions of interest or loci in the genome.

[0179] The kits may include instructions for use in the methods described herein.

[0180] Other aspects and embodiments of the invention provide the above-described aspects and embodiments in which the term "comprising" is replaced by the term "consisting of", and the above-described aspects and embodiments in which the term "comprising" is replaced by the term "consisting essentially of".

[0181] It will be understood that the present application discloses all combinations of any aspect and embodiment described above, unless the context otherwise requires. Similarly, the present application discloses all combinations of preferred and / or optional features (whether alone or together with any other aspect), unless the context otherwise requires.

[0182] Variations of the above embodiments, further embodiments, and modifications thereof will be apparent to those skilled in the art upon reading this disclosure, and therefore, these are within the scope of the present invention.

[0183] All documents and sequence database entries mentioned in this specification are incorporated herein by reference in their entirety for all purposes.

[0184] As used herein, "and / or" will be considered as specific disclosure of each of the two specified features or components with or without the other. For example, "A and / or B" will be considered as specific disclosure of each of (i) A, (ii) B, and (iii) A and B, just as if each were individually described herein.

[0185] experiment

[0186] In this application, we disclose a general method to build interaction maps of small molecules that bind to genomic DNA or chromatin proteins in situ. We exemplify the method with 3 different classes of DNA- or protein-interacting molecules. We validate our method in small cell samples with high signal-to-noise ratios using the bromodomain inhibitor JQ1. We then map, for the first time, the genomic targets of 3 widely used chemicals in cells, including 2 benchmark molecules that bind to G-quadruplex DNA and the first-line anticancer drug doxorubicin. Finally, we investigate the effect of HDACi on doxorubicin binding to genomic DNA.

[0187] Materials and methods

[0188] Summary

[0189] Chemicals and reagents were purchased from Sigma-Aldrich, MedChemExpress, and Fluorochem. All organic solvents were distilled by standard purification methods before use or purchased from Sigma-Aldrich in anhydrous form. All reactions were performed under argon in oven-dried glassware unless otherwise stated. NMR spectra were recorded on a Bruker 400 MHz Advance III HD spectrometer or a 500 MHz DCH Cryoprobe spectrometer in DMSO-d6 at 400 MHz and 500 MHz for 1H NMR and 125 MHz 13C NMR, respectively. NMR data are reported as follows: chemical shifts are recorded in parts per million (ppm), referenced to residual solvent peaks, multiplicity (s = singlet, d = doublet, t = triplet, q = quartet; m = multiplet, br = broad) and coupling constant values ​​are in Hz. LC-MS experiments were performed on an Amazon ESI-MS (Bruker) connected to a Dionex UltiMate 3000 UHPLC system (Thermo Fisher Scientific). High-resolution mass spectra (HRMS) were obtained from a Waters Vion IMSQTOF spectrometer. Flash column chromatography was performed using a CombiFlash Rf (Teledyne ISCO) and a C18 puriFlash column (Interchim). Pyridostatin (PDS) and PhenDC3 were prepared according to previously reported procedures.

[0190] Chemical synthesis

[0191] 1. Synthesis of JQ1-biotin

[0192]

[0193] JQ1 (1, 10 mg, 25 μmol) and HCTU (12.4 mg, 30 μmol) were dissolved in 1 mL of anhydrous DMF. Biotin-PEG2-NH2 (11.2 mg, 30 μmol) and DIEA (23 μl, 125 μmol) were added to the mixture and stirred at room temperature under argon for 2 hours. The solvent was evaporated to dryness in vacuo and the product was purified using flash column chromatography (C18 column, gradient elution: water (0.1% (v / v) TFA) at a flow rate of 18 mL / min for 30 minutes to MeCN (0.1% (v / v) TFA). The solvent was removed by freeze drying to obtain the product (JQ1-biotin, 17 mg, 90% yield) as a white powder. 1 H NMR (500MHz, DMSO) δ8.27(t,J=5.7Hz,1H),7.82(t,J=5.7Hz,1H),7.48(d,J=8.8Hz,2H),7.44–7.39(m,2H),6.40(s,1H),4.51(dd, J=8.0,6.3Hz,1H),4.31–4.25(m,1H),4.10(dd,J=7.7,4.4Hz,1H),3.51(tt,J=5.3,2.8Hz,4H),3.44(t,J=5.9Hz,2H),3.39(t,J=6 .0Hz,2H),3.33–3.12(m,7H),3.07(ddd,J=8.6,6.2,4.4Hz,1H),2.79(dd,J=12.4,5.1Hz,1H),2.59(s,3H),2.55(d,J=12.4Hz,1H) ,2.42–2.38(m,3H),2.04(t,J=7.4Hz,2H),1.61(s,3H),1.59–1.53(m,1H),1.51–1.40(m,3H),1.27(dtd,J=15.6,8.8,5.9Hz,2H). 13 CNMR(126MHz,DMSO)δ172.59,170.07,163.61,163.15,155.50,150.42,137.08,13 5.76,132.65,131.34,130.66,130.33,130.06,128.92,70.03,70.00,69.65,69.6 3,61.48,59.64,55.86,54.20,40.13,40.05,39.96,39.88,39.79,39.08,38.89,3 7.85,35.54,28.64,28.48,25.70,14.51,13.14,11.74.HRMS(ESI-QTof)m / z:[M+H]+ Calculated as C 35 H 46 ClN8O5S2 + :757.3660; measured, 757.2702.

[0194] 2. Synthesis of PDS-biotin

[0195]

[0196] The synthesis of di-boc protected PDS (2) has been reported previously (X. Zhang, et al. Nature Chem., 13 (2021) 626-633). Di-boc protected PDS (20 mg, 25 μmol) and biotin-PEG4-OSu (17.6 mg, 30 μmol) were dissolved in 1 mL of anhydrous DMF. DIEA (23 μl, 125 μmol) was added and the reaction was stirred at room temperature under argon for 2 hours. The solvent was evaporated to dryness in vacuo. The crude product was dissolved in 1 mL of DMF (30% TFA), stirred at room temperature for 30 minutes, and the solvent was evaporated to dryness in vacuo. The product was purified using flash column chromatography (C18 column, gradient elution: water (0.1% (v / v) TFA) at a flow rate of 18 mL / min for 30 minutes to MeCN (0.1% (v / v) TFA)). The solvent was removed by freeze drying to give the product as a white powder (PDS-biotin, 22.7 mg, 85%). 11H NMR (500 MHz, DMSO) δ 12.08 (s, 2H), 8.42 (dd, J = 8.3, 1.5 Hz, 2H), 8.18 (t, J = 5.6 Hz, 1H), 8.16–8.07 (m, 8H), 7.96–7.92 (m, 2H), 7.91 (s, 2H), 7.79 (ddd, J = 8.4, 5.6, 1.6 Hz, 3H), 7.55 (ddd, J = 8.2, 6.8, 1.2 Hz, 2H), 6.39 (s, 1H), 6.34 (s, 1H), 4.49 (t, J = 5.0 Hz, 4H), 4.32 (t, J = 5.5 Hz, 2H), 4.27 (dd, J = 7.7, 4.8 Hz, 1H), 4.09 (dd, J = 7.8, 4.5 Hz, 1H), 3.60 (t, J = 6.4 Hz, 3H), 3.56–3.47 (m, 13H), 3.34 (t, J = 5.9 Hz, 4H), 3.14 (q, J = 5.9 Hz, 2H), 3.05 (ddd, J = 8.6, 6.2, 4.4 Hz, 1H), 2.78 (dd, J = 12.5, 5.1 Hz, 1H), 2.58–2.51 (m, 1H), 2.35 (t, J = 6.4 Hz, 2H), 2.03 (t, J = 7.5 Hz, 2H), 1.57 (ddt, J = 12.3, 9.6, 6.0 Hz, 1H), 1.44 (ddt, J = 13.9, 10.0, 6.2 Hz, 3H), 1.26 (h, J = 8.1 Hz, 2H). 13 13C NMR (126 MHz, DMSO) δ 172.60, 171.06, 167.59, 163.74, 163.16, 162.14, 152.76, 151.49, 147.46, 131.29, 127.19, 124.99, 123.15, 119.47, 115.65, 112.57, 95.47, 70.20, 70.14, 70.11, 69.98, 69.58, 67.95, 67.17, 65.61, 61.48, 59.64, 55.86, 40.22, 40.13, 40.05, 39.96, 39.88, 39.79, 38.87, 38.69, 36.49, 35.52, 28.63, 28.48, 25.70. HRMS (ESI-QTof) m / z: [M+H] + Calculated for C 52 H 68 N 11 O 12 S2 + : 1070.2330; found, 1070.4765, 535.7427.

[0197] 3.PhenDC3-Biotin Synthesis

[0198]

[0199] PhenDC3-alkyne (3) was prepared by following the report of Lefebvre et al at Angewandte Chemie International Edition, 56 (2017) 11365-11369. 1 H NMR (400MHz, DMSO) δ12.15(s,2H),10.30(d,J=2.8Hz,2H),9.88(s,2H),8.87(d,J=8.4Hz,1H),8.68 (d,J=8.3Hz,1H),8.62(d,J=9.4Hz,1H),8.56–8.47(m,4H),8.25(s,2H),8.21(d,J=9.5Hz,1H),8.0 7(t,J=6.8Hz,3H),7.98(s,1H),7.70(s,1H),4.73(s,3H),4.72(s,3H),3.51(s,2H),3.18(d,J=6.0 Hz,2H),2.75(t,J=2.6Hz,1H),2.39–2.34(m,2H),2.28(t,J=7.0Hz,2H),1.80(s,2H),1.62(s,2H). 13 C NMR (101MHz, DMSO) δ170.2,164.2,163.7,152.5,148.0,145.8,145.7,145.8,145.7,138.8,135.5,135.4,134.7,134.5,133.9,133.8,132.8 ,131.0,130.3,130.0,129.9,129.2,125.3,122.9,121.6,119.4,119. 2,99.7,83.8,71.3,46.0,42.6,38.2,34.3,27.0,25.1,14.3; HRMS(ESI + ) is calculated as [C 45 H 40 N8O5F3] + :829.3068, m / z measured: 829.3057.

[0200] PhenDC3-alkyne (7, 5.4 mg, 6.5 μmol) and biotin-PEG3-azide (6 mg, 13 μmol) were suspended in 75 μL DMSO. Tris(2-carboxyethyl)phosphine (TCEP, 0.33 mmol, a freshly prepared 100 mM aqueous solution) was added, followed by copper sulfate (II) pentahydrate (0.33 mmol, a freshly prepared 10 mM aqueous solution). Tris(benzyltriazolemethyl)amine (TBTA, 0.33 mmol, a 40 mM 1:1 water / tert-butanol mixture stock solution) was added to the solution and stirred for 3 hours at room temperature under argon. Flash column chromatography (C18 column, gradient elution: water (0.1% (v / v) TFA) at 18 mL min -1 The mixture was purified by adding MeCN (0.1% (v / v) TFA) at a flow rate of 100 μg / mL for 30 minutes. The solvent was removed by freeze drying to obtain the product (PhenDC3-biotin, 2.9 mg, 41%) as a yellow powder. HRMS (ESI-QTof) m / z: [M2+] + Calculated as C 61 H 72 N 14 8S 2+ :580.26836; measured, 580.26768, 387.18184.

[0201] 4. Synthesis of Dox-biotin 1

[0202]

[0203] According to Tjandra et al. J. Med Chem, 63 (2020) 2181-2193, doxorubicin hydrochloride (4, 29 mg, 0.05 μmol) was dissolved in 4 mL of anhydrous DMF. Fmoc N-hydroxysuccinimide ester (Fmoc-OSu, 26 mg, 0.075 mmol) was dissolved in 1 mL of DMF and then added to the solution under constant stirring. DIEA (60 μL, 0.34 mmol) was added dropwise to the mixture to form a dark red solution. The mixture was stirred at room temperature under argon and protected from light. The reaction stopped after 4 hours. DMF was removed by vacuum, and 0.1% (v / v) trifluoroacetic acid aqueous solution was added to the remaining red oil to produce red crystals, which were washed with cold Et2O. The product doxorubicin-Fmoc (5) was then dried in vacuo and collected as red crystals (38 mg, 98%). The intermediate (5,38mg, 0.05mmol) was redissolved in 5mL anhydrous DMF and reacted with glutaric anhydride (53mg, 0.25mmol). DIEA (18μL, 0.1mmol) was added dropwise to the reaction mixture to form a dark red solution. The mixture was protected from light and stirred overnight at room temperature under a nitrogen atmosphere. After 24 hours, the reaction mixture was concentrated and the residual red oil was ground with 0.1% (v / v) trifluoroacetic acid aqueous solution to produce a red solid powder. The crude product was purified using a C18 fast column at 254nm and 200-300nm UV detectors, with MeCN (B) and water (0.1% formic acid) (A) as eluents, and a red powder (6,24mg, 55% yield) was obtained. N-Fmoc-adriamycin-O-semiglutaric acid ester (6) (10mg, 0.011mmol) was dissolved in 0.5ml anhydrous DMF. HCTU (5.6 mg, 13 μmol) and DIEA (3.8 μL, 22 μmol) were added to the solution. The mixture was stirred for 2 hours under an argon atmosphere. The solvent was evaporated in vacuo to dryness. The intermediate was resuspended in 1 mL of a 20% piperidine / DMF (v / v) solution and stirred at room temperature for 10 minutes. The solvent was evaporated in vacuo to dryness. The product was purified using flash column chromatography (C18 column, gradient elution: water (0.1% (v / v) TFA) at a flow rate of 18 mL / min over 30 minutes to MeCN (0.1% (v / v) TFA). The solvent was removed by freeze drying to obtain the product (Dox-biotin 1, 10.1 mg, 83% yield) as a red powder. 1H NMR(500MHz,DMSO)δ14.05(s,1H),13.27(s,1H),7.96–7.93(m,2H),7.86(t,J=5.6Hz,1H),7.82(t,J=5.7Hz,1H),7.74(d,J=5.3Hz,3H),7.71–7.66(m,1H),6.40(s,1H),6.35(s,1H),5.59(s,1H),5.46(d,J=6.3Hz,1H),5.32–5.28(m,1H),5.24(d,J=17.8Hz,1H),5.15(d,J=17.8Hz,1H),4.98(dd,J=5.5,2.9Hz,1H),4.30(dd,J=7.8,5.0Hz,1H),4.21(q,J=6.3Hz,1H),4.12(ddd,J=7.8,4.4,1.9Hz,1H),4.00(s,4H),3.55(d,J=5.6Hz,1H),3.39(q,J=5.9Hz,6H),3.18(p,J=6.0Hz,5H),3.13–3.07(m,3H),3.05(s,1H),2.93(d,J=18.2Hz,1H),2.81(dd,J=12.4,5.1Hz,1H),2.57(d,J=12.4Hz,1H),2.40(t,J=7.5Hz,2H),2.28(d,J=14.4Hz,1H),2.14(t,J=7.4Hz,2H),2.10(d,J=5.6Hz,1H),2.05(t,J=7.4Hz,3H),1.90(td,J=12.7,3.7Hz,1H),1.77(p,J=7.6Hz,3H),1.69(dd,J=12.2,4.4Hz,1H),1.60(ddd,J=15.9,10.1,4.7Hz,1H),1.54–1.39(m,4H),1.29(dt,J=15.7,7.7Hz,3H),1.19–1.14(m,5H). 13C NMR (126MHz, DMSO) δ207.82,186.71,186.61,172.13,172.10,171.54,162.69,160.86,155.94,154.44,136.3 8,135.10,134.83,133.85,120.05,119.85,119.09,110.86,110.79,99.27,75.10,69.78,69.72,69.55,69.16 ,69.10,66.20,66.14,65.41,61.02,59.18,56.66,55.41,46.66,45.75,39.69,39.61,39.52,39.44,38.45,3 8.43,36.11,35.08,34.13,32.58,31.87,28.19,28.03,25.25,20.65,16.62,8.64.HRMS(ESI-QTof)m / z:[M+H] + Calculated as C 52 H 73 N5O 19 S + :1102.2160; measured, 1102.4580.

[0204] 5. Synthesis of Dox-biotin 2

[0205]

[0206] Doxorubicin hydrochloride (4, 20 mg, 36 mmol) and biotin-PEG4-OSu (22 mg, 36 μmol) were dissolved in 1 mL of anhydrous DMF and added to a 5 mL flask. DIEA (7.1 μL, 55 μmol) was added and the reaction was stirred for 2 hours at room temperature under argon. The solvent was evaporated in vacuo to dryness. The product was purified using flash column chromatography (C18 column, gradient elution: water (0.1% (v / v) TFA) at a flow rate of 18 mL / min for 30 minutes to MeCN (0.1% (v / v) TFA). The solvent was removed by freeze drying to obtain a red powder product (Dox-biotin 2, 32 mg, 87% yield). 11H NMR (500 MHz, DMSO) δ 14.04 (s, 1H), 13.28 (s, 1H), 7.94–7.87 (m, 2H), 7.79 (t, J = 5.7 Hz, 1H), 7.69–7.61 (m, 1H), 7.55 (d, J = 8.1 Hz, 1H), 6.39 (s, 1H), 6.33 (s, 1H), 5.45 (s, 1H), 5.21 (d, J = 3.7 Hz, 1H), 4.94 (dd, J = 5.6, 3.5 Hz, 1H), 4.55 (s, 2H), 4.31–4.25 (m, 1H), 4.14 (q, J = 6.7 Hz, 1H), 4.10 (dd, J = 7.8, 4.4 Hz, 1H), 3.98 (s, 3H), 3.95 (s, 1H), 3.57 (s, 4H), 3.51 (td, J = 6.6, 1.7 Hz, 4H), 3.42 (ddt, J = 8.5, 5.5, 3.6 Hz, 6H), 3.38–3.30 (m, 4H), 3.14 (q, J = 5.9 Hz, 2H), 3.10–2.99 (m, 1H), 2.97 (d, J = 5.0 Hz, 2H), 2.79 (dd, J = 12.4, 5.1 Hz, 1H), 2.61–2.52 (m, 1H), 2.41–2.08 (m, 5H), 2.03 (t, J = 7.4 Hz, 2H), 1.81 (td, J = 12.9, 4.0 Hz, 1H), 1.58 (ddd, J = 20.6, 10.7, 6.1 Hz, 1H), 1.52–1.37 (m, 4H), 1.27 (dq, J = 14.3, 7.6 Hz, 2H), 1.11 (d, J = 6.5 Hz, 3H). 13 13C NMR (126 MHz, DMSO) δ 207.82, 186.71, 186.61, 172.13, 172.10, 171.54, 162.69, 160.86, 157.75, 157.51, 155.94, 154.44, 136.38, 135.10, 134.83, 133.85, 120.05, 119.85, 119.09, 110.86, 110.79, 99.27, 75.10, 69.78, 69.72, 69.55, 69.16, 69.10, 66.20, 66.14, 65.41, 61.02, 59.18, 56.66, 55.41, 46.66, 45.75, 38.45, 38.43, 36.11, 35.08, 34.13, 32.58, 31.87, 28.19, 28.03, 25.25, 20.65, 16.62, 8.64. HRMS (ESI-QTof) m / z: [M+H] + Calculated for C48 H 65 N4O 18 S + :1017.1100; measured, 1017.4043.

[0207] Cell culture and compound treatment

[0208] Mycoplasma-free human chronic myeloid leukemia K562 cells (RRID: CVCL_0004) from a 53-year-old woman were purchased from ATCC and cultured in RPMI 1640 (Gibco, 21875034) supplemented with 10% heat-inactivated fetal bovine serum (FBS, Gibco, A3840401). Human bone osteosarcoma epithelial U-2OS cells (RRID: CVCL_0042) from a moderately differentiated sarcoma of the tibia of a 15-year-old female osteosarcoma were obtained from ATCC and cultured in DMEM (Gibco, 41966029) supplemented with 10% FBS. Both cell lines were grown according to the ENCODE cell culture protocol and were regularly tested for mycoplasma contamination and short tandem repeat (STR) typing to confirm identity. HDAC inhibitors (HDACi) were prepared as stock solutions at 10 mM in DMSO. Cells were treated with HDACi dissolved at a final concentration of 1 μM or an equal concentration of solvent (0.1% DMSO) for 72 hours.

[0209] CUT&Tag

[0210] Recombinant pA-Tn5 and transposon components with DNA adapters have been described in detail elsewhere (WWI Hui, et al. Scientific Reports, 11 (2021) 1930). BRD4 CUT & Tag was performed as described previously (HS Kaya-Okur, et al. Nat. Protoc., 15 (2020) e23641). In short, cells were incubated with activated concanavalin A-coated magnetic beads (Bangs Labs, BP531). The cells bound by the beads were permeabilized and incubated with anti-BRD4 (E2A7X) rabbit antibodies (Cell Signalling Technology, 13440), followed by incubation with rabbit anti-mouse IgG antibodies (Antibodies-Online, ABIN101961, RRID: AB_10775589). The diluted pA-Tn5 adapter complex was then added, followed by a tagmentation reaction. The extracted DNA fragments were used for library preparation and Illumina sequencing.

[0211] Chemmap

[0212] Cell preparation. U-2OS cells were separated using Accutase and immediately quenched with complete medium. U-2OS and K562 suspension cells were collected by centrifugation and fixed in 0.1% formaldehyde (Thermo Scientific, 28906) in PBS for 2 minutes at room temperature, and then quenched with glycine to a final concentration of 75mM. Fixed cells were collected by centrifugation at 600x g for 4 minutes and then resuspended in cold wash buffer (20mM HEPES pH7.5, 150mM NaCl and 0.5mM spermidine (Sigma, S0266)) in nuclease-free water supplemented with EDTA-free cOmplete protease inhibitor (Sigma, 11873580001). (Note: For Chemmaps with G4 ligand, NaCl was replaced with an equal concentration of KCl in all buffers to maintain G4 stability. For optimal results, cell concentrations need to be adjusted based on target abundance and relative affinity of the probes. We used cells at 1500 cells / μL (JQ1-biotin) and 6000 cells / μL (G4 ligand and biotinylated doxorubicin).

[0213] Probe-primary antibody complex assembly. Compound stock solutions in DMSO were diluted to 10 μM in antibody buffer (2 mM EDTA, 0.1% BSA (Sigma, A8577), 0.05% digitonin (EMD Millipore, 300410) in wash buffer). For 5 samples, 20 μL of probe solution (10 μM) and 16.7 μL of anti-biotin (D5A7) rabbit mAb (CellSignaling Technology, 5597, approximately 10 μM concentration) were added to 200 μL of antibody buffer and incubated on ice for 1 hour to form a high concentration of complex (the probe was in excess at 1.2:1 to avoid nonspecific antibody binding). Next, 300 μL of antibody buffer was added to the probe-primary antibody complex solution to a final small molecule concentration of 0.4 μM.

[0214] Bead capture. For 5 samples, 50 μL (JQ1-biotin) or 75 μL (G4 ligand and biotinylated doxorubicin) of Concanavalin A beads (Bangs Labs, BP531) were washed twice in 1 mL of binding buffer (20 mM HEPES pH 7.5, 10 mM KCl, 1 mM CaCl2, and 1 mM MnCl2 in nuclease-free water) and resuspended in 75 μL of binding buffer. 100 μL of cell suspension was incubated with 10 μL of pre-washed Concanavalin A beads at 25°C, 600 rpm for 10 minutes. The bead-bound cells were gently washed twice with wash buffer, then resuspended in 100 μL of probe-primary antibody solution and incubated overnight at 4°C, 600 rpm.

[0215] Secondary antibody-Tn5 transposon complex assembly. For 5 samples, 2.5 μL of secondary antibody (Antibodies-Online, ABIN101961, RRID:Ab_10775589) and 5 μL of pA-Tn5 were added to 200 μL of Dig-300 buffer (20 mM HEPES pH 7.5, 300 mM NaCl, 0.5 mM spermidine, 0.01% digitonin in nuclease-free water supplemented with cOmplete protease inhibitors without EDTA) and incubated on ice for 1 hour. 300 μL of antibody buffer was added to the secondary antibody-Tn5 complex solution. (Secondary antibody-Tn5 complex ratio of 2:1).

[0216] Labeling. Wash cells 3 times with 500 μL Dig-wash buffer (0.05% digitonin in wash buffer), resuspend in 100 μL secondary antibody-Tn5 transposon solution, and incubate at 25°C, 600 rpm for 1 hour. Then wash cells 3 times in 500 μL Dig-300 buffer, then incubate in 300 μL labeling buffer (10 mM MgCl2 in Dig-300 buffer) at 37°C, 600 rpm for 1 hour.

[0217] DNA extraction. After labeling, wash cells twice with 500 μL TAPS washing buffer (10mM TAPS (AlfaAesar, J63268.AE) in nuclease-free water, 0.2mM EDTA). Add 150 μL extraction buffer (0.5mg / mL proteinase K (Thermo Scientific, EO0491), 0.5% SDS in 10mM Tris-HCl pH8.0), vortex and incubate at 55 ° C, 800 rpm for 1 hour. Next, add 100 μL phenol-chloroform-isoamyl alcohol (Invitrogen, 15593049) and mix. The mixture is transferred to a MaXtract high-density tube (QIAGEN, 129046) and centrifuged at room temperature, 16000x g for 3 minutes. Add 150 μL of chloroform to the upper aqueous phase, mix by inverting the phase-lock tubes, and centrifuge at room temperature at 16,000 x g for 3 min. Transfer the upper aqueous phase to a 1.5 mL DNA LoBind tube (Eppendorf, 022431021). Add 6 μL of 5M NaCl and 375 μL of cold ethanol, mix, and incubate overnight at -20°C. Centrifuge the sample at 4°C, 21,130 x g for 30 minutes. Carefully pour off the supernatant and rinse the DNA pellet with 1 mL of cold 100% ethanol, then centrifuge at 4°C, 21,130 x g for 2 minutes. After pouring off the wash solution and draining the remaining liquid with a paper towel, let the pellet air dry. Finally, the particles were resuspended in 25 μL of elution buffer 1 (10 mM Tris-HCl pH 8, 1 mM EDTA, 1 / 400 RNAse A (Thermo Scientific, EN0531) in nuclease-free water) by vortexing and incubating at 800 rpm for 10 min at 37°C.

[0218] Library preparation. In a 0.2 mL PCR tube, 25 μL NEBNext HiFi 2x PCR premix (NEB, M0541), 2 μL 10 μM Ad1 [JD Buenrostro, et al., Nature, 523 (2015) 486-490], 2 μL 10 μM Ad2 [JD Buenrostro, et al] and 21 μL labeled DNA were added, and PCR (72°C 5 min, 98°C 30 s, followed by 10 cycles of 98°C 10 s and 63°C 10 s, and one cycle of 72°C 1 min) was performed. The library was purified using AmpureXP beads (Beckman Coulter, A63882) at a 1.3X ratio (65 μL). After incubation at room temperature for 10 minutes, the bead-bound DNA was washed twice with 80% ethanol, and the library was eluted with 25 μL 10 mM Tris-HCl at room temperature for 5 minutes.

[0219] Library sequencing

[0220] The library size and concentration were measured using TapeStation HSD1000 ScreenTape (Agilent, 5067-5584). For size selection, the libraries were balanced and merged using Ampure XP beads. A 0.4X ratio of Ampure XP beads was added to the merged library and incubated at room temperature for 15 minutes, after which the supernatant was transferred to a new tube. A 1.3 ratio of Ampure XP beads was then added to the supernatant and incubated at room temperature for 15 minutes. The beads were washed twice with 80% ethanol and the library was eluted with 40 μL 10 mM Tris-HCl. The library was sequenced in a 36 bp × 2 double-end format on a NextSeq 500 sequencer (Illumina) using a High Output Kit (Illumina, FC-404-2005).

[0221] FRET melting assay

[0222] In the test buffer (60mM potassium cacodylate, pH = 7.4), 400nM FAM-AMRA dual-labeled oligonucleotides (Biomers) were annealed at 95°C for 5 minutes and then gradually cooled to 20°C. A series of probe concentrations were prepared in 8 tubes: 6μM ligands in 150μL test buffer were prepared as the initial concentration. Subsequent serial dilutions were completed by adding 100μL probe solution to 50μL test buffer to obtain 12 concentrations, including controls (1% DMSO). 25μL of each solution was transferred to a 96-well plate, and 25μL of annealed oligonucleotide solution was added to each well. The plate was then sealed with a transparent adhesive cover and gently shaken at room temperature for 10 minutes. The measured values ​​of the recovered FAM signal were recorded on the Bio-Rad CFX96 Touch real-time PCR detection system, which uses a temperature gradient from 25°C to 95°C of 0.5°C / min. The melting temperature was determined by the maximum of the first derivative of the relative fluorescence unit (RFU) value with respect to time, and ΔT was calculated by subtracting the baseline correction of the melting temperature of the control group. m The single-site binding model in GraphPad Prism 7 was used to fit the FRET T m The curves were averaged from two replicates.

[0223] Cell imaging

[0224] Approximately 40,000 U-2OS cells diluted in 1 ml of DMEM medium supplemented with 10% FBS were plated on 12-well plates. After incubation for 18 hours, live cells were treated with doxorubicin (1 μM), Dox-biotin 1 (1 μM), Dox-biotin 2 (1 μM) and 0.1% DMSO (control) in fresh medium for 6 hours. The cells were then washed twice with PBS and lightly fixed with 1% formaldehyde for 2 minutes. The cells were then incubated with Hoechst 33342 at 37°C for 10 minutes to label the nuclei. Imaging was taken in an EVOSM5000. Blue filter cubes with wavelengths of Ex 357 / 44 and Em 447 / 60 were used for visualization of the nuclei, and red filter cubes with wavelengths of Ex 531 / 40 and Em 593 / 40 were used for visualization of doxorubicin and its derivatives.

[0225] Bioinformatics data processing

[0226] 1. Data demultiplexing and deduplication. Illumina sequencing double-end output files were demultiplexed using decmuxIllumina version 3.0.9 with flags -cdiet 1 -r 0.01 -Rl 9. The resulting fq.gz files were sequenced for quality control using FastQC v0.11.8, and their summaries were visualized using MultiQC v1.11. Bases with a quality score below 20 were removed from both reads using cutadapt (cutadapt-q20). Fastq files were aligned to the combined hg38 and E. coli genomes using bwa 0.7.17-r1188, where only reads in the hg38 whitelist region continued the subsequent processing flow. Duplicates were removed using Picard version 2.20.3 (Picard MarkDuplicates), and peaks were called in the top 1% and 5% of AUC using loose and strict criteria without input controls, and the deduplicated bam files were sorted and indexed using seacr version 1.3.

[0227] 2. Peak calling. The deduplicated bam files were converted to bedpe files (bedtoolsbamtobed-bedpe), and then only fragments less than 1000bp in size were retained (awk'{if($1==$4&&$6-$2<1000)print$0}'). Next, bedtools genomecov was used to calculate the coverage of fragments <1000bp in the human genome and reported in bedgraph format. SEACR was then used to identify local enrichment regions. A SEACR strict search was performed to select the top 5% of peaks based on the total signal within the peak (SEACR_1.3$bdg_1000 0.05 non-strict). Peaks with a minimum coverage of 8 reads were retained for further analysis.

[0228] 3. Consensus region and reference comparison. Different thresholds were applied to generate peak files with minimum total signal in peak coordinates at 5, 8 and 10. For each threshold, the overlap between 5 technical replicates was calculated using Intervene tools (venn, upset and pairwise), and a series of .bed files containing at least 1 (merge of all technical replicates) to 5 (intersection of all technical replicates) were created using the -wa-wb flags of multiIntersectBed and bedtools v.2.30.0. The intersection between biological replicates can follow the same process. This classification of peaks allows quantification and sorting based on the standardized (cpm) signal intensity and the reproducibility of the peaks.

[0229] Evaluation of G4 enrichment quality using Chemmap-qPCR

[0230] G4 enrichment by Chemmap-qPCR was assessed by quantifying the relative enrichment of the constantly enriched G4 DNA region relative to the background region. For Chemmap-qPCR, Chemmap 10x PCR samples were used. DNA concentration and size distribution were checked with an Agilent HSD1000 Tapestation and normalized to the same amount for qPCR.

[0231] PCR reaction conditions: A master mix was prepared for each reaction. Chemmap samples were diluted 1 / 10. 5 μl of 2x premixed SYBRgreen qPCR mix and 2.5 μl of primer mix were added to each well, followed by 2.5 μl of diluted Chemmap samples. A plate seal was applied using a roller, and the plate was rotated (1 min 1000 rpm) before running qPCR. qPCR was performed for 40-45 cycles. RPA3 and MAZ were used as positive controls, and ESR1 and TMCC1 were used as negative controls. Primers used included the following:

[0232] Primer name Sequence (5′–3′) i7_primer_F AAGCAGAAGACGGCATACGAG i5_primer_F ACGGCGACCACCGAGATCTAC RPA3 forward CGG AAG TTG ACA GAT ACA GGG Reverse GAT CGC AGA AAG GTA GTC TCA G MAZ forward ACT CAG CGC AGG ATT GTA AAT A Reverse CCT CAT GCT TCG GCT TCC ESR1 forward GAA ACA GCC CCA AAT CTC AA Reverse TTG TAG CCA GCA AGC AAA TG TMCC1 forward GTG GTA CAC TGC CTA CAG TAT T Reverse GTA TAA CGC CTG GGC TAT GT

[0233] Statistical analysis

[0234] Data are presented as mean ± SD. The sample size (n) in the figure legends indicates the number of replicates in each experiment and is provided in the corresponding figure legends. The peak or gene size (N) in the heat map indicates the number of peaks or genes included. Statistical analysis of the relevant plots was performed by unpaired Student's t-test, and P values ​​are indicated in each figure.

[0235] result

[0236] Chemmap is based on the introduction of affinity tags into small molecules. When the small molecule enters its binding site in the nucleus, an antibody that recognizes the tag in the small molecule-antibody pre-complex can be used to recruit a second antibody pre-loaded with synthetic sequencing adapters and the transposase Tn5, which results in the insertion of sequencing adapters near the small molecule in situ binding ( Figure 1A ).

[0237] The recruitment of Tn5 to proteins bound to chromatin in lysate chromatin and permeabilized cells in this way has been exemplified by TAM-ChIP (Active Motif, M. Tedesco, et al., Nat. Biotechnol., 40 (2022) 235-244.) and CUT&Tag (9)). When DNA is extracted, the adapter fragments near the small molecule binding site can be selectively amplified by sequencing and then mapped by alignment with the genome. To validate the Chemmap method and compare the signal quality with established methods, we synthesized the biotinylated molecule JQ1 ( Figure 1B )(3,5).

[0238] JQ1 is a well-characterized inhibitor of the BET family of bromodomain proteins with high binding affinity (10). In parallel, we also mapped genome-wide binding sites of its primary target, BRD4, using specific antibodies in CUT&Tag (9). JQ1-biotin mapping experiments were performed in 150,000 human leukemia K562 cells with two biological replicates and five technical replicates to assess the robustness and reproducibility of our approach. In each experiment, we observed approximately 10,000 JQ1 binding sites with good reproducibility across technical and biological replicates (rS>0.9, see Figure 1C and Figure 2A , B). Next, we compared the high-confidence binding site sets of JQ1 Chemmap and BRD4 CUT&Tag (see Methods) and found that 93% of JQ1 peaks overlapped with BRD4 binding sites. We investigated BRD4 binding sites that did not overlap with JQ1 high-confidence peak sites and, after slightly optimizing the peak calling parameters based on the differences in binding affinities of the two probes, produced higher coverage of BRD4 binding sites by JQ1 (84%) ( Figure 2C Similarly, differential binding analysis revealed a strong overlap of JQ1 and BRD4 binding sites (1213 / 45667 differential sites, 2.7%) ( Figure 2D ). Furthermore, principal component analysis (PCA) confirmed that the JQ1 and BRD4 data clustered together and were significantly distant from the biotin control (Figure 2E). Overall, this suggests that ChemMap reliably reproduces the binding profile of JQ1 at its protein targets and that the observed differences are mostly due to non-optimal peak calling thresholds.

[0239] To assess the signal quality of ChemMap, we compared our findings with published JQ1Click-Chem-seq data in K562 cells, showing a substantial improvement in the signal-to-noise ratio of ChemMap ( Figure 1E)(5). To compare the methods quantitatively, we plotted the average read counts for Chemmap and Click-Chem-seq around the highest confidence BRD4 binding sites obtained by BRD4 CUT&Tag (7772 peaks present across all replicates). Despite using two orders of magnitude lower cell numbers, we found that Chemmap provided approximately 150-fold higher signal accumulation than Click-Chem-seq (maximum average read counts of 8.17 cpm and 0.05 cpm, respectively)( Figure 1F ).

[0240] After validating the approach with known protein inhibitors, we then sought to map the binding sites of two widely used G-quadruplex (G4) targeting molecules, PDS and PhenDC3, which was previously not possible (Figure 3a) (11,12). G4s are four-stranded structures that can form in G-rich DNA sequences. They are involved in gene regulation and are considered potential drug targets for cancer treatment (13). Small molecules that bind to G4s can interfere with transcription and replication forks, leading to DNA damage.

[0241] Only recently has G4 itself been mapped in chromatin using the specific antibody BG4 (14). Given the lack of understanding of how BG4 recognizes its binding targets and potential off-targets, there is a pressing need to cross-validate G4 topology in cells using a distinct, alternative approach. Furthermore, as more studies utilize G4 ligands in preclinical and clinical studies, there is a need to demonstrate that these chemicals can indeed bind their targets in situ. G4 ligands interact with the entire G-quartet surface of G4 via π-π stacking in crystal structures and have moderate binding affinities at the μM level (15). However, despite extensive attempts, direct mapping of binding sites for these small molecules in the nucleus has not been possible. Limited success with pull-down enrichment sequencing has only provided evidence for binding to telomeric repeat sequences (16). Perhaps the most convincing evidence for target engagement at the G4 locus comes from indirect approaches, such as mapping sites of strand breaks that are induced as a result of small molecule binding events (17). One of the major challenges in mapping DNA-small molecule interactions is the dissociation of ligands from DNA targets during wash steps, resulting in low recovery and poor signal-to-noise ratios.

[0242] Our previous attempts to map G4 ligands using traditional Chem-seq were unsuccessful, most likely due to the relatively low affinity of small molecules (16). Given the substantially improved sensitivity obtained with JQ1 Chemmap, we reasoned that transposon-based approaches in permeabilized cells (Figure 1a) would require that the lifetime of DNA-small molecule interactions be just long enough to allow catalytic insertion of linkers to label and select binding sites. The ligands PDS-biotin and PhenDC3-azide were synthesized and evaluated in biophysical assays as previously reported, and PhenDC3-biotin was coupled via a copper-assisted click reaction (16, 18). We inserted a flexible, long PEG4 linker into both probes to minimize binding perturbations and steric hindrance during antibody binding and DNA fragmentation ( Figure 3A ). A fluorescence resonance energy transfer (FRET)-melting assay was used to verify the binding of the tagged G4 ligand to different G4 oligomers in vitro ( Figure 4A ). We used both probes in our established ChemMap protocol but used 600,000 K562 cells per experiment to compensate for the relatively weak binding affinity of the G4 ligands. In addition, we used potassium salts instead of sodium in the buffer to mimic the intracellular ionic conditions and maintain the endogenous G4 landscape during the experiments. For both G4 ligands, we obtained high-quality maps, revealing about 20,000 high-confidence peaks for both G4-ligands in two biological replicates and five technical replicates ( Figure 3B In contrast, principal component analysis confirmed a clear separation from the biotin control experiment ( Figure 4C Comparing the high-confidence binding sites with published G4-seq data (OQS) (19), which contains all sites that have the potential to form G4 structures in human genomic DNA, we found a large overlap for both PDS (~89%) and PhenDC3 (~88%). Figure 3C and Figure 4B ). Next, we compared small molecule binding sites to published endogenous G4 maps observed via BG4 CUT&Tag experiments. In validating our approach, we observed strong high-confidence binding site overlap and signal correlation (rs>0.7) for antibodies compared to the G4 ligand map, with even higher correlations for PDS and PhenDC3 (rs>0.9)( Figure 3D , Figure 3E and Figure 4BThese results are consistent with previous in vitro binding experiments that found PDS, PhenDC3, and BG4 to be relatively broad-spectrum G4 binders with moderate G4 structural specificity (20). Nevertheless, the small molecules captured a diverse binding site space (5690 shared loci) that was not captured by BG4, which could be due to different probe binding preferences or G4 structural accessibility ( Figure 3E ). Due to the orthogonality of the antibody and small molecule probes, this data provides strong validation for the mapped endogenous G4 landscape. Furthermore, we observed similar trends when mapping both G4 ligands in U2OS cells, confirming the robustness of the ChemMap approach (Figure 4F). Overall, high-resolution mapping of G4 ligands directly confirms drug-target engagement in chromatin and should also serve as a valuable tool to guide the development of improved G4 ligands and therapeutics.

[0243] To assess the general applicability of this approach to detecting DNA-small molecule interactions, we studied a clinically approved drug, doxorubicin, which is thought to act by targeting DNA but has not been directly mapped to genomic DNA in cells. Doxorubicin belongs to the anthracycline class of anticancer antibiotics that can interact with DNA via an intercalation mechanism. The main anticancer effects of anthracyclines are DNA intercalation, inhibition of topoisomerase II, and formation of free radicals, which lead to DNA structural changes, DNA damage, and cytotoxicity (1). Approximately 1 million cancer patients are treated with doxorubicin or its variants each year. However, despite numerous studies of doxorubicin and its clinical applications over the past five decades, its mechanism of action remains unclear (21).

[0244] In order to use the Chemmap approach, we first had to design an appropriately labeled doxorubicin. By testing two coupling sites at 14-OH and 3'-NH2 as previously reported, we obtained the biotinylated derivatives Dox-biotin 1 and Dox-biotin 2 ( Figure 5A Next, we took advantage of the intrinsic fluorescence of doxorubicin and examined the cellular uptake of doxorubicin by U2OS cells using fluorescence microscopy ( Figure 5B ). Notably, doxorubicin and Dox-biotin 1 accumulated primarily in the nucleus, whereas Dox-biotin 2 was primarily localized in the cytoplasm. Similarly, we were unable to recover significant amounts of DNA when attempting to Chemmap Dox-biotin 2 in permeabilized K562 cells multiple times, highlighting the importance of 3'-NH2 for DNA binding events. In contrast, significant amounts of target DNA fragments were recovered from permeabilized K562 cells when Chemmap was performed with Dox-biotin 1 at varying probe concentrations. Notably, under the same conditions, 200 nM Dox-biotin 1 recovered up to 30 times more material than the other probes tested ( Figure 6B ).

[0245] Depending on the probe concentration, we observed approximately 14k high-confidence Dox-biotin 1 binding sites. Interestingly, Dox-biotin 1 peaks were primarily (95%) located in open chromatin regions mapped by ATAC-seq ( Figure 5D Given that we used saturating conditions of Dox-biotin 1 and that CUT&Tag-type approaches readily map heterochromatin histone marks and protein binding (9), it is unlikely that this binding profile is due to a technical bias of the Chemmap approach. Our findings instead suggest that chromatin accessibility is a prerequisite for doxorubicin-DNA binding in cells ( Figure 5D )(twenty two).

[0246] We then applied Chemmap to search for mechanistic evidence that epigenetic drugs (epi-drugs) could synergize chemotherapy by analyzing the kinetics of doxorubicin binding. Histone deacetylases (HDACs) are key chromatin silencing modifiers and are often dysregulated in cancer, making them an attractive therapeutic target for cancer treatment. Preclinical and clinical studies have shown that HDAC inhibitors (HDACi) can effectively sensitize cancer responses to doxorubicin treatment, causing apoptosis and cell death (23, 24). We selected Tucidinostat (chidamide), a selective HDAC inhibitor targeting class I HDAC1, HDAC2, HDAC3, and class IIb HDAC10, which has been clinically approved for peripheral T-cell lymphoma (PTCL) and adult T-cell leukemia lymphoma (ATLL) (25, 26), and combination therapy with doxorubicin is underway in preclinical and clinical trials ((27), NCT04231448).

[0247] We recovered a similar number of total high-confidence peaks after 72 h of treatment in K562 cells. Strikingly, differential binding analysis demonstrated that tucidinostat treatment enhanced doxorubicin binding and generated an overwhelming level of new binding sites ( Fig. 7A and Fig.7D In addition, HDACi pretreatment expanded the size of the original binding loci. To investigate the genomic distribution of new binding sites, Tucidinostat generated new binding sites outside the initial chromatin open regions (42% in Tucidinostat vs. 95% in the solvent group), indicating a significant advancement in chromatin remodeling ( Figure 4B). Overall, these results highlight that HDACi sensitizes cancer cells through expanded and newly established binding sites to enhance doxorubicin accessibility to chromatin. Thus, Chemmap provides a mechanism-based approach to understand the rationale for epigenetic drug combination therapy that will reinvigorate the field.

[0248] To confirm that the Chemmap reflects small molecule binding sites in living cells, we treated K562 cells with unmodified PDS (4 μM, 3 h) prior to PDS Chemmap. Fig. 9 We observed that as competitor concentration and treatment time increased, less DNA material was recovered and the number of peaks was greatly reduced (~6000 sites (60%) were lost compared to untreated) ( Fig.10 ).

[0249] To confirm that ChemMap can be performed with different nucleases, we mapped genome-wide binding of biotinylated doxorubicin using pA-Tn5 and pA-MNase. We found that doxorubicin mapped with pA-Tn5 and MNase showed similar peak distributions ( Fig.11 ). This suggests that nucleases such as MNase can be used to map binding sites via Chemmap.

[0250] Pyrrolimidazole polyamides are molecules that bind to the minor groove of DNA in a sequence-specific manner. By adjusting the composition of the PIP, it is possible to modify the target DNA sequence that is recognized. Three biotinylated PIPs ( Fig.12 ), which binds to dsDNA specifically with the following sequences: WGCWGCW (PIP1-biotin), WGCWGCW (PIP2-biotin), and WWCWWWGW (PIP3-biotin) (W represents A or T). According to the Chemmap protocol and data analysis, PIP1-biotin and PIP2-biotin showed enriched binding to the DNA sequence WGCWGCW at the genomic locus ( Fig.13 ).

[0251] We have demonstrated that Chemmap is a robust, convenient, and unambiguous method for mapping interaction sites of small molecules in genomic DNA and chromatin proteins in the nucleus. The method yields previously unobtainable insights into probe molecules and clinically used drugs, and we demonstrate the versatility of the method by mapping interaction sites for a chromatin protein inhibitor, two molecules that selectively interact with G-quadruplex structures, and finally doxorubicin, a known DNA-interacting compound that has been used for many years as an anticancer drug. Notably, Chemmap helps reveal the binding specificity of small molecules, to cross-validate the accuracy of drug targets (e.g., G4 structures), and, to understand the mechanistic rationale for combination treatments of diseases.

[0252] References

[0253] 1. RBSilverman, MW Holladay, The organic chemistry of drug design and drug action. (Elsevier / AP, Academic Press, is an imprint of Elsevier, Amsterdam; Boston, ed. Third edition / , 2014), pp.xviii, 517 pages.

[0254] 2. M. Schenone, V. BKWagner, PAClemons, Target identification and mechanism of action in chemical biology and drug discovery. Nat. Chem. Biol. 9, 232-240 (2013).

[0255] 3. L. Anders et al., Genome-wide localization of small molecules. Nat. Biotechnol. 32, 92-96 (2014).

[0256] 4. R. Rodriguez, KMMiller, Unravelling the genomic targets of smallmolecules using high-throughput sequencing. Nat. Rev. Genet. 15, 783-796 (2014).

[0257] 5.D.S.Tyler et al.,Click chemistry enables preclinical evaluation oftargeted epigenetic therapies.Science 356,1397-1401(2017).

[0258] 6.J.L.Meier,A.S.Yu,I.Korf,D.J.Segal,P.B.Dervan,Guiding the design ofsynthetic DNA-binding molecules with massively parallelsequencing.J.Am.Chem.Soc.134,17814-17822(2012).

[0259] 7.C.Anandhakumar et al.,Next-Generation Sequencing Studies Guide theDesign of Pyrrole-Imidazole Polyamides with Improved Binding Specificity bythe Addition of beta-Alanine.Chembiochem 15,2647-2651(2014).

[0260] 8.E.G.S.,B.Devesh,E.Asuka,A.A.Z.,Mapping Polyamide–DNA Interactionsin Human Cells Reveals a New Design Strategy for Effective Targeting ofGenomic Sites.Angew.Chem.Int.Ed.Engl.53,10124-10128(2014).

[0261] 9.H.S.Kaya-Okur et al.,CUT&Tag for efficient epigenomic profiling ofsmall samples and single cells.Nat.Commun.10,1930(2019).

[0262] 10.P.Filippakopoulos et al.,Selective inhibition of BETbromodomains.Nature 468,1067-1073(2010).

[0263] 11.R.Rodriguez et al.,A Novel Small Molecule That AltersShelterinIntegrity and Triggers a DNA-Damage Response at Telomeres.J.Am.Chem.Soc.130,15758-15759(2008).

[0264] 12.A.De Cian,E.Delemos,J.L.Mergny,M.P.Teulade-Fichou,D.Monchaud,Highly efficient G-quadruplex recognition by bisquinoliniumcompounds.J.Am.Chem.Soc.129,1856-1857(2007).

[0265] 13.S.Balasubramanian,L.H.Hurley,S.Neidle,Targeting G-quadruplexes ingene promoters:a novel anticancer strategy?Nat.Rev.Drug Discov.10,261-275(2011).

[0266] 14.R. -Hertsch et al.,G-quadruplex structures markhumanregulatory chromatin.Nat.Genet.48,1267(2016).

[0267] 15.W.J.Chung,B.Heddi,F.Hamon,M.-P.Teulade-Fichou,A.T.Phan,SolutionStructure of a G-quadruplex Bound to the BisquinoliniumCompound Phen-DC3.Angew.Chem.Int.Ed.53,999-1002(2014).

[0268] 16.S.Müller,S.Kumari,R.Rodriguez,S.Balasubramanian,Small-molecule-mediated G-quadruplex isolation from human cells.Nature Chem.2,1095-1098(2010).

[0269] 17.R.Rodriguez et al.,Small-molecule–induced DNA damageidentifiesalternative DNAstructures in human genes.Nat.Chem.Biol.8,301-310(2012).

[0270] 18.J.Lefebvre,C.Guetta,F.Poyer,F.Mahuteau-Betzer,M.-P.Teulade-Fichou,Copper–Alkyne Complexation Responsible for theNucleolar Localization ofQuadruplex Nucleic Acid Drugs Labeled byClick Reactions.Angew.Chem.Int.Ed.56,11365-11369(2017).

[0271] 19.V.S.Chambers et al.,High-throughput sequencing of DNAG-quadruplexstructures in the human genome.Nat.Biotechnol.33,877(2015).

[0272] 20.J.Spiegel,S.Adhikari,S.Balasubramanian,The Structure andFunctionof DNA G-Quadruplexes.Trends Chem.2,123-136(2020).

[0273] 21.X.Qiao et al.,Uncoupling DNAdamage from chromatin damagetodetoxify doxorubicin.Proc.Natl.Acad.Sci.U.S.A.117,15182-15192(2020).

[0274] 22.J.Shen et al.,Promoter G-quadruplex folding precedestranscriptionand is controlled by chromatin.Genome Biol.22,143(2021).

[0275] 23.P.N.Munster et al.,Phase I trial of vorinostat and doxorubicininsolid tumours:histone deacetylase 2 expression as a predictivemarker.Br.J.Cancer 101,1044-1050(2009).

[0276] 24.K.Vu et al.,Romidepsin Plus Liposomal Doxorubicin Is SafeandEffective in Patients with Relapsed or Refractory T-Cell Lymphoma:Results ofa Phase I Dose-Escalation Study.Clin.Cancer Res.26,1000-1008(2020).

[0277] 25.D.-S.Pan et al.,Discovery of an orally active subtype-selectiveHDAC inhibitor,chidamide,as an epigenetic modulator forcancertreatment.MedChemComm 5,1789-1796(2014).

[0278] 26.Y.Shi et al.,Results from a multicenter,open-label,pivotalphase IIstudy of chidamide in relapsed or refractory peripheral T-celllymphoma.Ann.Oncol.26,1766-1771(2015).

[0279] 27.M.-C.Zhang et al.,Clinical efficacy and molecular biomarkersin aphase II study of tucidinostat plus R-CHOP in elderly patients withnewlydiagnosed diffuse large B-cell lymphoma.Clin.Epigenetics 12,160(2020).

Claims

1. A method for mapping the location of one or more binding sites of a test compound within a nucleic acid, comprising: (i) contacting the nucleic acid with a tagged test compound comprising a test compound covalently linked to a tag, wherein the tagged test compound binds to the nucleic acid or a protein associated with the nucleic acid at one or more locations within the nucleic acid, (ii) contacting the tagged test compound with a first binding member that specifically binds to the tag, such that the first binding member binds to the tagged test compound, (iii) contacting the nucleic acid with a second binding member that specifically binds to the first binding member and is linked to an activatable nuclease, such that the second binding member binds to the first binding member that binds to the tagged test compound at the one or more binding sites, (iv) activating the nuclease such that the nuclease cleaves the nucleic acid at the one or more binding sites to generate fragments, and; (v) Determining the sequence of the generated fragment. 2 . The method of claim 1 , wherein the sequence of the nucleic acid fragment indicates the location of the one or more binding sites for the test compound within the nucleic acid.

3. The method of claim 1 or claim 2, wherein the test compound binds to the nucleic acid at one or more locations within the nucleic acid.

4. The method of claim 1 or claim 2, wherein the test compound binds to a protein associated with the nucleic acid at one or more locations within the nucleic acid.

5. The method according to any one of the preceding claims, wherein the test compound is covalently bound to the nucleic acid or a protein associated with the nucleic acid.

6. The method according to any one of claims 1 to 4, wherein the test compound non-covalently binds to the nucleic acid or a protein associated with the nucleic acid.

7. The method according to any one of the preceding claims, wherein the test compound is a small organic molecule of less than 5 kDa.

8. The method according to any one of the preceding claims, wherein the tag is biotin.

9. The method according to any one of the preceding claims, wherein the nuclease is fused to an immunoglobulin binding moiety in a fusion protein, and the fusion protein non-covalently binds to the second binding member via the immunoglobulin binding moiety.

10. The method of any one of the preceding claims, wherein the activatable nuclease is micrococcal nuclease.

11. The method according to any one of the preceding claims, wherein the activatable nuclease is a transposase.

12. The method of claim 11, wherein the transposase is Tn5.

13. The method according to any one of claims 1 to 12, wherein steps (i) and (ii) are performed simultaneously.

14. The method of claim 13, wherein the method comprises contacting the nucleic acid with a complex comprising the tagged test compound and the first binding member.

15. The method according to any one of claims 1 to 12, wherein steps (i) and (ii) are performed sequentially.

16. The method of any one of the preceding claims, wherein the nucleic acid is in a eukaryotic cell nucleus or an extract thereof.

17. The method of any one of claims 1 to 15, wherein the nucleic acid is within a cell or a cell extract.

18. The method of claim 17, wherein the cell is a prokaryotic cell.

19. The method of claim 17, wherein the cell is a eukaryotic cell.

20. The method of any one of claims 17 to 19, wherein step (i) comprises culturing living cells in the presence of the tagged test compound.

21. The method of claim 20, wherein the method further comprises permeabilizing the cells prior to step (ii).

22. The method of any one of the preceding claims, wherein the nucleic acid is RNA.

23. The method of claim 22, wherein the RNA is a cellular transcriptome or a portion thereof.

24. The method of any one of claims 1 to 21, wherein the nucleic acid is DNA.

25. The method of claim 24, wherein the DNA is a cellular genome or a fragment thereof.

26. The method according to any one of claims 1 to 25, wherein the first binding member is an antibody.

27. The method of any one of claims 1 to 26, wherein the second binding member is an antibody.

28. The method according to any one of claims 1 to 27, wherein the sequence of the generated fragments is determined by sequencing the fragments.

29. The method of any one of the preceding claims, comprising generating a set of sequence reads of the nucleic acid fragments.

30. The method of claim 29, comprising mapping the sequence reads in the population to one or more locations in a reference genome.

31. The method according to any one of claims 1 to 27, wherein the sequence of the generated fragment is determined by amplifying the fragment.

32. The method of claim 31, wherein the fragment is amplified using a set of primers specific for a nucleic acid sequence comprising a binding site for the test compound.

33. A method according to any of the preceding claims, comprising mapping the position of one or more binding sites of a test compound within a first nucleic acid and a second nucleic acid, and identifying the position of one or more binding sites present in the first nucleic acid but not in the second nucleic acid or the position of one or more binding sites present in the second nucleic acid but not in the first nucleic acid.

34. The method of claim 33, wherein the first nucleic acid is in a treated cell or cell extract and the second nucleic acid is in a cell or cell extract that has not been treated.

35. The method of claim 34, wherein the treatment is selected from: exposure to one or more compounds; exposure to light or irradiation; or exposure to cell culture conditions.

36. The method according to any one of claims 1 to 27, wherein the sequence of the generated fragment is determined by amplifying the fragment.

37. The method of claim 32, wherein the fragment is amplified using a set of primers specific for a nucleic acid sequence comprising a binding site for the test compound.

38. The method of any one of the preceding claims, wherein the nucleic acid is contacted with: (i) a population of tagged test compounds, each tagged test compound in the population comprising a test compound covalently linked to a tag and binding to the nucleic acid or a protein associated with the nucleic acid at one or more sites within the nucleic acid, (ii) a population of primary binding members, each primary binding member in the population specifically binds to a different labeled test compound in the population, and (iii) a population of secondary binding members linked to an activatable nuclease, each secondary binding member in the population specifically binding to a different primary binding member that binds the tagged test compound at its binding site.

39. The method of any one of claims 1 to 37, wherein step (i) further comprises contacting the nucleic acid with an unlabeled second test compound, optionally wherein the unlabeled second test compound binds to the nucleic acid or a protein associated with the nucleic acid at one or more locations within the nucleic acid.

40. The method of claim 39, comprising determining the effect of the presence of the untagged second test compound on the sequence of fragments generated by the tagged test compound.

41. A kit for mapping the location of one or more binding sites of a test compound within a nucleic acid, comprising: a label, which is covalently attached or attachable to the test compound, a first binding member which specifically binds to said tag, a second binding member that specifically binds to said first binding member; as well as A nuclease which is or can be linked to the second binding member.

42. A kit according to claim 41 for use in a method according to any one of claims 1-41.

Images