Determination of protein information by recoding amino acid polymers into DNA polymers

Abstract

The present disclosure relates to compositions of matter, methods, and systems for analyzing polymeric macromolecules, including polymeric macromolecules such as peptides, polypeptides, and proteins.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Application Nos. 63 / 388,317 filed on July 12, 2022, 63 / 399,294 filed on August 19, 2022, 63 / 439,523 filed on January 17, 2023, and 63 / 467,729 filed on May 19, 2023, which are incorporated herein by reference. Sequence Listing

[0002] This application contains a sequence listing that has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. The XML copy created on July 11, 2023 is named 062954-501001US_SL.xml and is 118,986 bytes in size. Technical Field

[0003] The present disclosure relates to compositions of matter, methods, and systems for analyzing polymeric macromolecules, including polymeric macromolecules such as peptides, polypeptides, and proteins. Background Art

[0004] Proteins are fundamental to cellular function. Therefore, the sequences and concentrations of thousands of proteins in each cell are key indicators of cell health. Abnormal sequences or concentrations of proteins may indicate disease states. However, there is currently a lack of tools and techniques for sensitive, accurate, economical, and unbiased characterization of the proteome. Early detection of abnormal sequences and / or concentrations is essential for the diagnosis and treatment of many diseases, such as cancer. For these and other reasons, better tools should be developed to evaluate the sequences and concentrations of proteins and peptides in biological samples.

[0005] Once such tools become available, the discovery of new biomarkers, accurate determination of concentrations of even the most minimally abundant proteins, discovery of important post-translational modifications, and monitoring of proteome dynamics will be some of the first steps toward improving health care. These initial steps toward a deeper understanding and earlier detection of important features of cancer and other health conditions will allow for diagnosis at the earliest stages, facilitate therapeutic discovery, and have a beneficial impact on patient care by informing the course of treatment.

[0006] Therefore, there is a need in the art for compositions of matter, methods, and systems for highly parallelized, accurate, sensitive, and high-throughput proteomic analysis. The present disclosure addresses this need and other needs. Summary of the invention

[0007] The present disclosure relates to compositions of matter, methods and systems for analyzing polymeric macromolecules, including peptides, polypeptides and proteins, in a highly parallel and high-throughput manner via recoding their sequences into DNA polymers.

[0008] In some embodiments, disclosed herein is a method for determining the identity and position information of amino acid residues of a peptide coupled to a solid support, the method comprising: (a) providing the peptide to the solid support, the peptide coupled to the solid support so that the N-terminal amino acid residue of the peptide is not directly coupled to the solid support and exposed to reaction conditions; (b) providing a chemically reactive conjugate, the chemically reactive conjugate comprising: (x) a circulating tag comprising a circulating nucleic acid associated with a cycle number, (y) a reactive portion for binding to the N-terminal amino acid residue of the peptide, and (z) an immobilization portion for immobilization to the solid support; (c) contacting the peptide with the chemically reactive conjugate, thereby coupling the chemically reactive conjugate to the N-terminal amino acid of the peptide to form a conjugated complex; (d) immobilizing the conjugated complex to the solid support via the immobilization portion; e) cleaving and thereby separating the N-terminal amino acid residue from the peptide, thereby providing an immobilized amino acid complex, the immobilized amino acid complex comprising the cleaved and separated N-terminal amino acid residue; (f) contacting the immobilized amino acid complex with a binding agent, the binding agent comprising: a binding portion for preferentially binding to the immobilized amino acid complex and a recoding tag comprising a recoding nucleic acid corresponding to the binding agent, thereby forming an affinity complex, the affinity complex comprising the immobilized amino acid complex and the binding agent, thereby bringing the circulating tag into proximity with the recoding tag within the affinity complex; (g) transferring the information of the recoding nucleic acid to the circulating nucleic acid of the immobilized conjugated complex to produce a recoding block; (j) obtaining sequence information of the recoding block; and (k) determining the identity and position information of the amino acid residues of the peptide based on the obtained sequence information. In some embodiments, cleaving the N-terminal amino acid residue from the peptide exposes the next amino acid residue as the N-terminal amino acid residue on the cleaved peptide. In some embodiments, the reactive portion of the chemically reactive conjugate cleaves the N-terminal amino acid residue from the peptide. Some embodiments include repeating steps (b) to (k) for each subsequent amino acid of the peptide. Some embodiments include washing the fixed amino acid complex prior to contacting the fixed amino acid complex with a binding agent. Some embodiments include determining the possible three-dimensional structure of the peptide based on the sequence information. In some embodiments, the recoding nucleic acid includes DNA or RNA. In some embodiments, the circulating nucleic acid includes DNA or RNA. In some embodiments, obtaining the sequence information of the recoding block includes sequencing. In some embodiments, the binding moiety includes a peptide, an antibody, an antibody fragment, or an antibody derivative. In some embodiments, the binding moiety includes an aptamer.In some embodiments, the binding moiety binds to natural amino acids, post-translationally modified amino acids, derivative forms of amino acids, derivative or stabilized forms of post-translationally modified amino acids, synthetic amino acids, amino acids with specific side chains, amino acids with phosphorylated side chains, amino acids with glycosylated side chains, amino acids with methylated modifications, or D-amino acids, or combinations thereof. In some embodiments, the solid support comprises beads, plates, or chips. In some embodiments, the solid support comprises a glass slide, silica, resin, gel, membrane, polystyrene, metal, nitrocellulose, mineral, plastic, polyacrylamide, latex, or ceramic. In some embodiments, the peptide comprises a hormone, a neurotransmitter, an enzyme, an antibody, a viral protein, a bacterial protein, a synthetic peptide, a bioactive peptide, a peptide hormone, an oligopeptide, a polypeptide, a fusion protein, a cyclic peptide, a branched peptide, a recombinant protein, a tumor marker, a therapeutic peptide, an antigenic peptide, or a signaling peptide. In some embodiments, the peptide is derived from a cell lysate, a blood sample, a plasma sample, a serum sample, a tissue biopsy, a saliva sample, a urine sample, a cerebrospinal fluid sample, a sweat sample, a synovial fluid sample, a stool sample, a gut microbiome sample, an environmental water sample, a soil sample, a bacterial culture, a viral culture, an organoid, a tumor biopsy, a sputum sample, or a hair sample. In some embodiments, the peptide is associated with a disease. In some embodiments, the transfer information includes performing nucleic acid amplification, enzymatic ligation, splint ligation, chemical ligation, template-assisted ligation, the use of a ligase, the use of a splint oligonucleotide, the use of a catalyst, the use of a bridging molecule, the use of a condensing agent, the use of a coupling agent, the use of a polymerase, the use of a complementary nucleic acid sequence, the use of a nicking enzyme, the use of a nucleic acid modifying enzyme, the use of a recombinase, the use of a strand displacement polymerase, the use of a single-stranded binding protein, a click chemistry reaction, a phosphodiester bond formation, or a peptide nucleic acid-mediated connection. In some embodiments, the information of the recoded nucleic acid comprises the sequence of the recoded nucleic acid or the reverse complement of the sequence of the recoded nucleic acid. In some embodiments, the transferring information comprises joining the recoded nucleic acid or the reverse complement of the recoded nucleic acid to the circulating nucleic acid.

[0009] In some embodiments, disclosed herein is a method for determining the identity and position information of multiple amino acid residues of a peptide, wherein the peptide comprises n amino acid residues, the method comprising: (a) coupling the peptide to a solid support such that the N-terminal amino acid residue of the peptide is not directly coupled to the solid support and exposed to a reaction condition; (b) providing a chemically reactive conjugate, wherein the chemically reactive conjugate comprises: (x) a circulating tag comprising a circulating nucleic acid associated with a cycle number, (y) a reactive portion, wherein the reactive portion is used to bind to and cleave the N-terminal amino acid residue of the peptide and expose the next amino acid residue as (c) contacting the peptide with the chemically reactive conjugate, thereby coupling the chemically reactive conjugate to the N-terminal amino acid of the peptide to form a conjugate complex; (d) immobilizing the conjugate complex to the solid support via the immobilization moiety; and (e) cleaving from the peptide and thereby separating the N-terminal amino acid residue, thereby exposing the next amino acid residue as the N-terminal amino acid residue on the cleaved peptide and providing an immobilized amino acid complex, wherein the immobilized amino acid complex comprises (f) repeating (b) to (e) n-1 times to assemble n-1 additional fixed amino acid complexes, each additional fixed amino acid complex correspondingly comprising nucleic acids associated with cycles 2 to n; (g) contacting the fixed amino acid complexes with a binding agent, the binding agent comprising: a binding portion for preferentially binding to one of the fixed amino acid complexes or a subset of the fixed amino acid complexes and a recoding tag comprising a recoded nucleic acid corresponding to the binding agent, thereby forming one or more affinity complexes, each affinity complex comprising the fixed amino acid complexes; (h) in each formed affinity complex, the circulating tag or its reverse complement is joined to the recoding tag to form a recoding block, thereby generating a plurality of recoding blocks, each recoding block corresponding to the formed affinity complex; (i) two or more members of the plurality of recoding blocks are joined to form a memory oligonucleotide; (j) sequence information of the memory oligonucleotide is obtained; and (k) based on the obtained sequence information, the identity and position information of the plurality of amino acid residues of the peptide are determined. In some embodiments, (g)-(h) are repeated 2, 3, 4 or more times. In some embodiments, n is an integer greater than or equal to 2. In some embodiments, each binding agent comprises a recoding tag having a unique nucleic acid sequence. In some embodiments, a plurality of binding agents comprise recoding tags having the same nucleic acid sequence. In some embodiments, the binding agent comprises a recoding tag having a unique sequence portion and a common sequence portion.Some embodiments include deprotecting the circulating tag between (f) and (g). Some embodiments include washing the fixed amino acid complex before contacting the fixed amino acid complex with a binding agent. Some embodiments include determining the possible three-dimensional structure of the peptide based on the sequence information. In some embodiments, the recoded nucleic acid includes DNA. In some embodiments, the circulating nucleic acid includes DNA. Some embodiments including obtaining the sequence information of the memory oligonucleotide include sequencing. In some embodiments, the binding portion includes an antibody or a fragment thereof. In some embodiments, the binding portion binds natural amino acids, derivatized amino acids, synthetic amino acids, or D-amino acids. In some embodiments, the binding portion binds post-translationally modified amino acids. In some embodiments, the solid support includes beads, plates, or chips. In some embodiments, the solid support includes a glass slide, silica, a resin, a gel, a membrane, polystyrene, a metal, nitrocellulose, a mineral, a plastic, a polyacrylamide, a latex, or a ceramic. In some embodiments, determining the identity and position information of multiple amino acid residues of the peptide includes determining the identity and position information of all amino acid residues of the peptide. In some embodiments, determining the identity and position information of the plurality of amino acid residues of the peptide comprises determining the identity and position information of only a subset of the amino acid residues of the peptide. Some embodiments comprise identifying the peptide by comparing the identity and position information of the plurality of amino acid residues with a database.

[0010] In some embodiments, disclosed herein are chemically reactive conjugates (CRCs) comprising: (A) a nucleic acid sequence tag; (B) a reactive portion for binding to and cleaving the N-terminal amino acid residue of a peptide; and (C) an immobilization portion for immobilization to a solid support. Some embodiments include a CRC represented by Formula I: wherein A comprises the circulating tag, B comprises the reactive portion, C comprises the immobilization portion, LA comprises an optional linker, and L B including an optional linker, and L C Some embodiments relate to a CRC of Formula I, wherein A comprises a circulating tag, B comprises a reactive moiety, C comprises an immobilization moiety, and L A Contains optional connector, L B including an optional linker, and L C An optional linker is included. Can be or include a central portion. Some embodiments include a CRC represented by Formula II: wherein A comprises the circulating tag, B comprises the reactive portion, C comprises the immobilization portion, and L AB including an optional linker, and L BC Some embodiments relate to a CRC of Formula II, wherein A comprises a circulating tag, B comprises a reactive moiety, C comprises an immobilization moiety, and L AB including an optional linker, and L BC Including optional linkers. In some embodiments, the reactive portion includes phenyl isothiocyanate (PITC), isothiocyanate (ITC), dansyl chloride, dinitrofluorobenzene (DNFB), enzymes or peptides, or combinations or derivatives thereof. In some embodiments, the reactive portion specifically cuts at a specific amino acid. In some embodiments, the reactive portion cuts more than a single amino acid or motif. In some embodiments, the fixed portion includes biotin, streptavidin, thiol groups, amine groups or carboxyl groups, azides, alkynes, olefins, arylboronic acids, aryl halides, halogenated alkynes, silylalkynes, Si-H groups, protected or photoprotected reactive groups, or photoactivated reactive groups. In some embodiments, the nucleic acid sequence tag is produced after the nucleic acid sequence is conjugated to a group for attaching a nucleic acid sequence, and the group includes hydroxylamine, tetrazine, azide, alkynes, alkenes, trans-cyclooctene, DBCO, bicyclononyne, norbornene, strained alkynes or strained alkenes, or derivatives thereof. In some embodiments, the reactive moiety is generated by attaching the reactive moiety to a group on the CRC for attaching the reactive moiety, the group comprising tetrazine, azide, olefin, alkyne, trans-cyclooctene, DBCO, bicyclononyne, norbornene, strained alkyne or strained olefin, or a derivative thereof. Some embodiments include a cleavable group between (A) and (B), between (B) and (C), between (A) and (C), between (A) and (B+C), between (B) and (A+C), or between (C) and (A+B), or any combination thereof. Some embodiments include a cleavable group between (A) and (B), between (B) and (C), or a combination thereof. In some embodiments, (A), (B) and (C) are linearly oriented relative to each other in any order: (A)-(B)-(C), (A)-(C)-(B), or (B)-(A)-(C).

[0011] In some embodiments, disclosed herein is a kit for determining the identity and position information of the amino acid residues of a peptide, the kit comprising: a chemically reactive conjugate comprising (a) a nucleic acid sequence tag and (b) a reactive portion, the reactive portion being coupled to the N-terminal amino acid residue of the peptide, thereby forming a conjugated complex, the conjugated complex comprising the chemically reactive conjugate coupled to the N-terminal amino acid of the peptide; a binding agent comprising a binding portion for preferentially binding to the conjugated complex and a recoding tag containing a recoding nucleic acid corresponding to the binding agent; and a reagent for transferring the information of the recoding nucleic acid to the circulating nucleic acid of the conjugated complex to produce a recoding block.

[0012] In some embodiments, disclosed herein is a method for sequencing a subset of nucleotides of an oligonucleotide, the method comprising: providing a combination of reversibly terminated nucleotides and non-reversibly terminated nucleotides in a nucleic acid sequencing reaction, wherein the nucleotides corresponding to the non-reversibly terminated nucleotides in the sequenced nucleic acid are not sequenced. Some embodiments include identifying the nucleotides corresponding to the reversibly terminated nucleotides in the sequenced nucleic acid. In some embodiments, the sequenced nucleic acid comprises a region comprising only a subset of nucleotides selected from A, C, G, and T, and wherein the subset of nucleotides is not sequenced. In some embodiments, the subset of nucleotides selected from A, C, G, and T comprises 2 nucleotides selected from A, C, G, and T. In some embodiments, the subset of nucleotides selected from A, C, G, and T comprises 3 nucleotides selected from A, C, G, and T. In some embodiments, the region comprises a primer sequence. In some embodiments, the region does not comprise a barcode sequence, a re-encoding nucleic acid sequence or a portion thereof, or a circulating nucleic acid sequence or a portion thereof.

[0013] In some embodiments, methods are disclosed herein, comprising: providing a conjugate comprising a reactive molecule coupled to a protected oligonucleotide; contacting the reactive moiety with a terminal amino acid of a peptide, thereby binding the reactive moiety to the terminal amino acid, and optionally cleaving the terminal amino acid from the peptide; deprotecting the oligonucleotide; and contacting the deprotected oligonucleotide with an enzyme or reagent for connection or polymerization. Some embodiments include reprotecting the oligonucleotide. In some embodiments, the reactive moiety cleaves the terminal amino acid from the peptide to expose the next terminal amino acid, and wherein the method further comprises contacting the next amino acid with another conjugate after reprotecting the oligonucleotide. In some embodiments, the terminal amino acid is an N-terminal amino acid. In some embodiments, the peptide is fixed to a solid support. In some embodiments, the conjugate comprises an organic small molecule. In some embodiments, the conjugate comprises a chemically reactive conjugate (CRC), comprising: (A) the oligonucleotide; (B) the reactive moiety; and (C) an immobilization moiety. In some embodiments, the oligonucleotide comprises a circulating nucleic acid.

[0014] In some embodiments, methods are disclosed herein, comprising: providing a conjugate comprising a peptide coupled to a protected oligonucleotide; contacting the terminal amino acid of the peptide so that a reactive portion is bound to the terminal amino acid and optionally cleaving the terminal amino acid from the peptide; deprotecting the oligonucleotide; and contacting the deprotected oligonucleotide with an enzyme or reagent for connection or polymerization. Some embodiments include reprotecting the oligonucleotide. In some embodiments, the reactive portion cleaves the terminal amino acid from the peptide to expose the next terminal amino acid, and wherein the method further comprises contacting the next amino acid with another conjugate after reprotecting the oligonucleotide. In some embodiments, the terminal amino acid is an N-terminal amino acid. In some embodiments, the peptide is fixed to a solid support. In some embodiments, the conjugate comprises an organic small molecule.

[0015] This summary of the invention is provided to introduce a selection of concepts in a simplified form and will be further described in the detailed description below. This summary of the invention is neither intended to identify the key or essential features of the claimed subject matter nor to limit the scope of the claimed subject matter. Other features, details, utilities and advantages of the claimed subject matter will be apparent from the following written detailed description, which includes those aspects shown in the drawings and defined in the appended claims. These aspects and other features and advantages of the present disclosure are described in more detail below. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order that the manner in which the above-mentioned features of the present disclosure can be understood in detail, the present disclosure briefly summarized above can be more particularly described by reference to embodiments, some of which are shown in the accompanying drawings. However, it should be noted that the accompanying drawings only show exemplary embodiments and therefore should not be considered as limiting its scope, and other equally effective embodiments may be admitted.

[0017] Thus, the foregoing and other features and advantages of the present disclosure will be more fully understood from the following detailed description of illustrative embodiments, taken in conjunction with the accompanying drawings, in which:

[0018] Figure 1 An exemplary division of the proteomics field by technology is shown.

[0019] Figure 2 A simplified block diagram of an exemplary workflow for analyzing polymeric macromolecules, including polymeric macromolecules such as peptides and proteins, according to embodiments of the present disclosure is shown.

[0020] Figure 3 Schematically shows an embodiment according to the present disclosure including Figure 2 The workflow of various operations process.

[0021] Figure 4 Schematically shows an embodiment according to the present disclosure Figure 3 Exemplary solid supports for spatially supporting macromolecular analytes during the process of.

[0022] Figure 5 Schematically shows an embodiment according to the present disclosure Figure 3 During the manipulation, the chemically reactive conjugate interacts with the terminal amino acid of the immobilized peptide.

[0023] Figure 6 Schematically shows an embodiment according to the present disclosure Figure 3 During the manipulation of the chemically reactive conjugate, the chemically reactive conjugate is immobilized on the solid support.

[0024] Figure 7 Schematically shows an embodiment according to the present disclosure Figure 3 During manipulation of the conjugate, cleavage of the terminal amino acid (eg, cleavage of the peptide bond) occurs after the conjugate has been immobilized.

[0025] Figure 8 Schematically illustrates an iterative repetition according to an embodiment of the present disclosure Figure 5-Figure 7 The result of the operation.

[0026] Fig. 9The assembly of an exemplary configuration of a re-encoding block according to an embodiment of the present disclosure is schematically illustrated.

[0027] Fig.10 The assembly of an exemplary configuration of a re-encoding block according to an embodiment of the present disclosure is schematically illustrated.

[0028] Fig.11 Schematically illustrated is the transfer of amino acid identity information from a recoding tag of a binding agent to a circulating tag of an immobilized conjugate to form a recoding block via ligation according to an embodiment of the present disclosure.

[0029] Fig.12 An iterative process for assembling a re-encoded block according to an embodiment of the present disclosure is schematically illustrated.

[0030] Fig.13 Schematically shows an embodiment according to the present disclosure Figure 3 The relative sizes of the various components in the process.

[0031] Fig.14 Schematically shows an embodiment according to the present disclosure Figure 3 Separation of incompatible chemical operations during the process.

[0032] Fig.15 Schematically illustrated is the assembly of a single memory oligonucleotide for subsequent DNA sequencing analysis according to an embodiment of the present disclosure.

[0033] Fig.16 Schematically illustrated is the remediation of incomplete recoding blocks during memory oligonucleotide assembly according to embodiments of the present disclosure.

[0034] Fig.17 Schematically illustrated are various oligonucleotide components within a sample volume during recoding block assembly according to embodiments of the present disclosure.

[0035] Fig.18 Schematically illustrated are various oligonucleotide components within a sample volume during memory oligonucleotide assembly according to embodiments of the present disclosure.

[0036] Fig.19 The release of memory oligonucleotides and conjugate complexes from a solid support according to embodiments of the present disclosure is schematically illustrated.

[0037] Figure 20A-20B PPO functionality is shown. Relative fluorescence units track the binding, cleavage and fixation of PPO to the N-terminal amino acid residue of the immobilized peptide (e.g. Figure 3 Steps 1-4).

[0038] Fig.21 Schematically illustrated is the regulation of proximity between oligonucleotide components during assembly of a memory oligonucleotide according to the methods described herein, according to embodiments of the present disclosure.

[0039] Fig. 22 Demonstrated is the utilization of universal sequences during assembly of memory oligonucleotides in accordance with embodiments of the present disclosure.

[0040] Fig.23 is a schematic diagram showing the transfer of information from a mapping oligonucleotide to a recoding block according to an embodiment of the present disclosure.

[0041] Fig.24 Alternative events during performance of the methods described herein, according to embodiments of the present disclosure, are schematically illustrated.

[0042] Fig.25 A schematic diagram depicting useful process steps, system geometry, and components.

[0043] Fig.26 An exemplary model CRC using a model vanillin molecule instead of an oligonucleotide for proof-of-concept analysis is shown, showing the generation of the three described groups.

[0044] Fig. 27 Gel data showing the concatenation of model loop labels and recoding labels to produce a recoding block.

[0045] Fig.28 An example of a cyclic protection and deprotection workflow is shown.

[0046] Fig.29 Schematic representation of the 2-step assembly of the CRC to the N-terminus of the peptide.

[0047] Fig.30 Schematic representation of the 2-step assembly of the CRC to the N-terminus of the peptide.

[0048] Fig.31 Schematic representation of the 2-step assembly of the CRC to the N-terminus of the peptide.

[0049] Figure 32A-32B The CRC synthesis process and intermediate molecules are shown.

[0050] Fig.33 The functionality of PPO is shown: relative fluorescence units (RFU) of PPO immobilized on an azide-modified surface via a copper-catalyzed Huisgen cycloaddition reaction followed by reaction with amine-labeled fluorescein.

[0051] Fig.34The functionality of PPO is shown. Relative fluorescence units of a fluorescent oligonucleotide complementary to an oligonucleotide immobilized to PPO on an azide-modified surface via a copper-catalyzed Huisgen cycloaddition reaction.

[0052] Fig.35 Shown is the functionality of PPO: relative fluorescence units (RFU) of PPO immobilized onto different azide-modified surfaces via copper-catalyzed Huisgen cycloaddition reaction followed by reaction with amine-labeled fluorescein.

[0053] Figure 36A-Figure 36D An exemplary simulation of the binding of commercially available binding agents to immobilized PTH-ligand is shown.

[0054] Fig.37 PCR data concatenating the model cycle labels and the recoding labels to produce a recoding block is shown.

[0055] It should be understood that the drawings are not necessarily drawn to scale and that like reference numerals refer to like features. It is contemplated that elements and features of one embodiment may be beneficially incorporated in other embodiments without further recitation. DETAILED DESCRIPTION

[0056] The methods and compositions described herein can be used to determine the identity and positional information of the amino acid residues of a peptide. The peptide can be coupled to a solid support and contacted with a chemically reactive conjugate, which cuts the N-terminal amino acid of the peptide and couples the N-terminal amino acid to a solid support with a circulating tag. It can then be contacted with a binding agent (such as a binding agent that is specific to the N-terminal amino acid). The binding agent can include a recoding tag. The circulating tag and the recoding tag can include nucleic acid information, which can be sequenced to obtain the identity and positional information of the N-terminal amino acid. The process can be repeated for each amino acid of a peptide. Therefore, the position and information of the amino acid residues of a protein can be recoded using nucleic acids and obtained after sequencing the nucleic acids.

[0057] In some embodiments, disclosed herein is a method for determining the identity and position information of amino acid residues of a peptide coupled to a solid support, the method comprising: (a) providing a peptide to a solid support, the peptide being coupled to the solid support so that the N-terminal amino acid residue of the peptide is not directly coupled to the solid support and exposed to reaction conditions; (b) providing a chemically reactive conjugate, the chemically reactive conjugate comprising: (x) a circulating tag comprising a circulating nucleic acid associated with a cycle number, (y) a reactive portion for binding to the N-terminal amino acid residue of the peptide, and (z) an immobilization portion for immobilization to the solid support; (c) contacting the peptide with the chemically reactive conjugate, thereby coupling the chemically reactive conjugate to the N-terminal amino acid of the peptide to form a conjugate complex; (d) immobilizing the conjugate complex to the solid support via the immobilization portion; (e) cleaving and thereby separating the N-terminal amino acid residue from the peptide, thereby providing an immobilized amino acid complex, the immobilized amino acid complex comprising the cleaved and separated N-terminal amino acid residue; (f) contacting the immobilized amino acid complex with a binding agent, the binding agent comprising: a binding portion for preferentially binding to the immobilized amino acid complex and a recoding tag comprising a recoding nucleic acid corresponding to the binding agent, thereby forming an affinity complex, the affinity complex comprising the immobilized amino acid complex and the binding agent, thereby bringing the circulating tag into proximity with the recoding tag within the affinity complex; (g) transferring the information of the recoding nucleic acid to the circulating nucleic acid of the immobilized conjugated complex to produce a recoding block; (j) obtaining sequence information of the recoding block; and (k) determining the identity and position information of the amino acid residues of the peptide based on the obtained sequence information. Some embodiments include repeating any or all of steps (b) to (k) for each subsequent amino acid of the peptide.

[0058] In some embodiments, disclosed herein is a method for determining the identity and position information of the amino acid residues of a peptide coupled to a solid support. The method may include providing a peptide to a solid support. In some embodiments, the peptide is coupled to a solid support, such as so that the N-terminal amino acid residue of the peptide is not directly coupled to the solid support or exposed to reaction conditions. The method may include providing a chemically reactive conjugate. The chemically reactive conjugate may include a cycle tag. The cycle tag may include a circulating nucleic acid associated with the cycle number. The chemically reactive conjugate may include a reactive portion. The reactive portion may be used to bind the N-terminal amino acid residue of the peptide. The chemically reactive conjugate may include a fixed portion. The fixed portion may be used to be fixed to a solid support. The method may include contacting the peptide with the chemically reactive conjugate. Contacting the peptide with the chemically reactive conjugate may allow the chemically reactive conjugate to be coupled to the N-terminal amino acid of the peptide to form a conjugated complex. The method may include fixing the conjugated complex to a solid support, such as via a fixed portion. The method may include cutting or separating the N-terminal amino acid residue from the peptide. Cutting or separating the N-terminal amino acid residue from the peptide may provide a fixed amino acid complex. The fixed amino acid complex may include a cleaved and separated N-terminal amino acid residue. The method may include contacting the fixed amino acid complex with a binding agent. The binding agent may include a binding portion. The binding portion may be used to preferentially bind to the fixed amino acid complex. The binding agent may include a recoding tag. The recoding tag may include a recoding nucleic acid corresponding to the binding agent. Contacting the fixed amino acid complex with the binding agent may form an affinity complex. The affinity complex may include a fixed amino acid complex. The affinity complex may include a binding agent. Contacting the fixed amino acid complex with the binding agent may bring the circulating tag into proximity with the recoding tag (e.g., within the affinity complex). The method may include transferring information of the recoding nucleic acid to the circulating nucleic acid. This may generate a recoding block. The recoding blocks may be assembled into a memory oligonucleotide. The method may include joining one or more recoding blocks generated from one or more amino acid residues. The method may include obtaining sequence information of the recoding blocks. The method may include obtaining sequence information of the memory oligonucleotide. The method may include determining information of the amino acid residues of the peptide based on the obtained sequence information. The information may include identity information. The information may include position information. In some embodiments, the N-terminal amino acid residue is cleaved from the peptide to expose the next amino acid residue as the N-terminal amino acid residue on the cleaved peptide. In some embodiments, the reactive portion of the chemically reactive conjugate cleaves the N-terminal amino acid residue from the peptide. Some embodiments include repeating any of the preceding steps for each subsequent amino acid of the peptide. In some embodiments, the immobilization portion includes an activatable chemical moiety alkyne. Some embodiments include joining the chemical moiety to a solid support.In some embodiments, the N-terminal amino acid residue is cut from the peptide to expose the next amino acid residue as the N-terminal amino acid residue on the cut peptide. In some embodiments, the reactive portion of the chemically reactive conjugate cuts the N-terminal amino acid residue from the peptide. Some embodiments include washing away the chemically reactive conjugate that is not engaged with the solid support before contacting the next N-terminal amino acid of the peptide with the chemically reactive complex. Some embodiments include contacting the fixed amino acid complex with a binding agent to form an affinity complex. Some embodiments include washing the fixed amino acid complex before contacting the fixed amino acid complex with a binding agent. Some embodiments include washing the fixed amino acid affinity complex after contacting the affinity complex with one or a group of binding agents.

[0059] In some embodiments, disclosed herein is a method for determining the identity and position information of multiple amino acid residues of a peptide, wherein the peptide comprises n amino acid residues, the method comprising: (a) coupling the peptide to a solid support such that the N-terminal amino acid residue of the peptide is not directly coupled to the solid support and exposed to a reaction condition; (b) providing a chemically reactive conjugate, wherein the chemically reactive conjugate comprises: (x) a circulating tag comprising a circulating nucleic acid associated with a cycle number, (y) a reactive portion, wherein the reactive portion is used to bind to and cleave the N-terminal amino acid residue of the peptide and expose the next amino acid residue as the cleaved peptide. (c) contacting the peptide with a chemically reactive conjugate, thereby coupling the chemically reactive conjugate to the N-terminal amino acid of the peptide to form a conjugate complex; (d) immobilizing the conjugate complex to the solid support via the immobilization moiety; (e) cleaving the N-terminal amino acid residue from the peptide and thereby separating the N-terminal amino acid residue, thereby exposing the next amino acid residue as the N-terminal amino acid residue on the cleaved peptide and providing an immobilized amino acid complex, the immobilized amino acid complex comprising the cleaved and separated N-terminal amino acid residue; (f) combining (b) to (e) Repeat n-1 times to assemble n-1 additional fixed amino acid complexes, each additional fixed amino acid complex correspondingly comprising nucleic acids associated with cycles 2 to n; (g) contacting the fixed amino acid complexes with a binding agent or a group of binding agents, each binding agent comprising: a binding portion for preferentially binding to a fixed amino acid complex or a subset of fixed amino acid complexes and a recoding tag comprising a recoding nucleic acid corresponding to the binding agent, thereby forming one or more affinity complexes, each affinity complex comprising the fixed amino acid complex and the binding agent, so that the circulating tag is close to the recoding tag within each formed affinity complex; (h) within each formed affinity complex, the circulating tag or its reverse complement is conjugated to the recoding tag to form a recoding block, or otherwise transfers the information of the recoding nucleic acid to the circulating nucleic acid of the fixed conjugated complex, thereby generating multiple recoding blocks, each recoding block corresponding to the formed affinity complex; (i) conjugating two or more members of the multiple recoding blocks to form a memory oligonucleotide; (j) obtaining sequence information of the memory oligonucleotide; and (k) determining the identity and position information of multiple amino acid residues of the peptide based on the obtained sequence information.

[0060] In some embodiments, disclosed herein is a method for determining the identity and position information of multiple amino acid residues of a peptide. The peptide may comprise n amino acid residues. The method may comprise coupling the peptide to a solid support. The coupling may be such that the N-terminal amino acid residue of the peptide is not directly coupled to the solid support or exposed to reaction conditions. The method may comprise providing a chemically reactive conjugate. The chemically reactive conjugate may comprise a cyclic tag comprising a cyclic nucleic acid associated with the number of cycles. The chemically reactive conjugate may comprise a reactive portion. The reactive portion may bind and / or cleave the N-terminal amino acid residue of the peptide. The reactive portion may expose the next amino acid residue as the N-terminal amino acid residue on the cleaved peptide. The chemically reactive conjugate may comprise a fixed portion for fixing to a solid support. The method may comprise contacting the peptide with the chemically reactive conjugate. Such contact may couple the chemically reactive conjugate to the N-terminal amino acid of the peptide, and may form a conjugated complex. The method may comprise fixing the conjugated complex to a solid support. The fixation may be performed via a fixed portion. The method may comprise cutting from the peptide and thereby separating the N-terminal amino acid residue. The cleavage may expose the next amino acid residue as the N-terminal amino acid residue on the cleaved peptide. The method may include providing a fixed amino acid complex. The fixed amino acid complex may include the cleaved and separated N-terminal amino acid residue. The method may include repeating step n-1 times to assemble n-1 additional fixed amino acid complexes. The additional fixed amino acid complexes may include nucleic acids associated with cycles 2 to n. The method may include contacting the fixed amino acid complex with one or a group of binding agents. The binding agent may include a binding portion for preferentially binding to a fixed amino acid complex or a subset of fixed amino acid complexes. The binding agent may include a recoding tag. The recoding tag may include a recoding nucleic acid corresponding to the binding agent. Contacting the fixed amino acid complex with one or more binding agents may form one or more affinity complexes. The affinity complex may include a fixed amino acid complex and a binding agent. Contacting the fixed amino acid complex with a binding agent may bring the circulating tag into proximity with the recoding tag within the formed affinity complex. The method may include joining the circulating tag or its reverse complement to the recoding tag within each formed affinity complex. The joining may form a recoding block. The joining or the method may include generating multiple recoding blocks. Each recoding block can correspond to an affinity complex formed. The method may include joining two or more members of a plurality of recoding blocks to form a memory oligonucleotide. The method may include obtaining sequence information of the memory oligonucleotide. The method may include determining the identity and position information of a plurality of amino acid residues of the peptide based on the obtained sequence information. In some embodiments, n is an integer greater than or equal to 2.In some embodiments, each binding agent comprises a recoding tag having a unique nucleic acid sequence. In some embodiments, multiple binding agents comprise recoding tags having the same nucleic acid sequence. In some embodiments, binding agents comprise recoding tags that may have a unique sequence portion and a common sequence portion.

[0061] In some embodiments, disclosed herein are chemically reactive conjugates comprising: (a) a nucleic acid sequence tag; (b) a reactive portion for binding to and cleaving the N-terminal amino acid residue of a peptide; and (c) an immobilization portion for immobilization to a solid support.

[0062] In some embodiments, chemically reactive conjugates are disclosed herein. The chemically reactive conjugates may comprise a nucleic acid sequence tag. The chemically reactive conjugates may comprise a reactive portion. The reactive portion may be used to bind to an N-terminal amino acid residue. The reactive portion may be used to cleave an N-terminal amino acid residue from a peptide. The chemically reactive conjugates may comprise an immobilization portion. The immobilization portion may be used to immobilize to a solid support. A kit containing any of the components described herein is also disclosed. introduction

[0063] The sequence and concentration of cellular and secreted proteins are useful indicators of cell health. Abnormal sequences or concentrations may indicate disease states. However, there is a lack of tools and techniques for sensitive, accurate, economical, and unbiased characterization of the proteome. Early detection of abnormal sequences and / or concentrations is critical for the diagnosis and treatment of many diseases, such as cancer. For these and other reasons, better tools must be developed to evaluate the sequence and concentration of proteins and peptides in biological samples.

[0064] Next-generation sequencing (NGS) of DNA and RNA polymers has revolutionized diagnostic, clinical, and research approaches by enabling clinicians and researchers to analyze billions of DNA sequences with high throughput and low cost. However, the ability to detect and quantify proteins and peptides lags behind nucleic acids, in large part because there is no equivalent technology to the polymerase chain reaction (PCR) for amino acid polymers. Similar to NGS, new tools to sensitively quantify proteins and assess their sequences can aid understanding of cellular processes and continue to transform research, diagnostics, clinical approaches, and help advance precision medicine.

[0065] The current state-of-the-art proteomics toolkit includes the following general methods: 1) Edman degradation followed by conventional chromatography; 2) fragmentation followed by advanced separation and mass spectrometry (MS) techniques; and 3) protein identification via affinity molecules. These methods provide a lot of useful information. However, none of these methods generate information in terms of scale, throughput, reproducibility, access, or cost required to unlock transformative applications in research, diagnostics, or therapeutics.

[0066] Peptide sequencing based on Edman degradation was first proposed and automated by Pehr Edman in the 1950s. The process is similar to Sanger sequencing. In brief, the peptide sequence information is collected using a series of chemical reactions to gradually degrade the N-terminal amino acid on the peptide and downstream HPLC analysis. First, the N-terminal amino acid is reacted with phenyl isothiocyanate (PITC) under alkaline conditions (usually NMP / methanol / water) to form a phenylthiocarbamoyl (PTC) derivative. In the second step, the PTC-modified amino acid is treated with an acid (usually anhydrous TFA) to produce an ATZ (2-anilino-5(4)-thioazolinone)-modified amino acid, thereby separating the amino acid from the polymer and producing the next N-terminus on the polypeptide. The cyclic ATZ-amino acid is converted to a PTH-amino acid derivative and analyzed by chromatography. These steps are then repeated in sequence to determine the peptide sequence. It is effective, but the protein sample requirements are high in the early stages, and the process lacks the throughput and cost to support large-scale discovery.

[0067] Recently, multiplex methods and devices for peptide sequencing based on Edman degradation of trace amounts of proteins have been developed. See, for example, U.S. Pat. No. 7,611,834 B2 to Chharbra. However, such methods and devices are still not suitable for highly parallel high-throughput proteomic analysis.

[0068] In the past 20 years, peptide analysis by fragmentation and analysis via mass spectrometry (LC / MS here) have been increasingly used to quantify and sequence protein abundance. In addition, in some applications, proteomics based on recognition has been adopted. In this method, affinity molecules (such as antibodies or antibody fragments, aptamers, RNA or modified proteins) are usually engineered to recognize the tertiary structure of the analyte. Typically, these affinity molecules are connected to molecular beacons that fluoresce or provide other means of detecting binding events, such as in ELISA assays. However, like previous methods, methods based on fragmentation and recognition lack the throughput and efficiency to support large-scale discovery.

[0069] The present disclosure provides methods for analyzing polymeric macromolecules such as peptides, polypeptides, and proteins.Accordingly, aspects of the present disclosure relate to the field of proteomics.

[0070] Figure 1 The proteomics landscape is divided by technology. As mentioned above, the current proteomics analysis landscape includes the following general methods: 1) Edman degradation followed by conventional chromatography; 2) fragmentation followed by advanced separation and mass spectrometry techniques; and 3) protein identification via affinity molecules. While these (and other) methods can provide researchers with useful information, they do not provide information on the scale, throughput, or cost required to unlock transformative applications in research, diagnostics, or therapeutics. Some of the more specific challenges associated with current methods (e.g., Edman, LC / MS, and affinity methods) include: (a) Protein folding is dynamic, and proteins may lose their characteristic shape. When they lose their characteristic shape, recognition-based methods become inaccurate. This can happen in the case of unstable proteins or in the case of uncontrolled sample handling prior to analysis. (b) Recognition-based methods do not inform whether a protein sequence is a catalytically ineffective variant, which is often the case in cancer biology. (c) The biomarker of interest may be present at fM concentrations or lower, which is below the detection limit of most available tools for quantifying the absolute abundance of multiple proteins. (d) The spectrum of protein molecules is extensive. The spectrum of protein molecules is much more complex than that of the RNA transcriptome due to the additional diversity introduced by post-translational modifications (PTMs). (e) Proteins within cells change dynamically (in terms of expression levels and modification status) in response to the environment, physiological state, and disease state. Therefore, proteins contain a wealth of relevant information, much of which remains unexplored. (f) Generating an efficient collection of affinity agents with low cross-reactivity between off-target macromolecules can be time-consuming. (g) Multiplexing the readout of a panel of affinity agents with minimal cross-reactivity between the affinity agents and off-target macromolecules is challenging. (h) Existing methods and automation around current methods are slow, expensive, and in the case of the Edman method, have limited throughput, processing only a few peptides per day. (i) LC / MS has disadvantages including: high instrument cost, high level of user expertise required, poor quantitative capability, and poor dynamic range. Absolute and even relative quantification between samples is challenging because proteins ionize at different efficiency levels. (j) LC / MS analyses more abundant species and therefore requires complex upfront sample preparation, such as nanoparticle corona, which makes the characterization of low-abundance proteins challenging. (k) LC / MS sample throughput is typically limited to a few thousand peptides per run. (l) Recent attempts to develop methods discriminate poorly between n-terminal or c-terminal AAs and suffer from the “proximity effect.” Other single-molecule methods still under development will require expensive instrumentation because amplification of the analyte is not possible and small numbers of photons, electrons, or detection elements must be detected.

[0071] The present disclosure addresses the above challenges and other needs by providing methods, systems and compositions for analyzing polymeric macromolecules by recoding the sequence of polymeric macromolecules into DNA polymers for subsequent DNA sequencing and analysis. Figure 1 , certain embodiments of the present disclosure fall under the following sections: "Proteomics" >> "Advanced Research" >> "Chemistry" >> "Sequence-based". Many applications of the present disclosure include peptide sequence and quantitative determination in samples of synthetic and biological origin, including a variety of protein complexes, proteins and / or polypeptide components.

[0072] Some embodiments of the methods described herein include any of the following steps: 1: binding to a matrix; 2: conjugation of functionalized PITC to amino acids; 3: fixing the PITC conjugate to a hydrogel matrix; 4: cleavage of amino acids via Edman degradation; 4a: nucleotide deprotection; 5: construction of recoding blocks with binding agents; 6: memory oligonucleotide assembly; and 7: release of oligonucleotides for sequencing. Improved methods for determining protein sequence and abundance

[0073] Figure 2 A simplified block diagram of an exemplary workflow 200 for analyzing polymeric macromolecules according to an embodiment of the present disclosure is shown. More particularly, workflow 200 includes a high-level overview of various methods herein and how these methods are coordinated with DNA sequencing technology. As shown, samples of macromolecules (e.g., proteins and peptides) are prepared and these samples are fixed to a solid support (frame 1). When fixed, the amino acid sequence of the macromolecule is converted (e.g., "recoded") to a DNA sequence (frame 2), and the DNA sequence is amplified as a library for NGS sequencing (frame 3). The DNA library is then sequenced (frame 4) and analyzed (frame 5) via a high-throughput, high-precision method, thereby achieving low cost.

[0074] Figure 3 Schematically shows an embodiment according to the present disclosure Figure 2 More specifically, Figure 3 Shown Figure 2 The main stages of a "re-encoding" operation of FIG. 3 are shown as process 300. As shown, there are three distinct and separable stages for the re-encoding process 300, and each stage is depicted in a row of operations.

[0075] In the first stage ( Figure 3 In operation 1-4), the cycle information is captured. In operation 1, the surface of the solid support is prepared for the attachment of the following: a macromolecular analyte, a set of universal primers, and a trifunctional chemically reactive conjugate. This can be achieved by providing three (or more) orthogonal chemistries on the surface of the support, wherein the orthogonal chemistries are Figure 3 aldehyde-hydrazine, azide-alkyne, and thiol are shown in FIG. Note that a variety of conjugation chemistries are possible, including alternative chemical functional groups for anchoring primers, macromolecular analytes, and chemically reactive conjugates to the solid support, as described below. A variety of macromolecular analytes (e.g., proteins, protein fragments (i.e., peptides), or other polymers) are immobilized to the support surface using at least one of the orthogonal reaction modes of the support.

[0076] Operations 2-4 are then performed to immobilize the trifunctional chemically reactive conjugate (as a conjugate-AA-circulating tag complex). As shown, in operation 2, the N-terminal amino acid of the immobilized analyte is contacted with a chemically reactive conjugate comprising a reactive group to the amino terminus (such as Edman's reagent (phenyl isothiocyanate (PITC))), an orthogonal reactive group to the support, and a nucleic acid molecule that carries information about the circulation of the conjugate when in contact with the analyte. Under alkaline conditions, the PITC conjugate reacts with the N-terminal amino acid to form a phenylthiocarbamoyl-amino acid (PTC) conjugate. Rigorous washing removes unreacted PITC conjugate, and then, in operation 3, activation of the orthogonal chemistry used to tether the conjugate to the support is initiated to immobilize the PTC conjugate near the anchor point of the analyte of interest. For example, by changing the redox conditions to induce dithiol formation, or by adding Cu 2+, stabilizers, and redox components to induce a click reaction, the PTC-thiol conjugate or PTC-alkyne conjugate can be immobilized on a solid support. After the conjugate is immobilized on the solid support, a conjugate reactivity scavenger can be added to block the reactivity of any bound conjugate that was not washed off in the previous step or steps to render it inactive for future n-terminal amino acid reactions. In operation 4, peptide bond cleavage of the N-terminal amino acid of the targeting peptide is induced. In the example using Edman degradation chemistry, this is promoted by a pH change from alkaline conditions to acidic conditions. Operations 1-4 can then be repeated n cycles to produce a sheet of n-cycle labeled conjugates positioned on the solid support.

[0077] In fact, the first iteration (i.e., the first cycle) of operation 2-4 provides information related to the terminal monomer of the immobilized polymeric analyte. Its second cycle provides information related to the next monomer of the immobilized polymeric analyte, and so on. Iterating n cycles through steps 2-4 produces a sheet of spatially localized conjugates that contain the cyclic information. With appropriate spacing between the anchor points of the immobilized macromolecular analytes, conjugates associated with a single analyte are co-localized and separated from conjugates of other analytes.

[0078] Figure 3 The second row of depicts the operation of the iterative process by which the recoding block is constructed. In this operation, amino acid information is associated with cycle information. In short, a variety of binding agents that identify fixed conjugate-AA-circulation tag complexes are introduced in operation 5a, and the multiple binding agents are combined with their cognate targets in operation 5b. The binding agent is engineered to preferentially identify specific conjugates based on the difference of the homologous amino acids of the fixed conjugate. Those reagents with both homologous AA and homologous cycle information will thus guide the AA information to be connected to the cycle tag (operation 5c and 5d) of the corresponding conjugate complex. Repeated combination, washing and connection allow multiple attempts to find homologous partners and transfer information to each fixed conjugate-AA-circulation tag complex to build a recoding block. Therefore, multiple continuous binding cycles can be used to drive the yield of information transfer from a binding agent to a fixed conjugate to reach an arbitrarily high level of completion.

[0079] exist Figure 3The third row, the recoding blocks formed are assembled into memory oligonucleotides (e.g., combined into single memory oligonucleotides). This oligonucleotide can be amplified on a solid support or in solution, and then analyzed using a DNA sequencing method to determine the sequence and / or abundance of the fixed analyte. In short, in operation 6, the co-located recoding blocks interact based on their complementary DNA sequences to assemble DNA oligonucleotides representing the sequence of the initial macromolecule. This process is similar to the g-block assembly of gene products. Assembly can be promoted by a polymerase extension-ligation process or by a ligation process.

[0080] There may be gaps in the connectivity between co-located conjugates, for example, due to incomplete information accumulation during the sequential degradation of peptides and the fixation of PTC-AA-cyclic tags-conjugated complexes, incomplete information transfer from recoding tags to cyclic tags during the recoding block assembly process, or incomplete connection of available and existing recoding block information during the memory oligonucleotide assembly process. In order to remedy these gaps and enable the information to be assembled into a single oligonucleotide that can be analyzed using DNA sequencing with high yield, a connection step using a universal splint oligonucleotide can be performed. Therefore, in operation 7, the incomplete assembly of co-located recoding blocks and / or memory oligonucleotides is corrected by adding a universal splint that can replace the recoding block sequence that was not generated in operation 5. In the case of losing recoding block information, the amino acid information associated with the wrong cycle will be lost, but most of the recoding block information is assembled into memory oligonucleotides. In operation 8, the tether of the recoding block is released and an amplifiable product is generated via polymerase extension. Optionally, the solid support surface can be restored by cutting the conjugate from the surface.

[0081] Figure 4 An exemplary solid support for spatially supporting macromolecular analytes according to an embodiment of the present disclosure is schematically shown. As shown, the solid support is coated with a hydrogel that supports orthogonal chemistries. The orthogonal chemistries depicted are: aldehyde-hydrazine, azide-alkyne, and thiol. Based on the selected fixation scheme, thiols or click chemistry can be activated for attachment of trifunctional chemically reactive conjugates. Aldehyde-hydrazine conjugation is an exemplary chemistry that can provide specific and orthogonal fixation of macromolecular analytes. Macromolecular analytes are seeded on the surface so that they are mostly spatially separated and reactants that interact with one macromolecule do not interact with another macromolecule. The volume element is defined by the radius limited by the length of the macromolecular polymer and the length of the linker of the conjugated complex and the binding agent.

[0082] Figure 5 Schematically shows an embodiment according to the present disclosure Figure 3Interaction of a chemically reactive conjugate with the terminal amino acid of an immobilized peptide during operation 2 of the recoding process 300. Typically, the conjugate has three functions: 1) binds to the terminal amino acid and cleaves the peptide bond between the terminal amino acid and the next amino acid in the polymer (for an N-terminal reaction, this is equivalent to the classical function of the Edman reagent); 2) fixes the conjugate to a solid support; and 3) carries the circulating tag oligonucleotide. Note the 1:1 relationship of immobilized peptide to conjugate in a given cycle. The conjugate that reacts and binds to the terminal amino acid in operation 2 of the recoding process 300 is Figure 5 . The PITC conjugate is shown as a solid triangle. Under alkaline conditions, the PITC conjugate reacts with the N-terminal amino acid to form a phenylthiocarbamoyl-amino acid (PTC) conjugate. Unreacted conjugates are shown as open triangles. Any unreacted PITC conjugates can be washed from the surface of the solid support before triggering the chemistry that binds the PTC-conjugate to the surface.

[0083] Figure 6 Schematically shows an embodiment according to the present disclosure Figure 3 During operation 3 of the recoding process 300 in, a chemically reactive conjugate is immobilized to a solid support. Typically, the conjugate immobilization reaction can be triggered by light, catalyst addition, or by changing buffer properties or temperature to control the reaction rate. For example, lowering the redox potential allows for the formation of a stable dithiol linkage. Rigorous washing removes unreacted PITC conjugate, and then activation of an orthogonal chemistry for attaching the conjugate to the solid support is initiated to immobilize the PITC conjugate near the anchor point of the peptide of interest. For example, by changing the redox conditions to induce dithiol formation, or by adding Cu 2+ , stabilizers and redox components to induce click reactions, PTC-thiol conjugates or PTC-alkyne conjugates can be fixed to a solid support. Note that the length of the peptide defines the volume element around the anchor point in the support, and the conjugate associated with a specific peptide is co-localized to the anchor point. After the conjugate is fixed to the solid support, a conjugate reactive scavenger can be added to block the reactivity of the residual conjugate that has not reacted with the N-terminal amino acid, has not been completely washed and attached to the solid support. In this way, the incomplete removal of the PITC conjugate is remedied by introducing an amino acid mimetic. Unreacted PITC-conjugates can bind to the surface, but their future reactivity with amino acids is quenched, leaving bystander conjugates on the surface that cannot participate in downstream processes.

[0084] Figure 7 Schematically shows an embodiment according to the present disclosure Figure 3Cleavage of the terminal amino acid (e.g., cleavage of a peptide bond) is performed in operation 4 of the recoding process 300. In examples utilizing Edman degradation chemistry, this is accomplished by changing the pH from alkaline conditions to strongly acidic conditions (sometimes in an organic solvent). Therefore, the hydrogel and conjugation reaction are designed to tolerate peptide bond cleavage conditions. Also for this reason, the circulating tag nucleic acid and any other nucleic acid immobilized to the solid support will contain protecting groups to prevent degradation of amines or other reactive moieties of the nucleic acid. Cleavage of the terminal amino acid results in the release of the peptide and provides a new terminal amino acid on the immobilized peptide analyte. In Figure 7 In the present invention, the immobilized PTC-AA-circulating tag-conjugate complex is positioned near the anchor point of the peptide analyte.

[0085] Figure 8 Schematically illustrates an iterative repetition according to an embodiment of the present disclosure Figure 5-Figure 7 More specifically, Figure 8 Iterations of operations 2-4 of the recoding process 300 are shown. As shown, a series of co-localized conjugates, each having a cyclic tag that carries information about the relative position of amino acids in one fixed peptide analyte, are spatially separated from conjugates of other peptide analytes. The details of the generation of each conjugate are independent of the information carried by the conjugate. Thus, fixed conjugates carrying information derived from carboxyl terminal chemistry and fixed conjugates carrying information derived from amine terminal chemistry can be combined in downstream steps.

[0086] Fig. 9 The assembly of a recoding block according to an embodiment of the present disclosure is schematically illustrated, such as operations 5a-5b above. During this process of the recoding process 300, amino acid identity information is aggregated with cycle information. The cognate binder interacts with the immobilized conjugate, such as Fig. 9 As shown in the top small figure of . The binder is engineered to preferentially recognize specific conjugates based on the differences in the homologous amino acids of the fixed conjugates. The binding energy of the binder is a combination of: (a) the binding energy of the affinity binding part and the conjugate, and (b) the hybridization energy between the circulating tag oligonucleotide of the conjugate and the recoding tag oligonucleotide of the binder. The binder with both homologous AA and homologous circulation information will guide the AA information to connect to the circulation tag, as shown in the bottom small figure. In practice, the components for identifying all AA conjugates of all cycles exist simultaneously to generate recoding blocks in parallel. The discrimination can be enhanced by slow annealing under "competitive" conditions to find the global maximum binding energy of the combined affinity binding part and the nucleic acid. Note that the recognition of the PTC-conjugate fixed on the solid support avoids the neighbor effect of the adjacent amino acids on the initial peptide.

[0087] Fig.10Schematically shows an embodiment according to the present disclosure Fig. 9 Preparatory operations for an exemplary process for assembling a re-encoded block. Fig.10 The bottom panel in shows a binder comprising a binding moiety and a recoding tag, and a conjugate with a circulating tag. There are several possible interactions between the binder and the immobilized conjugate that may be present, because the binder used to recognize all AA conjugates of all cycles is present simultaneously. They can be classified as: (a) correct homologous AA, correct homologous nucleotide; (b) correct homologous AA, incorrect homologous nucleotide; (c) incorrect homologous AA, correct homologous nucleotide; (d) incorrect homologous AA, incorrect homologous nucleotide; and (e) non-specific binding. Stringent washing conditions remove weakly bound binders from the surface. These may be due to cross-reactive binding of the binding moiety to non-homologous PTC-AA-circulating tag conjugate complexes and include interactions classified as (c), (d) or (e). Interactions classified as (a) are productive during the next step of oligonucleotide ligation, where information is transferred from the recoding tag to the circulating tag to form a recoding block. Interactions classified as (b) are not productive during the next step of oligonucleotide ligation. Characteristic time (1 / k off )(where k off The off-rate of the cognate binder) can exceed the time required to effectively wash the solid support.

[0088] Fig.11 Schematically illustrating the transfer of amino acid identity information from a recoding tag of a binding agent to a circulating tag of a fixed conjugate to form a recoding block via ligation, such as operations 5c-5d of the recoding process 300, according to an embodiment of the present disclosure. As shown, complementary ligation oligonucleotides and ligase are added in an appropriate buffer to support ligation, and information transfer is only performed when the homologous amino acid and complementary nucleic acid conditions are met. A binding agent that is homologous to an amino acid but contains a recoding tag that is not complementary to the circulating tag does not undergo information transfer. Similarly, a ligation oligonucleotide that is not complementary to the recoding tag of the binding agent does not undergo information transfer.

[0089] Fig.12The iterative process of operations 5a-5d of the recoding process 300 for assembling a recoding block according to an embodiment of the present disclosure is schematically shown. During its execution, the binding agent for identifying all AA conjugates of all cycles is present at the same time. Therefore, the efficiency of the correct binding of homologous pairs in any one experiment may be low. Slow annealing will help distinguish interactions with similar binding energies and drive the binding of homologous pairs. However, this may not increase the efficiency to the desired level. In addition, in any given experiment, steric hindrance caused by the co-localization of fixed conjugates may limit the binding agent from approaching one or more conjugates. In order to drive a high proportion of recoding block assembly, multiple experiments of binding, washing and connection can be used. In experiments where unproductive binding events occur, connection does not occur. Strict washing for removing non-homologous binding agents creates new opportunities to find homologous agents and anneal with homologous agents in the next experiment. In principle, assuming there is no systematic effect, repeated experiments will drive the recoding block assembly to completion.

[0090] Fig.13 The relative sizes of the various components of the recoding process 300 according to an embodiment of the present disclosure are schematically illustrated. As shown, the relative sizes of the various components emphasize providing linkers / spacers that allow the components to interact sufficiently freely while also maintaining co-localized separation of each immobilized macromolecular analyte on the solid support.

[0091] Fig.14 Schematically illustrates the separation of incompatible chemical operations during the recoding process 300 according to an embodiment of the present disclosure. As shown, the recoding process 300 is adapted to separate the steps such that no switching between chemistries is required to complete the cycle and / or no reversible chemistry is required.

[0092] Fig.15 The assembly of memory oligonucleotides for subsequent DNA sequencing analysis of operations 6-8 of the recoding process 300 according to an embodiment of the present disclosure is schematically illustrated. As shown, the overlapping and complementary sequences of the co-localized recoding blocks facilitate their assembly into a single oligonucleotide (memory oligonucleotide), which becomes the seed for analysis using DNA sequencing technology. Several molecular biology methods may be useful during assembly. For example, memory oligonucleotides may be assembled using polymerase extension followed by ligation, or simply by using ligation methods. In the case of assembly by ligation, the addition of a single-stranded 5' phosphorylated DNA oligonucleotide complementary to the AA tag of the recoding block facilitates assembly. A chimeric splint having a sequence complementary to the recoding block and the P5 or P7 sequence is used to directly connect to a primer sequence (such as 5') fixed to a solid support. Fig.15) can promote memory oligonucleotide amplification. After the memory oligonucleotide is assembled, the recoding block tether to the solid support can be optionally cut, and the polymerase extension from the 3' end of the fixed P5 or P7 can initiate cluster generation. Alternatively, the assembled memory oligonucleotide can undergo end repair, A tailing, sequencing adapter ligation, and amplification in situ or in solution.

[0093] Fig.16 Schematically illustrates the remediation of incomplete recoding blocks during memory oligonucleotide assembly according to an embodiment of the present disclosure. Fig.16 Operation 7 of the recoding process 300 is shown. As shown, there may be gaps in the connectivity between co-localized conjugates, for example, due to a) incomplete information accumulation during the sequential degradation of the peptides and fixation of the PTC-AA-cyclic tag-conjugate complex, b) incomplete information transfer from the recoding tag to the cyclic tag during the recoding block assembly process, or c) incomplete connection of available and existing recoding block information during the memory oligonucleotide assembly process. In order to remedy these gaps and enable high-yield assembly of information into a single oligonucleotide that can be analyzed using DNA sequencing, a connection step using a universal splint oligonucleotide can be performed. By using a library containing a splint that can assemble any unconnected recoding block with any other unconnected recoding block, the remedy can be completed for all cycles simultaneously. Alternatively, the remedy can be completed stepwise by using a subset of the described library. Fig.16 The "..." in indicates the completion of the series and represents intermediate linker oligonucleotides that are not explicitly shown. C1 indicates the cycle tag sequence (or its complement sequence), and "n" indicates the total number of cycles.

[0094] Fig.17 Schematic representation of various oligonucleotide components within a sample volume during recoding block assembly according to an embodiment of the present disclosure. Accounting for interactions and adjusting reaction conditions facilitates accurate and complete assembly during the recoding process 300. Within any given volume element around the anchor point of a protein or peptide there will be fixed PTC-AA-circulating tag-conjugate complexes having: (a) the same AAs, different circulation information, and (b) different AAs, different circulation information, but there will be no complexes having: (c) different AAs, same circulation information, or (d) the same AAs, same circulation information. Fig.17In the diagram, "Group 1" components exist to support assembly of cycle 1 information. "Group 2" components exist to support assembly of cycle 2 information, and so on, to Group 3, to Group "n". Interactions within and between groups are catalogued at the top of each column. The total number of oligonucleotide components is given for each component type. Weak interactions due to hybridization of short polymer oligonucleotides are possible. These will be exceeded by relatively stronger interactions of the binding moieties that guide oligonucleotide assembly. The bold lines show the expected interactions for a given recoding block AA1-cycle 1 hypothesis and represent the total binding energy of the interactions. The thin lines show exemplary possible oligonucleotide interactions. These interactions have low Tm and therefore control misconnections that lead to incorrect recoding block information. Recoding blocks with various tethering sites are shown, for example, to 5', 3' and internal nucleosides. Fig.17 The "..." in indicates the completion of the series and represents intermediate cycle tags, linker oligonucleotides, or recoding tags that are not explicitly shown. C1 indicates the cycle tag sequence (or its complement sequence), AA indicates the amino acid recoding sequence, and "n" indicates the total number of cycles.

[0095] Fig.18 Schematically illustrates various oligonucleotide components within a sample volume during memory oligonucleotide assembly according to an embodiment of the present disclosure. Fig.18 In the example, the effective concentration of the components is high due to co-localization within a volume element defined by the length of the macromolecular analyte and the length of the linker of the associated recoding block. However, the complexity of the oligonucleotide is not high. And since the loop codes (C1, C2, ... Cn) and the amino acid codes (AA1, AA2, ... AAn) are defined using a scheme based on communication theory, mismatch connections are impossible. Note that even "incorrect assembly" caused by mismatch connections will produce oligonucleotides with useful macromolecular analyte sequence information because the loop information is located on the side of the amino acid information. In determining the sequence of the peptide analyte, consecutive blocks of information in the memory oligonucleotide are redundant. "..." indicates the completion of the series and represents intermediate recoding blocks or AA'-complements that are not explicitly shown. "n" represents the total number of cycles.

[0096] Fig.19 Schematically illustrates the release of memory oligonucleotides and conjugate complexes from a solid support at operation 8 of the recoding process 300 according to an embodiment of the present disclosure. An exemplary memory oligonucleotide is shown in Fig.19, which has p7 and P5 adapters. The memory oligonucleotide may also contain a sample index, UMI, CRISPR PAM or spacer sequence, or other identification nucleic acid sequences that can be incorporated during the NGS library preparation step. Cutting the tether (or a subset of the tether) to the solid support is an optional step to improve the efficiency of PCR extensions involving memory oligonucleotides. Removing the conjugate from the surface is an optional process for cleaning the solid support before using it for downstream steps such as cluster generation and NGS sequencing. Fig.19 , depicts the reduction of disulfide bonds, which can be mediated by the addition of dithiothreitol to the solution contacting the support surface.

[0097] In certain embodiments, the recoding block comprises sequences that facilitate assembly of memory oligonucleotides and / or facilitate target enrichment, target depletion, and / or sequencing sample preparation (e.g., NGS sample preparation), such as CRISPR PAM or spacer sequences. For example, approximately 90% of the protein content in human plasma is albumin. It is advantageous to deplete albumin in plasma to improve the sensitivity of detecting lower abundance proteins that interact with albumin therein. Therefore, depletion via DNA enrichment or depletion methods after recoding can provide sample preparation with less bias compared to depletion or enrichment of protein samples via conventional recognition-based protein enrichment or depletion methods. Therefore, the oligonucleotide design for circulating tags, recoding tags, recoding blocks and / or memory oligonucleotides may include CRISPR PAM and spacer sequences (or others) that are specific for albumin (e.g., NGG, C1-AAtag Met -C2-AAtag Lys ) to preferentially deplete the recoded albumin peptide sequence via cleavage of the memory oligonucleotide amplicons with CRISPR nucleases or other enzymes.

[0098] Figure 20A-20B Depicted in Figure 3 The fluorescence values ​​obtained during the entire execution of steps 1 to 4 of the method. The relative fluorescence units (RFU) of the fluorescent oligonucleotide complementary to the circulating tag mark the progress through the advancing steps of the method. Fig. 20AIn, each bar shows the measured value of fluorescence in the advancement step. Bar 1 shows the minimum autofluorescence of the peptide and solid support used in the study. Bar 3 shows the capture of fluorescent oligonucleotides by the reaction of the CRC fixed to the solid support via its reactive part (PITC) with the N-terminal amino acid of the fixed peptide. The low signal support of bar 2 is that the signal is independent of the unbound fluorescent oligonucleotides in the solution and is consistent with the signal emitted by the fluorescent oligonucleotides captured by the CRC reacting with the fixed peptide on the solid support. Bar 4 shows the signal of the fluorescent oligonucleotides released from the surface when the surface is exposed to mild chemical conditions that promote oligonucleotide dehybridization. The relative values ​​of bars 3 and 4 can be explained by the volume difference during the measurement. Bar 5 confirms that the fluorescent oligonucleotides are dehybridized from the surface. Between the measured values ​​of bars 5 and 6, the CRC of sample B is fixed to the surface via the copper-catalyzed Huisgen cycloaddition reaction. In addition, between the measured values ​​of bars 5 and 6, the surface is subjected to anhydrous acid under conditions that support N-terminal amino acid cleavage, thereby exposing the next amino acid residue as the N-terminal amino acid residue on the cleaved peptide. Bar 6 shows the progress of contacting the second CRC with a different cyclic tag sequence via a reactive portion (PITC) with the surface. After cutting the first N-terminal amino acid with acid, the CRC will be reactive to the newly exposed N-terminal amino acid of the fixed peptide. Bar 8 shows the capture of new fluorescent oligonucleotides by the CRC fixed to the solid support via its reactive portion (PITC) and the reaction of the new terminal amino acid of the fixed peptide. The low signal support of bar 7 is that the signal is independent of the unbound fluorescent oligonucleotide in the solution and is consistent with the signal emitted by the fluorescent oligonucleotide captured by the CRC reacting with the fixed peptide on the solid support. Bar 9 shows the signal of the fluorescent oligonucleotide released from the surface when the surface is exposed to mild chemical conditions that promote oligonucleotide dehybridization. The relative values ​​of bars 8 and 9 can be explained by the volume difference during measurement. Bar 10 confirms that the fluorescent oligonucleotide is dehybridized from the surface. The progression of the fluorescent signal confirms the reaction, capture and cleavage of the N-terminal amino acid residue of the peptide using the materials and methods disclosed herein. The strong signal of the bars in steps 3, 4, 8 and 9 confirms that the CRC is progressing. Figure 3 The functionality of steps 2-4. Fig. 20B Each bar shows the fluorescence at the advancement step of the method. Fig. 20A Same as bar B, but the starting azide-functionalized silica surface was supplied by a commercial source.

[0099] Fig.21 Schematically illustrates how the efficiency of memory oligonucleotide assembly can be adjusted according to the methods described herein. As shown, Fig.21In the large sphere represents the volume as defined by the length of the analyte polymer (e.g., amino acid polymer). There are many smaller spheres in the large sphere. Each of these smaller spheres can represent the volume defined by the binding agent and conjugate utilized during the recoding process, more specifically the binding agent and conjugate utilized during the above-mentioned operation 5. Such volume depends mainly on the joint length of the binding agent and conjugate. Therefore, in order to promote the association of the recoding block during the assembly of the memory oligonucleotide, the polymer (representational larger sphere) can collapse via a known polymer collapse mechanism, such as described in, for example, Leonid Lonov, Hydrogel-based actuators: possibilities and limitations, Materials Today, 17, 10, 494 (2014), the document is incorporated herein in its entirety. Alternatively, binding agent and conjugate (representational smaller sphere) can be extended, for example, by utilizing expandable spacers, connecting oligonucleotides and / or computer deconvolution of rare events as described elsewhere herein to expand, thereby promoting the communication of adjacent recoding blocks. Note that the recoding blocks can be linked in any sequential order to generate memory oligonucleotides. Expandable spacers can include molecules containing multiple thiol groups. When disulfide bonds are formed, the range of the spacer is shortened, and when the cross-linker is reduced (e.g., by adding DTT), the range of the spacer is increased.

[0100] Fig. 22 Shown according to the embodiment of the present disclosure, without considering any particular order, during the memory oligonucleotide assembly, the connection of the recoding block is promoted by utilizing a universal sequence. As mentioned above, the recoding block can be connected in any sequential order to produce a memory oligonucleotide. This is due to the fact that the cyclic information is directly adjacent to the amino acid information in the recoding block of the assembly, regardless of whether the recoding block is sequential or non-sequential in the memory oligonucleotide. Although it may be effective to assemble the recoding block with the correct sequential order of the analyte, the adjacent nature of the cyclic information and the amino acid information in the recoding block may cause redundancy. Therefore, in order to avoid these redundancies, the standard of memory oligonucleotide assembly is also relaxed, and the recoding block can be assembled in a random order.

[0101] In order to promote the assembly of memory oligonucleotides without considering any particular order, universal assembly sequences can be used in the recoding process. Before the analyte of the cycle tag and / or recoding tag is introduced into one or more anchors, such universal sequences can be attached to the 5' and / or 3' ends of these tags. Complementary universal sequences are attached to two or more cycle tags and / or recoding tags to promote the random connection (linking) (for example, connection (ligation)) of the gained recoding block during the memory oligonucleotide assembly, without considering the sequential order, and the correct macromolecular analyte sequence can be assigned during the analysis after sequencing.

[0102] Fig.23 Schematically demonstrate information transfer from positioning oligonucleotide to recoding block. In certain embodiments, during the recoding process, peptide is attached to solid support via positioning joint, and the positioning joint can include any following molecule, and the molecule is configured to attach the peptide to the solid support, and is further configured to be combined with nucleic acid. The nucleic acid can include any suitable type of nucleic acid sequence, and the nucleic acid sequence carries the code information related to the location of the fixed PTC-conjugate separated on the solid support. The nucleic acid can be directly engaged with the hydrogel. This nucleic acid can be referred to as "positioning oligonucleotide". The positioning oligonucleotide can be attached to the positioning joint before or after being combined with the peptide and / or before or after the peptide is fixed to the solid support. During the recoding process, after the information of the recoding tag is transferred to the fixed conjugated complex to produce the recoding block, a PCR-like thermal cycling process can be performed to sequentially transfer the positioning oligonucleotide information to multiple adjacent recoding blocks via polymerase extension. The use of non-natural nucleotides (represented as circles in the figure) in synthetic nucleic acids and polymerase extension using only A, G, C, T, and iC in the reaction solution can be used to control undesired polymerase extension.

[0103] In summary, the above recoding process avoids key challenges associated with: 1) incompatible chemistry / protection chemistry, 2) reversible chemistry, and 3) binder molecule specificity. Regarding incompatible chemistry and protection chemistry: The harsh chemical conditions associated with peptide bond cleavage are performed in a single block of the process, where protecting groups can be utilized to maintain nucleic acid integrity. Regarding reversible chemistry: Because information is aggregated in blocks, switching between chemistries, blocking and deblocking of unstable chemical moieties, and other complexities are avoided. Because operations can be run in parallel, rather than accumulating information continuously, reversible chemistry is not required. This greatly expands the range of potential chemistries that can be deployed in the workflow. Regarding binder molecule specificity: The specificity of the binder molecule for a single amino acid is achieved by recognizing the amino acid within the isolated environment of the immobilized PTC conjugate, by separating the recognition event of each individual amino acid from the influence of the neighboring amino acids of the peptide. Amino acid identity is recoded separately from cyclic information (position within the polypeptide chain), providing flexibility and simplicity to the workflow / process and reducing the complexity of amino acid recognition events. DNA libraries re-encoded from peptide sequences can be amplified directly on solid supports or by releasing nucleic acid libraries from solid supports and amplifying them using standard NGS library preparation kits or via standard molecular biology techniques. Analysis using any high-throughput NGS method yields millions of reads per run and translates to millions of peptides sequenced in a single run.

[0104] Fig.24 Schematically illustrates examples of variable events during the performance of the recoding method described herein according to embodiments of the present disclosure. More particularly, Fig.24 Depicts the inaccurate association of circulating tag information with analyte monomers, such as caused by two conjugates being fixed in close proximity to each other on a solid support. Referring again to operation 5a of the recoding process, when a binding agent is introduced into a fixed conjugate-AA-circulating tag complex, a binding agent having both homologous AA and homologous circulating information should recognize and bind to their target conjugate. Thereafter, the binding agent should guide its AA information to be connected to the circulating tag of the conjugate complex in the form of a recoded tag. However, the proximity of the conjugate complex fixed on a solid support may cause a binding agent having a homologous AA but not having homologous circulating information to bind to the conjugate complex in rare cases, thereby resulting in a variable recoded tag-circulating tag connection, and thus resulting in an inaccurate association of circulating tag information with an analyte monomer.

[0105] exist Fig.24In FIG. 1 , the binder "AA1:C12" is shown to bind to the conjugate-AA-circulation tag complex "C1:AA1". In this example, the binder AA1:C12 correctly recognizes the homologous amino acid of CA:AA1 (e.g., AA1 is recognized). However, because the circulation tag of the complex C1:AA1 is non-homologous, the binder should not bind to C1:AA1. However, the binder AA1:C12 recognizes the circulation tag C12 of the nearby conjugate-AA-circulation tag complex "C12:AA3", thereby promoting the "variable" binding of the binder AA1:C12 to the complex C1:AA1. Therefore, in addition to the hybridization energy of the C12:AA3 complex in close proximity to the CA:AA1 complex, the affinity of the binding portion of the binder AA1:C12 for AA1 promotes this binding. As a result of this binding, amino acid 3 (AA3) is "variably" assigned to circulation 12 (C12), while the correct assignment in this example is AA1 to C1. Note that in this example, the binder and nearby conjugated complexes must contain the same cycling information to allow for variable events.

[0106] For all recoding cycles up to cycle "n", Fig.24 The variable partitioning in cannot be remedied by sequentially introducing the binding agents into the fixed conjugate-AA-circulating tag complex in the following order: AA 1-n :C1,AA 1-n :C2, AA 1-n :C3, and so on. Similarly, for all amino acid binding moieties, the partitioning cannot be remedied by sequentially introducing the binding agents into the immobilized conjugate-AA-circulating tag complex in the following order: AA1:C1, AA2:C2, AA3:C3, and so on. Instead, to reduce or eliminate Fig.24 The types of interactions in the molecule can promote the spatial separation of the conjugate-AA-circulating tag complex.

[0107] These variable events can be effectively avoided by using short spacers for the conjugate-AA-circulating tag complex and the binding agent during the recoding block assembly step (e.g., operations 5a-5d above). However, such spacers may have a negative impact on the assembly of memory oligonucleotides because the interaction of the recoding block promotes such assembly. In order to overcome these contradictory spatial limitations, spacer molecules that can be controllably extended or expanded can be used. For example, cysteine ​​can be incorporated at both ends of the spacer molecule via a disulfide bridge, thereby preventing the recoding block assembly (e.g., Fig.24The invention relates to a linker that promotes shortening during the operation depicted in ( ). This spacer can be extended by reducing disulfide bonds during memory oligonucleotide assembly. Alternatively, a controllably extensible polymer can be utilized. For example, a two-part hydrogel configured to collapse or expand based on solution / solvent conditions or a polymer with reactivity that allows expansion can be incorporated into a solid support. During the assembly of the recoding block, the polymer can be relaxed to increase the distance between the anchored conjugate-AA-circulating tag complex; however, during other steps of the recoding process, the polymer can be collapsed.

[0108] In still other embodiments, a linking oligonucleotide having bridging capability can be utilized (e.g., see Fig. 22 ) to reduce the inaccessibility of the re-encoded blocks to each other. For example, Fig. 22 As shown, long linker oligonucleotides can be used to bridge gaps via an extension: ligation approach via a recoding block. In other embodiments, prior information and probability can be used to improve the accuracy of identification, because Fig.24 The events depicted are rare and depend on the proximity of the conjugate-AA-circulating tag complex. Artificial intelligence and other computer-based methods can be used to identify these events so that they can be corrected in silico.

[0109] Fig.25 A- Fig.25 C includes example methods, which may include separation, distribution, and assembly. Fig.25 A depicts an example of separation: the N-terminal amino acid can be sequentially removed from a peptide using a trifunctional molecule in a series of cycles, with each cycle resulting in an amino acid complex being fixed near the anchor point of its cognate peptide. Multiple cycles can produce a spatially localized complex containing the looped DNA, as depicted in the top geometric inset, where the large sphere represents the protein localization and the smaller spheres represent the localization of its isolated amino acids. The cycles may be known, but the amino acid identities have not yet been determined. Fig.25 B depicts an example of partitioning: after removing the protecting groups from the isolated complex and transitioning from an anhydrous environment to an aqueous environment, the amino acid identity can be attached to the isolated complex via recognition by an affinity construct that brings the identity information in the form of DNA into proximity with the circulating DNA. The "identity" and "circulating" DNA can be linked in a high-fidelity reaction. Fig.25 C depicts an example of assembly: regional DNA extensions can be ligated into long constructs reflecting the initial peptide information using NGS sequencing analysis, as shown in the bottommost geometry panel.

[0110] Fig.26A trifunctional molecule of approximately 1 kd is shown with: (1) phenyl isothiocyanate, (2) a propargyl group, and (3) a model vanillin at an oligonucleotide position to simplify analytical characterization of the basic structure: NNN-(propargyl-PEG2)(6-oxo-6-(dibenzo[b,f]azocine-4-yn-1-yl)-hexanoic acid)(PEG3-1-acetamido-4-isothiocyanato-benzene). The molecular structure was confirmed using LC ESI-MS and tested for its functionality. HPLC analysis showed product formation with high yield, indicating functional activity of the key reactive isothiocyanate moiety.

[0111] Fig. 27 An agarose electrophoresis gel demonstrating efficient in situ ligation of circulating tag and recoding tag oligonucleotides is shown. In lane 1 is a dsDNA ladder marker (Cat. No. 10597012 from Invitrogen), with the brightest band appearing at 100 base pairs. In lane 2 is the product from the ligation of a 45-mer oligonucleotide with tether arms at both the 3' end (Sys#001LO2,30, SEQ ID NO:85) and the 5' end (Sys#001,LO1,30, SEQ ID NO:84) with a 30-mer ligation oligonucleotide. Three bands are visible: the product of two 30-mer oligonucleotides ligated, a faint band showing one or the other 30-mer oligonucleotide ligated, and an unclear band showing no ligated 45-mer oligonucleotide. Lanes 3 and 4 show the ligation products when only one or the other 30-mer ligation oligonucleotide is added to the reaction, thus producing a shorter product. Lane 5 shows the ligation mixture without added ligase, and the major band is the 45-mer oligonucleotide band. Lane 6 shows the ligation product with the "untethered" form of the 45-mer oligonucleotide, and three bands similar to those in lane 2, indicating the presence of a double ligation product, a single ligation product, and a 45-mer product without ligation.

[0112] Fig.28 Block diagram showing the steps of the cyclic protection and deprotection workflow.

[0113] Fig.29 A reaction scheme for the stepwise assembly of an immobilized CRC complex is shown, wherein the N-terminal amino acid is reacted with an amine-reactive molecule having a second reactive functional group (e.g., a tetrazine). A trifunctional construct having a nucleic acid circulating tag and a surface immobilization moiety and trans-cyclooctene can be reacted with a tetrazine of an amine-reactive molecule to form an immobilized CRC complex.

[0114] Fig.30A reaction scheme for the stepwise assembly of an immobilized CRC complex is shown, wherein the N-terminal amino acid is reacted with an amine-reactive molecule having a second reactive functional group (e.g., trans-cyclooctene). A trifunctional construct having a nucleic acid circulating tag and a surface immobilization moiety can be reacted with a tetrazine functional group of an amine-reactive molecule to form an immobilized CRC complex.

[0115] Fig.31 A reaction scheme for the stepwise assembly of an immobilized CRC complex is shown, in which a tetrazine-labeled oligonucleotide is reacted with a functional group of a trifunctional construct (e.g., trans-cyclooctene) having a reactive portion for binding and cleaving the N-terminal amino acid residue of a peptide and a surface-immobilized portion.

[0116] Figure 32A-32B The CRC synthesis process and intermediate molecules are shown. Fig.32A is a block diagram illustrating the steps in the synthesis of PPO starting from PDA, which is converted to PDON-tBOC, which can be deprotected to form PDON, which is then converted to PDO and subsequently to PPO. Fig.32B Includes the chemical structures of PPO and intermediates.

[0117] Fig.33 The function of PPO is shown. The relative fluorescence units (RFU) of PPO fixed to an azide-modified surface via a copper-catalyzed Huisgen cycloaddition reaction and then reacted with amine-labeled fluorescein are shown. Multiple fractions of purified PPO behave similarly. Strong signals above background confirm the function of both the ITC chemically reactive elements of alkynes and CRC.

[0118] Fig.34 The function of PPO is shown. The relative fluorescence units of fluorescent oligonucleotides complementary to oligonucleotides immobilized to PPO on an azide-modified surface via a copper-catalyzed Huisgen cycloaddition reaction are shown. Multiple fractions of purified PPO behave similarly. Strong signals above background confirm the function of both the oligonucleotide elements of the alkyne and the CRC.

[0119] Fig.35 The functionality of PPO is shown. The relative fluorescence units (RFU) of PPO immobilized via a reactive ITC moiety onto an amine-modified surface followed by a copper-catalyzed Huisgen cycloaddition with an azide-labeled fluorescein reagent are shown. Multiple fractions of purified PPO behave similarly. The strong signal above background confirms the functionality of the alkyne, the functionality of the ITC chemically reactive elements of the CRC, and the ability to use the CRC on multiple embodiments of a solid support.

[0120] Figure 36A-Figure 36DExemplary simulations and binding kinetics of a commercially available antibody (Sigma, SAB5200015) to immobilized phosphotyrosine-PTH-ligand are shown. Fig.36D Representative data showing robust and reproducible binding curves generated using the Nicoya SPR system are shown.

[0121] Fig.37 PCR data for the tethered recoding block is shown. Amplification of both the tethered oligonucleotide with and without the tether shows amplification of the tethered recoding block with the tether, thereby demonstrating the ability to generate amplicons of the tethered recoding block for subsequent acquisition of sequence information of the memory oligonucleotide or the recoding block.

[0122] In certain embodiments, a method for analyzing one or more peptides from a sample comprising a plurality of peptides, proteins and / or protein complexes is provided, the method comprising: (a) providing a peptide of polymer length n=2 to 2000 attached to a solid support; (b) providing a first chemically reactive conjugate, such as a PITC-conjugate, wherein the first chemically reactive conjugate comprises a cycle tag having identification information about a workflow cycle of the method. (c) contacting the peptide with a first chemically reactive conjugate, wherein the first chemically reactive conjugate binds to the terminal amino acid or modified terminal portion of the peptide to form a conjugate complex, such as a PTC-AA-cycle tag-conjugate complex, (d) immobilizing the conjugate complex to a solid support, (e) cleaving the terminal amino acid from the peptide, thereby providing an immobilized conjugate complex and a new terminal amino acid of the peptide attached to the solid support of (a), (f) contacting the immobilized conjugate complex with a first binding agent capable of binding to the immobilized conjugate complex, wherein the first binding agent comprises a binding moiety and a first recode tag (e.g., a "recodeTag") having identifying information about the first binding agent; and (g) transferring information of the first recode tag associated with the first binding agent to the cycle tag of the immobilized conjugate complex to produce a first recode block (recode block). (h) optionally repeating steps (b) to (g) to assemble a second recoding block having recoding information for a new terminal amino acid of the peptide; (i) optionally repeating step (h) for additional iterative cycles to produce additional recoding blocks for additional amino acids of the fixed peptide of step (a); (j) optionally deprotecting the nucleic acids of the first, second and additional recoding blocks; (k) contacting the recoding blocks with a polymerase, nucleotides, a ligase and a buffer under conditions allowing extension-ligation to assemble the recoding blocks into memory oligonucleotides (e.g., "memory oligonucleotides"); and (l) analyzing the memory oligonucleotides.

[0123] In some aspects, one or more operations of the method are repeated one or more times to increase the step yield of the method. For example, in specific aspects, operations (e), (f) and / or (g) are repeated one or more times to increase the step yield.

[0124] In some aspects, the method further includes contacting the fixed conjugated complex with a promiscuous binder between operations (h) and (j) and / or after operation (k), the promiscuous binder is capable of binding to the fixed conjugated complex regardless of the identity of the amino acid (AA) within the conjugated complex, and wherein the promiscuous binder comprises a binding moiety that associates with the fixed conjugate regardless of the AA. The promiscuous binder can carry specific circulation information, or a promiscuous recoded tag (e.g., inosine base) that can hybridize with any circulation tag (or a subset of circulation tags) and carry identification information about the promiscuous binder. This provides robustness for the binding recognition operation and can be repeated one or more times to increase the step yield. In such aspects, operation (k) can be repeated after contacting the fixed conjugated complex with the promiscuous binder.

[0125] In some aspects, the peptide comprises any suitable macromolecular polymer, including proteins, peptides, complex carbohydrates, etc. In such aspects, the monomeric units of the macromolecular polymer can comprise amino acids, carbohydrates, and / or any monomeric moieties that can be combined into a polymer.

[0126] In some aspects, the conjugated complex comprises zero, one or more reactive moieties (e.g., moieties for joining the complex to a solid support), and the reaction comprises an activatable chemistry. In some aspects, the conjugated complex comprises zero, one or more reactive moieties (e.g., moieties for joining the complex to a solid support), and the reaction comprises an activatable chemistry. In some aspects, the conjugated complex comprises zero, one or more reactive moieties (e.g., moieties for joining the complex to a solid support), and the reaction comprises a reversible chemistry and an activatable chemistry.

[0127] In some aspects, the recoding tag attached to the binding agent is a nucleic acid having the following: a sequence corresponding to the (n-1)th cycle tag or the (n+ / -i)th cycle tag, an amino acid (AA) tag (e.g., an "AA tag"), and the nth cycle tag. Optionally, the recoding tag attached to the binding agent is a nucleic acid having the following: a universal sequence for amplification or assembly, a sequence complementary to the cycle tag (e.g., a "cycle tag complement sequence"), and an amino acid (AA) tag (e.g., an "AA tag").

[0128] In some aspects, operation (k) comprises contacting the recoding block with a ligase, an AA tag oligonucleotide complement, and a buffer under conditions permissive for ligation to assemble the recoding block and the AA tag oligonucleotide complement into a memory oligonucleotide, or to generate fragments of a memory oligonucleotide.

[0129] In certain embodiments, a method for analyzing one or more peptides from a sample comprising a plurality of peptides, proteins and / or protein complexes is provided, the method comprising: (a) providing a peptide of a polymer length n=2 to 2000 attached to a solid support; (b) providing a first chemically reactive conjugate (e.g., a PITC-conjugate), wherein the conjugate comprises a cycle tag having identification information about a workflow cycle of the method, a reactive portion that can bind to and cleave the terminal amino acid of the peptide, and a reactive portion that facilitates immobilization to the solid support; (c) contacting the peptide with the first chemically reactive conjugate, wherein the first chemically reactive conjugate is bound to the terminal amino acid or modified terminal portion of the peptide to form a first conjugate complex, such as a PIT-AA-cyclic tag-conjugate complex; (d) immobilizing the first conjugate complex to a solid support; (e) cleaving the terminal amino acid from the peptide, thereby providing a first immobilized conjugate complex and a new terminal amino acid of the peptide attached to the solid support of (a); (f) optionally repeating (b) to (e) to assemble a second immobilized conjugate complex having the cyclic information of the new terminal amino acid of the peptide; (g) optionally repeating (f) for additional iterations to produce the peptide of step (a); (h) optionally deprotecting the nucleic acid of the conjugate complex and / or any protected nucleic acid associated with the solid support; (i) contacting the first fixed conjugate complex with a first binding agent capable of binding to the first fixed conjugate complex, wherein the first binding agent comprises a binding moiety and a recoding tag having identification information about the first binding agent; (j) transferring the information of the recoding tag associated with the first binding agent to the circulating tag of the first fixed conjugate complex to produce a first recoding block; (k) optionally repeating (i) and (j) with a second binding agent. , the second binding agent comprises a binding portion and a recoding tag having identification information about the second binding agent to transfer the information of the recoding tag associated with the second binding agent to a second fixed conjugate complex to produce a second recoding block; (l) optionally repeating (k) for additional cycles to produce a recoding block of additional amino acids of the peptide of step (a); (m) contacting the recoding block with a polymerase, nucleotides, a ligase and a buffer under conditions that allow extension-ligation to assemble the recoding block into a memory oligonucleotide or generate fragments of a memory oligonucleotide; and (n) analyzing the memory oligonucleotide.

[0130] In some aspects, one or more operations of the method are repeated one or more times to increase the step yield of the method. For example, in specific aspects, operations (e), (i) and / or (j) are repeated one or more times to increase the step yield.

[0131] In some aspects, the method further includes contacting the first fixed conjugated complex with a promiscuous binder after operation (m), the promiscuous binder being capable of binding to the first fixed conjugated complex regardless of the identity of the amino acid within the conjugated complex, wherein the promiscuous binder comprises a binding moiety that associates with the fixed conjugate regardless of the amino acid. The promiscuous binder can carry specific cycle information, or a promiscuous recoded tag (e.g., inosine base) that can hybridize with any cycle tag (or a subset of cycle tags) and carry identification information about the promiscuous binder. This provides robustness for the binding recognition operation and can be repeated one or more times to increase the step yield. In such aspects, operation (m) can be repeated after contacting the fixed conjugated complex with the promiscuous binder.

[0132] In some aspects, assembly (e.g., joining) of recoding blocks is facilitated by utilizing a permissive polymerase such as polymerase θ (Polθ) or by utilizing proteins involved in a blunt-end DNA joining process similar to non-homologous end joining (NHEJ). See, e.g., T et al., Postepy Biochem 2009;55(1):36-45; Davis AJ, Chen DJ, Transl Cancer Res. 2013 Jun;2(3):130-143.

[0133] In some aspects, the peptide comprises any suitable macromolecular polymer, including proteins, peptides, polypeptides, etc. In such aspects, the monomeric units of the macromolecular polymer can comprise amino acids, carbohydrates, and / or any monomeric moieties that can be combined into a polymer.

[0134] In certain embodiments, a method for analyzing one or more peptides from a sample containing a plurality of peptides, proteins and / or protein complexes is provided, the method comprising: (a) providing a peptide of a polymer length n=2 to 2000 attached to a solid support using a location linker, wherein the location linker is bound to a location oligonucleotide (e.g., a "location oligo"); (b) providing a first chemically reactive conjugate (e.g., a PITC-conjugate), wherein the conjugate comprises a cycle tag having identification information about a workflow cycle of the method, a reactive portion that can bind to and cleave a terminal amino acid of the peptide, and a reactive portion that facilitates immobilization to a solid support; (c) contacting the peptide with the first chemically reactive conjugate, wherein the first chemically reactive conjugate binds to the terminal amino acid or modified terminal portion of the peptide to form a first conjugated complex, e.g., a PITC-cycle tag-conjugated complex; (d) fixing the first conjugated complex to a solid support; (e) cleaving the terminal amino acid from the peptide, thereby providing a first fixed conjugated complex and a new terminal amino acid of the peptide attached to the solid support of (a), (f) optionally repeating (b) to (e) to assemble a second fixed conjugated complex having the cyclic information of the new terminal amino acid of the peptide, (g) optionally repeating (f) for additional iterative cycles to produce additional fixed conjugated complexes of additional amino acids of the peptide of step (a); (h) optionally deprotecting the nucleic acid of the conjugated complex and / or any protected nucleic acid associated with the solid support; (i) fixing the first solid support to a second fixed conjugated complex and a new terminal amino acid of the peptide attached to the solid support of (a), (ii) optionally repeating (b) to (e) to assemble a second fixed conjugated complex having the cyclic information of the new terminal amino acid of the peptide, (iii) optionally repeating (f) for additional iterative cycles to produce additional fixed conjugated complexes of additional amino acids of the peptide of step (a); (i) contacting the fixed conjugated complex with a first binding agent capable of binding to the first fixed conjugated complex, wherein the first binding agent comprises a binding moiety and a recoded tag having identification information about the first binding agent; (j) transferring information of the recoded tag associated with the first binding agent to the circulating tag of the first fixed conjugated complex to produce a first recoded block; (k) optionally repeating (i) and (j) with a second binding agent, wherein the second binding agent comprises a binding moiety and a recoded tag having identification information about the second binding agent, to transfer information of the recoded tag associated with the second binding agent to the second fixed conjugated complex to produce a second recoding block; (l) optionally repeating step (k) for additional cycles to produce recoding blocks of additional amino acids of the peptide of step (a); (m) contacting at least the first recoding block and the corresponding positioning oligonucleotide with a polymerase, nucleotides, and a buffer under conditions that allow extension to transfer information from the positioning oligonucleotide to the first recoding block, thereby producing a memory oligonucleotide; (n) optionally repeating step (m) to transfer information from the positioning oligonucleotide to additional recoding blocks in proximity to the positioning oligonucleotide; (o) releasing the memory oligonucleotide from the solid support via tether cleavage, hydrogel dissociation, polymerization, or another means;(p) optionally assembling the memory oligonucleotides into longer memory oligonucleotides (ectopically); and (q) analyzing the memory oligonucleotides.;

[0135] In some aspects, one or more operations of the method are repeated one or more times to increase the step yield of the method. For example, in specific aspects, operations (e), (i) and / or (j) are repeated one or more times to increase the step yield.

[0136] In some aspects, the peptide comprises any suitable macromolecular polymer, including proteins, peptides, complex carbohydrates, etc. In such aspects, the monomeric units of the macromolecular polymer can comprise amino acids, carbohydrates, and / or any monomeric moieties that can be combined into a polymer.

[0137] In some aspects, the recoding tag attached to the binding agent is a nucleic acid having the following: a sequence corresponding to the (n-1)th cycle tag or the (n+ / -i)th cycle tag, an amino acid (AA) tag (e.g., an "AA tag"), and the nth cycle tag. Optionally, the recoding tag attached to the binding agent is a nucleic acid having the following: a universal sequence for amplification or assembly, a sequence complementary to the cycle tag (e.g., a "cycle tag complement sequence"), and an amino acid (AA) tag (e.g., an "AA tag").

[0138] In some aspects, a ligase is used to transfer information from the mapping oligonucleotide to the recoding block.

[0139] In some aspects, each individual memory oligonucleotide is analyzed independently or in random assembly with other memory oligonucleotides of the same analyte or different analytes from the sample. This approach can facilitate simplification of the recoding process and allow for more efficient analysis.

[0140] In some aspects, spatial localization in histological tissue sections can be determined using localization oligonucleotides and combined with computer identification data to achieve spatial resolution of individual protein molecules. Determining the spatial localization of protein molecules in histological tissue sections enables spatial multi-omics analysis. Spatial multi-omics is the study of gene / RNA expression and protein abundance in a spatial context to elucidate functional biology. Integrating analyses of different scales from spatial multi-omics can promote improved understanding of tissue and cellular microenvironment.

[0141] In some aspects, the conjugate complex comprises zero, one, or more reactive moieties (eg, for attaching the complex to a solid support), and the reaction comprises an activatable chemistry.

[0142] In some aspects, the conjugate complex comprises zero, one, or more reactive moieties (eg, for attaching the complex to a solid support), and the reaction comprises reversible chemistry.

[0143] In some aspects, the conjugate complex comprises zero, one, or more reactive moieties (eg, for attaching the complex to a solid support), and the reaction comprises both activatable and reversible chemistry.

[0144] In some aspects, one or more amino acids (or monomer subunits) are removed from a fixed peptide (or macromolecular analyte), without considering the amino acids (or monomers) that identify the cycle. These "skipped" amino acid cycles are recorded with a computer, and the analysis algorithm takes into account the known translation of the information skipped during the comparison with the reference sequence. In the case of a peptide, this can be achieved by optionally performing one or more iterations of operation 2-4 described below, wherein PITC replaces a chemically reactive conjugate (e.g., PITC-conjugate). This can be referred to as "gated" reads or "gated" sequencing. An advantage of this aspect is that the isoforms of the protein can be easily determined by reading sections that are not adjacent to each other in the protein to obtain long-range information. This can save time and cost to obtain intermediate or redundant information and related genomic information contained in a peptide or in a peptide combination. For example, this aspect can include 5 cycles of peptide degradation using a chemically reactive conjugate, followed by 30 cycles using PITC or enzyme cutting, followed by another 5 cycles using a chemically reactive conjugate, etc.

[0145] In some aspects, the use of a predetermined subset of binding agents allows the identification of a subset of amino acids of a peptide, polypeptide, protein, or protein complex. Given that the site of interest (e.g., post-translational modification (PTM) or splice location) may be different between various proteins in a mixed population, this aspect eliminates the need to measure / determine the identity of every single amino acid in a sample in every single cycle (a task that requires significantly more sequencing).

[0146] In some aspects, a subset of amino acids identified by a subset of binders is modified with a post-translational modification. Doing so can greatly enrich the information density of the subset of amino acids when analyzed.

[0147] In some aspects, an aminopeptidase (e.g., CAS No.: 37288-67-8) or similar reagent / construct is used to remove one or more amino acids (or monomer subunits) from an immobilized peptide (or macromolecular analyte) without regard to identifying the circulating amino acid (or monomer). In addition, this technology can also be applied to prepare the N-terminus of a protein or peptide protected by acylation for treatment by a chemically reactive conjugate. In addition, this method can be used to "gate" amino acids such as proline, which in some examples cannot be effectively cleaved under the chemical conditions using a chemically reactive conjugate.

[0148] In some aspects, one or more operations of the method are performed simultaneously. For example, in certain aspects, operations (i) to (l) are performed simultaneously.

[0149] In some aspects, operation (m) comprises contacting the recoding block with a ligase, an AA tag oligonucleotide complement, and a buffer under conditions permissive for ligation to assemble the recoding block and the AA tag oligonucleotide complement into a memory oligonucleotide.

[0150] In some aspects, the memory oligonucleotide, cycling tag, recoding block, AA tag complement and / or linker oligonucleotide or component can comprise a DNA molecule, an RNA molecule, another type of nucleic acid molecule, a DNA molecule with a pseudo-complementary base (e.g., inosine), or a combination or chimera thereof.

[0151] In some aspects, the memory oligonucleotide or the ligation component comprises a universal priming site, and the universal priming site can comprise a priming site for amplification, a priming site for sequencing, or both.

[0152] In some aspects, the memory oligonucleotide comprises a sample index, a spacer, a unique molecular identifier (UMI), a universal priming site, a CRISPR protospacer adjacent motif (PAM) sequence, or any combination thereof.

[0153] In some aspects, the memory oligonucleotide and / or chemically reactive conjugate comprises a spacer between 0.1 nm and 500 nm in length attached to its 3' end, 5' end, or to a modified nucleotide base.

[0154] In some aspects, a memory oligonucleotide is associated with a unique molecular identifier (UMI) or a barcode.

[0155] In some aspects, solid supports as described herein include solid beads, porous beads, solid planar supports, porous planar supports, patterned or non-patterned surfaces, nanoparticles, or inorganic or polymeric microspheres. In some aspects, the support can include a glass slide or wafer, a silicon slide or wafer, a PC PTC PE HDPE or other plastic surface, Teflon, nylon, nitrocellulose or other membrane, and the particles / beads can be polystyrene, cross-linked polystyrene, agarose or acrylamide.

[0156] In some aspects, the beads or nanoparticles are magnetic or paramagnetic.

[0157] In some aspects, the solid support can be passivated with glass, silicon oxide, tantalum pentoxide, DLC diamond-like carbon, or other passivating agents, or the solid support can comprise a membrane that is passivated or activated via, for example, corona or other plasma treatment methods.

[0158] In some aspects, the solid support may or may not be assembled with other components to facilitate fluid transport and / or detection (eg, flow cells, biochips, microtiter plates).

[0159] In some aspects, the solid support is comprised of a hydrogel that supports the attachment of components for macromolecular recoding and / or analytical workflows.

[0160] In some aspects, the hydrogel is formed from synthetic polymers, natural polymers, and / or hybrid polymers. The monomers may include one or more of: acrylamide, dihydroxy methacrylate, methacrylic acid, etc., in linear, branched, and / or cross-linked configurations, block copolymer configurations, or other configurations that are conducive to sequencing macromolecules.

[0161] In some aspects, the hydrogel comprises at least 3 orthogonal conjugation chemistry modalities.

[0162] In some aspects, the macromolecule (eg, protein, peptide) and / or the universal primer sequence is covalently attached to the solid support.

[0163] In some aspects, the binding agent comprises a polypeptide or protein, such as an antibody or portion thereof (e.g., a single-chain variable fragment (scFv), a fragment antigen binding (FAB) region, a FAB2 region), a nanobody, a DNA aptamer, an RNA aptamer, a modified aptamer, a photoactive or non-photoactive caged compound, an oligopeptide permease (Opp), an aminoacyl-tRNA synthetase (aaRS), a periplasmic binding protein (PBP), a dipeptide permease (Dpp), a proton-dependent oligopeptide transporter (POT), a modified aminopeptidase, a modified aminoacyl-tRNA synthetase, a modified anticalin, or a modified Clp protease adaptor protein (ClpS).

[0164] In some aspects, the binding agent is capable of selectively binding to the immobilized conjugated complex based on the AA that is part of the complex.

[0165] In some aspects, a binding agent comprises a binding moiety and a recoding tag.

[0166] In some aspects, the recoding tag comprises a sequence representing AA information, and the recoding block comprises a sequence representing both workflow cycle and amino acid (or monomer identity) information.

[0167] In some aspects, the binding moiety and the recoding tag are joined by a linker having a length between 0.1 nm and 500 nm.

[0168] In some aspects, the chemically reactive conjugate and / or conjugated complex further comprises a spacer, a workflow cycle specific sequence, a unique molecular identifier, a universal priming site, a restriction endonuclease cleavage sequence, or any combination thereof.

[0169] In some aspects, the chemically reactive conjugate and / or conjugated complex comprises a spacer associated with a reactive moiety for anchoring the chemically reactive conjugated complex to a hydrogel surface, and the spacer comprises a restriction endonuclease cleavage sequence capable of releasing the PITC-AA moiety and / or circulating tag from the conjugated complex.

[0170] In some aspects, the chemically reactive conjugate and / or conjugated complex comprises a spacer associated with a reactive moiety for binding and cleaving a terminal amino acid, and the spacer contains a restriction endonuclease cleavage sequence capable of releasing the circulating tag and / or the reactive moiety for immobilization from the conjugated complex.

[0171] In some aspects, the chemically reactive conjugate can be in pro-form, meaning that it is capable of performing functions such as circulating identification (e.g., circulating tags), binding and cleaving amino acids (e.g., PITC), and reacting with surfaces (e.g., hydrogel-coated surfaces) through addition, activation, cleavage reactions, or other manipulations.

[0172] In some aspects, the transfer of information from the recoding tag to the recoding block is mediated by DNA ligase and a ligating oligonucleotide.

[0173] In some aspects, the transfer of information of the recoding tag to the recoding block is mediated by a DNA polymerase or by a combination of a DNA polymerase and a ligase.

[0174] In some aspects, the transfer of information from the recoding tag to the recoding block is mediated by chemical ligation.

[0175] In some aspects, a plurality of macromolecules and associated conjugated complexes are attached to a solid support.

[0176] In some aspects, multiple libraries of different combinations or compositions of binding agents with completely different or different but overlapping affinities can be introduced to the surface of the immobilized chemically reactive conjugates. By using different libraries with different binding properties, a more comprehensive and more accurate characterization of the immobilized peptides can be achieved.

[0177] In some aspects, the plurality of macromolecules are spaced apart on the solid support at an average distance of >100 nm.

[0178] In some aspects, the reactivity of residual chemically reactive conjugates (e.g., conjugates that have not reacted with amino acids but are immobilized to the surface due to inadequate removal by washing prior to initiating the immobilization chemistry) is quenched by the amino acid or amino acid mimetic to become bystanders in future cycles.

[0179] In some aspects, modification of the terminal amino acid of the peptide prior to contacting the peptide with the first chemically reactive conjugate increases the reactivity of the chemically reactive conjugate to the modified amino acid relative to the unmodified amino acid. For example, activation of the C-terminal amino acid with acetic anhydride prior to contacting with trimethylsilyl isothiocyanate has been described. Bailey, JM, Shenoy, NR, Ronk, M. and Shively, JE, 1992, Protein Sci. 1, 68-80.

[0180] In some aspects, the methods described herein further include contacting the recoding blocks with a polymerase, nucleotides, ligases, and / or buffers under conditions that allow extension-ligation or ligation to assemble the recoding blocks into memory oligonucleotides, and contacting a plurality of incompletely connected memory oligonucleotides with a ligation oligonucleotide, a polymerase, nucleotides, ligases, and / or buffers under conditions that allow extension-ligation or ligation to assemble the incompletely connected memory oligonucleotides into memory oligonucleotides. Thus, the yield during memory oligonucleotide assembly can be increased.

[0181] In some aspects, the methods described herein further include contacting the recoding blocks with a polymerase, nucleotides, ligases, and / or buffers under conditions that allow extension-ligation or ligation to assemble the recoding blocks into memory oligonucleotides, and then contacting the plurality of incompletely connected memory oligonucleotide fragments and / or the recoding blocks with a ligation oligonucleotide, a ligase, and a buffer under conditions that promote ligation of the recoding blocks with the memory oligonucleotide fragments. Thus, the yield during assembly of the memory oligonucleotides can be increased.

[0182] In some aspects, the ligation oligonucleotide comprises a sequence complementary to a sequence of a recoding block, thereby facilitating ligation of recoding blocks that were not ligated during contact with a polymerase, nucleotides, a ligase, and a buffer.

[0183] In some aspects, the ligation oligonucleotide comprises additional nucleotide sequences encoded to carry information related to a sample or process and / or to facilitate ligation or extension-ligation.

[0184] In some aspects, memory oligonucleotides are amplified prior to analysis, such as by bridge amplification, ExAmp NGS clustering, isothermal clustering, solution-based PCR amplification, A-tailing to add primer sequences prior to solution-based amplification, or any suitable DNA amplification method.

[0185] In some aspects, the memory oligonucleotide optionally comprises a sample index, a spacer, a unique molecular identifier (UMI), a universal priming site, a CRISPR protospacer adjacent motif (PAM) sequence, or any combination thereof.

[0186] In some respects, multiple memory oligonucleotides are enriched before analysis, for example, via a depletion process or a standardization process to remove or reduce the oligonucleotide parts associated with high-abundance proteins, peptides or macromolecules. In some respects, enrichment or depletion can be carried out via a commercially available test kit (such as Agilent SureSelect), or via a custom enrichment or depletion method using an oligonucleotide that is partially complementary to a memory oligonucleotide sequence (for example, complementary to the AA tag sequence of a target memory oligonucleotide).

[0187] In some aspects, multiple memory oligonucleotides representing multiple macromolecules are analyzed in parallel.

[0188] In some aspects, analyzing the one or more memory oligonucleotides comprises a nucleic acid sequencing method.

[0189] In some aspects, analyzing the one or more memory oligonucleotides comprises analyzing via a multiplex PCR approach.

[0190] In some aspects, the nucleic acid sequencing method comprises sequencing by synthesis, sequencing by ligation, sequencing by hybridization, or pyrosequencing.

[0191] In some aspects, the nucleic acid sequencing method comprises single molecule microscopy sequencing or nanopore sequencing.

[0192] In some aspects, the memory oligonucleotides are configured for analysis using commercially available NGS technology, such as the NGS methods exemplified by Illumina, Element Bio, and Singular Genomics.

[0193] In some aspects, the chemically reactive conjugate and / or conjugated complex comprises a cleavable group flanking a matching unique molecular identifier (UMI) within the circulating tag to facilitate the cleavage of the memory oligonucleotide at a specified position. In these aspects, one or more restriction endonuclease sequences carried by one or more circulating tag sequences assembled into memory oligonucleotides are cut to produce one or more oligonucleotides (memory oligonucleotides). The oligonucleotides are short enough to be fully read using short-read DNA sequencing technology, including those short-read DNA sequencing methods and devices commercialized by Illumina, Element Bio, and Singular Genomics.

[0194] In some aspects, helicases can be utilized during the assembly of memory oligonucleotides. In some examples, the use or gating of helicases during one or more assembly processes can improve the proximity of DNA blocks to facilitate the assembly of longer memory oligonucleotides.

[0195] In some aspects, the memory oligonucleotide or its recoding block is configured to be analyzed using a decoding-based method. More information about decoding-based techniques can be found in Gunderson et al., Decoding Randomly Ordered DNA Arrays, Genome Res., May 2004; 14(5):870-7, which is incorporated herein by reference in its entirety for all purposes.

[0196] In some aspects, a decoding-based approach is used to analyze fragments of memory oligonucleotides or re-encoding blocks or any such spatially restricted set of constructs containing sequence and identity information associated with a given peptide, protein, protein complex, or polymer. See Gunderson et al.

[0197] In some aspects, the identification component is selected from a UMI, a sample index, a recoded tag, a recoded block, a junction oligonucleotide, an AA tag, their complements, or any combination thereof.

[0198] In some aspects, the N-terminal AA of the peptide is removed by a chemical cleavage alternative to Edman cleavage.

[0199] In some aspects, the one or more chemically reactive conjugates are bound to the terminal amino acid residue of the peptide.

[0200] In some aspects, one or more binding agents are bound to the conjugate complex.

[0201] In some aspects, the conjugate complex comprises a post-translationally modified amino acid.

[0202] In some aspects, the identification component of the re-encoding tag, the re-encoding block, or both includes error detection and / or correction bits.

[0203] In some aspects, the error detection / correction sequences are derived from Hamming distance theory or other modern digital code space theories (eg, Lee, Levenshtein-Tenengolts, Reed-Solomon, or others).

[0204] In some aspects, components of a recoding tag, a recoding block, or both comprise 2, 3, 4, 5, 6, or more different types of nucleotides.

[0205] In some aspects, the code (or codes) (eg, sequence) associated with a recoding tag or recoding block via analysis of memory oligonucleotides is derived from 2, 3, 4, 5, 6, or more types of nucleotides.

[0206] In some aspects, the number of different types of nucleotides used to generate the recoding code is not equal to the number of nucleotide types that make up the recoding tag, the cycle tag, or either or both.

[0207] In some aspects, the macromolecule, fragment or peptide activation includes functional moieties such as NHS groups, aldehyde groups, azide groups, alkyne groups, maleimide groups, thiol groups, tetrazine groups, and trans-cyclooctene groups.

[0208] In some aspects, the immobilized peptide is linearized (denatured) using one or more detergents, one or more surfactants, one or more dispersing agents, one or more reducing agents, and / or one or more alkylating agents.

[0209] In some aspects, the chemically reactive conjugate reacts and cleaves from the C-terminus of the peptide rather than the N-terminus to produce a recoding block that can be assembled using any of the methods described herein.

[0210] In some aspects, "paired-end read" information can be collected from fixed protein complexes, proteins, or peptides by using chemically reactive conjugates that operate on both the N-terminus and the C-terminus of a given protein complex, protein, or peptide, either sequentially or in parallel, to produce recoding blocks that can be assembled using the methods described herein.

[0211] In certain embodiments, methods are provided for obtaining a priori defined code information via sequencing a subset of nucleotide types in an oligonucleotide or oligonucleotide cluster. This is particularly beneficial when considering the readout of information stored in DNA (e.g., DNA data storage information technology readout).

[0212] In some aspects, information recoded into a memory oligonucleotide is obtained by sequencing a subset of nucleotide types in the memory oligonucleotide. For example, in the sequencing readout, a subset of nucleotide types can be identified, and a subset of nucleotide types can be unidentified, for example, by introducing non-fluorescent, non-reversibly terminated nucleotides into the SBS sequencing reagent mixture. In certain embodiments, the subset is 2 of the 4 natural nucleotides.

[0213] In certain embodiments, a method is provided for preparing one or more peptides of a polymer length n=2 to 2000 for attachment to a solid support, the method comprising: (a) fragmenting peptides, proteins and / or protein complexes in one or more samples; (b) activating zero, one, two or more portions of each fragmented peptide, protein and / or protein complex; (c) optionally attaching a sample-specific nucleotide index sequence to the activated peptide, protein and / or protein complex; and (d) attaching the peptide to a solid support.

[0214] In some aspects, one or more operations of the methods are performed in any suitable sequential order, or simultaneously.

[0215] In some aspects, the subunits of a given protein are co-immobilized on a surface directly or through their interaction with native subunits. Subsequently, one or more subunits can be recoded simultaneously within the same localization region by processes (b)-(m) (including alternative aspects related to the method). The information of the memory oligonucleotide can contain a mixture of subunits (protein and native), which can be deconvoluted on a computer.

[0216] In certain embodiments, a method for preparing an interacting peptide or multiple interacting peptides for attachment to a solid support is provided, the method comprising: (a) cross-linking peptides, proteins, and / or protein complexes in one or more samples (e.g., using homobifunctional, heterobifunctional, or photoreactive methods, as described in Kluger et al., (2004) Bioorganic Chemistry v32:6,451); (b) activating zero, one, two, or more portions of each cross-linked peptide, protein, and / or protein complex for immobilization on a solid support; (c) optionally attaching a sample-specific nucleotide index sequence to the activated peptide, protein, and / or protein complex; and (d) attaching the complex to a solid support. In some aspects, one or more operations of the method are performed in any suitable sequential order, or simultaneously. In general, the method enables analysis of related proteins and their interactions in vivo, thereby facilitating discovery, identification, and research of protein interactomes.

[0217] In certain embodiments, a method for preparing an interactive DNA-peptide or a plurality of interactive DNA-peptide complexes for attachment to a solid support is provided, the method comprising: (a) for one or more samples, crosslinking peptides, proteins and / or protein complexes with native DNA associated with proteins in a biological environment (e.g., using formaldehyde or other methods known in the art); (b) activating zero, one, two or more portions of each crosslinked peptide-DNA, protein and / or protein complex-DNA complex; (c) optionally attaching a sample-specific nucleotide index sequence to the activated peptide-DNA and / or protein-DNA complex; and (d) attaching the complex to a solid support. In some aspects, one or more operations of the method are performed in any suitable sequential order, or simultaneously. Generally, the method provides an analysis of in vivo interactions between proteins and DNA.

[0218] In some aspects, fragmentation comprises physical shearing, endopeptidase activity, modified endopeptidase activity, proteases, metalloproteases, and / or other suitable fragmentation methods.

[0219] In some aspects, the peptide comprises any suitable macromolecular polymer, including proteins, peptides, etc. In such aspects, the monomeric units of the macromolecular polymer can comprise amino acids, carbohydrates, and / or any monomeric moieties that can be combined into a polymer.

[0220] In some aspects, the method further comprises depleting one or more high-abundance proteins from the sample prior to any of operations (a), (b), (c), and / or (d).

[0221] In certain embodiments, the use of a chemically reactive conjugate with a cleavable spacer allows for recovery of the substrate surface for a second round of recoding. For example, in certain embodiments, a method for analyzing one or more residual immobilized analytes from a surface having a plurality of peptides, proteins, and / or protein complexes is provided, the method comprising: (a) providing a surface for use in a previous round of recoding operations (b)-(d) described below, and the surface has been recovered by cleaving the spacer of a first chemically reactive conjugate; (b) providing a second chemically reactive conjugate (e.g., a PITC-conjugate), wherein the conjugate comprises a circulating tag having identification information about a workflow cycle of the method, a reactive moiety that can bind to and cleave the terminal amino acid of the peptide, and (c) contacting the peptide with a second chemically reactive conjugate, wherein the second chemically reactive conjugate binds to the terminal amino acid or modified terminal portion of the peptide to form a second conjugate complex, such as a PIT-AA-cyclic tag-conjugate complex; (d) immobilizing the second conjugate complex to the solid support; (e) cleaving the terminal amino acid from the peptide, thereby providing a second immobilized conjugate complex and a new terminal amino acid of the peptide attached to the solid support of (a), (f) optionally repeating (b) to (e) to assemble a second immobilized conjugate complex having the cyclic information of the new terminal amino acid of the peptide, and (g) ) optionally repeating (f) for additional iterative cycles to produce additional fixed conjugate complexes of additional amino acids of the peptide of step (a); (h) optionally deprotecting the nucleic acid of the conjugate complex and / or any protected nucleic acid associated with the solid support; (i) contacting the second fixed conjugate complex with a binding agent capable of binding to the second fixed conjugate complex, wherein the binding agent comprises a binding moiety and a recoded tag having identification information about the binding agent; (j) transferring the information of the recoded tag associated with the binding agent to the recoded block of the second fixed conjugate complex to produce a recoded block; (k) optionally binding the second binding agent with a second binding agent. Repeating (i) and (j), wherein the second binding agent comprises a binding portion and a recoding tag having identification information about the second binding agent to transfer the information of the recoding tag associated with the second binding agent to a second fixed conjugate complex to produce a second recoding block; (l) optionally repeating (k) for additional cycles to produce a recoding block of additional amino acids of the peptide of step (a); (m) contacting the recoding block with a polymerase, nucleotides, a ligase and a buffer under conditions allowing extension-ligation to assemble the recoding block into a memory oligonucleotide or generate fragments of a memory oligonucleotide; and (n) analyzing the memory oligonucleotide.

[0222] In some aspects, aspects previously described in relation to the first round of operations are applied to the second round of operations.

[0223] In some aspects, one or more operations of the methods are performed in any suitable sequential order, or simultaneously.

[0224] In some aspects, the recovery process is repeated one or more times.

[0225] In some aspects, only a portion of the chemically reactive conjugate is cleaved from the surface, as it may be desirable to retain a portion of the recoding block to facilitate in silico mapping and assembly in iterative cycles of memory oligonucleotide assembly.

[0226] In some aspects, surface restoration can include "gating" proteins using chemical (eg, phenyl isothiocyanate (PITC)) or biological (eg, aminopeptidase) methods.

[0227] In some aspects, the amine groups of the remaining uncleaved recoding block nucleic acid bases are protected by reaction with fluorenylmethoxycarbonyl (FMOC) or other standard protection chemistry.

[0228] In some aspects, after process (m) of the method, a plurality of assembly oligonucleotides containing all or some of the possible assembly oligonucleotides are hybridized to the memory oligonucleotides, ligated, and dehybridized to form a liquid phase memory oligonucleotide.

[0229] In some embodiments, disclosed herein is a method for analyzing one or more peptides from a sample comprising a plurality of peptides, proteins and / or protein complexes, the method comprising: (a) providing a peptide of a polymer length n=2 to 2000 attached to a solid support; (b) providing a first chemically reactive conjugate, wherein the conjugate comprises a circulating tag, a reactive portion that can bind to and cleave the terminal amino acid of the peptide, and a reactive portion that facilitates immobilization to the solid support; (c) contacting the peptide with the first chemically reactive conjugate, wherein the first chemically reactive conjugate binds to the terminal amino acid of the peptide or modified terminal moiety to form a first conjugated complex; (d) immobilizing the first conjugated complex to a solid support; (e) cleaving the terminal amino acid from the peptide, thereby providing a first immobilized conjugated complex and a new terminal amino acid of the peptide attached to the solid support of (a); (f) optionally repeating processes (b) to (e) to assemble a second immobilized conjugated complex having the cyclic information of the new terminal amino acid of the peptide; (g) optionally repeating (f) for additional iterative cycles to produce additional immobilized conjugated complexes of additional amino acids of the peptide of step (a); (h) optionally (i) contacting the first fixed conjugated complex with a first binding agent capable of binding to the first fixed conjugated complex, wherein the first binding agent comprises a binding moiety and a recoding tag having identification information about the first binding agent; (j) transferring the information of the recoding tag associated with the first binding agent to the circulating tag of the first fixed conjugated complex to produce a first recoding block; (k) optionally repeating (i) and (j) with a second binding agent, wherein the second binding agent comprises a binding moiety; The invention relates to a method for preparing a recoding block of a peptide of step (a) and a recoding tag having identification information about a second binding agent to transfer the information of the recoding tag associated with the second binding agent to a second fixed conjugated complex to produce a second recoding block; (l) optionally repeating (k) for additional cycles to produce recoding blocks of additional amino acids of the peptide of step (a); (m) contacting the recoding block with a polymerase, nucleotides, a ligase, and a buffer under conditions that allow extension-ligation to assemble the recoding block into a memory oligonucleotide or produce fragments of a memory oligonucleotide; and (n) analyzing the memory oligonucleotide. Any of the above method steps can be used alone or in combination with other steps or methods described herein. In some embodiments, (e), (i), and (j) are repeated one or more times to increase the step yield of the method. Some embodiments include: after (m) and / or (l), contacting the first fixed conjugate complex with a hybrid binder that is capable of binding to the first fixed conjugate complex regardless of the identity of the amino acid within the conjugate complex, wherein the hybrid binder comprises a binding portion that associates with the fixed conjugate regardless of the amino acid, and a hybrid recoded tag that is capable of hybridizing to any circulating tags and carries identification information about the hybrid binder.In some embodiments, the conjugated complex comprises zero, one or more reactive moieties, and the reaction comprises activatable chemistry and / or reversible chemistry. In some embodiments, the recoding tag associated with the first binding agent is a nucleic acid having the following: a sequence corresponding to the (n-1)th cycle tag, an amino acid (AA) tag, and the nth cycle tag. In some embodiments, (i) to (l) are performed simultaneously. In some embodiments, (m) includes contacting the recoding block with a ligase, an AA tag oligonucleotide complement, and a buffer under conditions that allow connection to assemble the recoding block and the AA tag oligonucleotide complement into a memory oligonucleotide. In some embodiments, the memory oligonucleotide, the cycle tag, and the recoding block each comprise a nucleic acid molecule. In some embodiments, the memory oligonucleotide comprises a universal priming site, which comprises a priming site for amplification or a priming site for sequencing or both. In some embodiments, the binding agent comprises a polypeptide or a protein.

[0230] In some embodiments, disclosed herein is a method for determining the identity and position information of an amino acid residue of a peptide coupled to a solid support, the method comprising: (a) providing a peptide to a solid support, the peptide being coupled to the solid support so that the N-terminal amino acid residue of the peptide is not directly coupled to the solid support and exposed to a reaction condition; (b) providing a chemically reactive conjugate, the chemically reactive conjugate comprising: (x) a circulating tag comprising a circulating nucleic acid associated with a cycle number; (y) a reactive portion, the reactive portion being used to bind to and cleave the N-terminal amino acid residue of the peptide and expose the next amino acid residue as the N-terminal amino acid residue on the cleaved peptide; and (z) an immobilization portion for immobilization to the solid support; (c) contacting the peptide with the chemically reactive conjugate, thereby coupling the chemically reactive conjugate to the N-terminal amino acid of the peptide to form a conjugated complex; and (d) attaching the conjugated complex to the solid support via the immobilization portion. (e) cleaving and thereby separating the N-terminal amino acid residue from the peptide, thereby providing an immobilized amino acid complex, the fixed amino acid complex comprising the cleaved and separated N-terminal amino acid residue; (f) contacting the fixed amino acid complex with a binding agent, the binding agent comprising: a binding portion for preferentially binding to the fixed amino acid complex; and a recoding tag comprising a recoded nucleic acid corresponding to the binding agent, thereby forming an affinity complex, the affinity complex comprising the fixed amino acid complex and the binding agent, so that the circulating tag is close to the recoding tag within each formed affinity complex; (g) transferring the information of the nucleic acid recoding tag associated with the first binding agent to the circulating tag of the first fixed conjugated complex to produce a first recoding block; (j) obtaining sequence information of the recoding block; and (k) determining the identity and position information of the amino acid residues of the peptide based on the obtained sequence information. In some embodiments, the fixed amino acid complex is washed before contacting with the binding agent. In some embodiments, the possible three-dimensional structure of the peptide is determined using the sequence information. Some embodiments include repeating steps (b) to (k) for each subsequent amino acid of the peptide.

[0231] In some embodiments, disclosed herein is a method for determining the identity and position information of an amino acid residue of a peptide coupled to a solid support, the method comprising: (a) providing a peptide to a solid support, the peptide being coupled to the solid support so that the N-terminal amino acid residue of the peptide is not directly coupled to the solid support and exposed to a reaction condition; (b) providing a chemically reactive conjugate, the chemically reactive conjugate comprising: (x) a circulating tag comprising a circulating nucleic acid associated with a cycle number; (y) a reactive portion, the reactive portion being used to bind to and cleave the N-terminal amino acid residue of the peptide and expose the next amino acid residue as the N-terminal amino acid residue on the cleaved peptide; and (z) an immobilization portion for immobilization to the solid support; (c) contacting the peptide with the chemically reactive conjugate, thereby coupling the chemically reactive conjugate to the N-terminal amino acid of the peptide to form a conjugated complex; (d) reacting the peptide to form a conjugated complex via an immobilization reaction. (e) cleaving and thereby separating the N-terminal amino acid residue from the peptide, thereby providing an immobilized amino acid complex, the immobilized amino acid complex comprising the cleaved and separated N-terminal amino acid residue; (f) contacting the immobilized amino acid complex with a binding agent, the binding agent comprising: a binding portion for preferentially binding to the immobilized amino acid complex and a recoding tag comprising a recoding nucleic acid corresponding to the binding agent, thereby forming an affinity complex, the affinity complex comprising the immobilized amino acid complex and the binding agent, thereby bringing the circulating tag into proximity with the recoding tag within the affinity complex; (g) joining the recoding nucleic acid or the sequence of the recoding nucleic acid with the circulating nucleic acid or the sequence of the circulating nucleic acid to produce a recoding block; (j) obtaining sequence information of the recoding block; and (k) determining the identity and position information of the amino acid residues of the peptide based on the obtained sequence information. Some embodiments include repeating steps (b) to (k) for the next amino acid of the peptide. Some embodiments include repeating steps (b) to (k) for each subsequent amino acid of the peptide. Some embodiments include washing the immobilized amino acid complex before contacting the immobilized amino acid complex with the binding agent. Some embodiments include determining the probable three-dimensional structure of the peptide based on the sequence information.

[0232] In some embodiments, disclosed herein is a method for determining the identity and position information of multiple amino acid residues of a peptide, wherein the peptide comprises n amino acid residues, the method comprising: (a) coupling the peptide to a solid support so that the N-terminal amino acid residue of the peptide is not directly coupled to the solid support and exposed to reaction conditions; (b) providing a chemically reactive conjugate, wherein the chemically reactive conjugate comprises: (x) a circulating tag comprising a circulating nucleic acid associated with a cycle number; (y) a reactive portion, wherein the reactive portion is used to bind to and cleave the N-terminal amino acid residue of the peptide and expose the next amino acid residue as the N-terminal amino acid residue on the cleaved peptide; and (z) an immobilization portion for immobilization to the solid support; (c) contacting the peptide with the chemically reactive conjugate, thereby coupling the chemically reactive conjugate to the N-terminal amino acid of the peptide to form a conjugate complex; (d) immobilizing the conjugate complex to the solid support via the immobilization portion; (e) cleaving and thereby separating the N-terminal amino acid residue from the peptide, thereby exposing the next amino acid residue as the N-terminal amino acid residue on the cleaved peptide and providing an immobilized amino acid complex, wherein the immobilized amino acid complex comprises the cleaved and separated amino acid residue. N-terminal amino acid residue of the peptide; (f) repeating (b) to (e) n-1 times to assemble n-1 additional fixed amino acid complexes, each additional fixed amino acid complex correspondingly comprising nucleic acids associated with cycles 2 to n; (g) contacting the fixed amino acid complex with a binding agent, the binding agent comprising: a binding portion for preferentially binding to one of the fixed amino acid complexes or a subset of the fixed amino acid complexes; and a recoding tag comprising a recoding nucleic acid corresponding to the binding agent, thereby forming one or more affinity complexes, each affinity complex comprising a fixed amino acid complex and the binding agent, so that the cycle tag is close to the recoding tag within each formed affinity complex; (h) within each formed affinity complex, the cycle tag is joined to the recoding tag to form a recoding block, thereby generating multiple recoding blocks, each recoding block corresponding to the formed affinity complex; (i) joining two or more members of the multiple recoding blocks to form a memory oligonucleotide; (j) obtaining sequence information of the memory oligonucleotide; and (k) determining the identity and position information of multiple amino acid residues of the peptide based on the obtained sequence information. In some embodiments, n is an integer greater than or equal to 2. In some embodiments, each binding agent comprises a recoded tag having a unique nucleic acid sequence. In some embodiments, multiple binding agents comprise recoded tags having the same nucleic acid sequence. In some embodiments, binding agents comprise recoded tags that can have a unique sequence portion and a common sequence portion.

[0233] In some embodiments, determining the identity and position information of the plurality of amino acid residues of the peptide comprises determining the identity and position information of all the amino acid residues of the peptide. In some embodiments, determining the identity and position information of the plurality of amino acid residues of the peptide comprises determining the identity and position information of only a subset of the amino acid residues of the peptide. Some embodiments comprise identifying the peptide, for example, by comparing the identity and position information of the plurality of amino acid residues with a database.

[0234] In some embodiments, disclosed herein is a method for determining the identity and position information of an amino acid residue of a peptide coupled to a solid support, the method comprising: (a) providing a peptide to a solid support, the peptide being coupled to the solid support so that the N-terminal amino acid residue of the peptide is not directly coupled to the solid support and being exposed to a reaction condition; (b) providing a chemically reactive conjugate, the chemically reactive conjugate comprising: (x) a cycle tag associated with a cycle number; (y) a reactive portion, the reactive portion being used to bind to and cleave the N-terminal amino acid residue of the peptide and expose the next amino acid residue as the N-terminal amino acid residue on the cleaved peptide; and (z) an immobilization portion for immobilization to the solid support; (c) contacting the peptide with the chemically reactive conjugate, thereby coupling the chemically reactive conjugate to the N-terminal amino acid of the peptide to form a conjugated complex; and (d) attaching the conjugate to the solid support via the immobilization portion. The invention relates to a method for immobilizing a conjugated complex onto a solid support; (e) cleaving and thereby separating the N-terminal amino acid residue from the peptide, thereby providing an immobilized amino acid complex, wherein the immobilized amino acid complex comprises the cleaved and separated N-terminal amino acid residue; (f) contacting the immobilized amino acid complex with a binding agent, wherein the binding agent comprises: a binding portion for preferentially binding to the immobilized amino acid complex; and a recoding tag comprising a recoded nucleic acid corresponding to the binding agent, thereby forming an affinity complex, wherein the affinity complex comprises the immobilized amino acid complex and the binding agent, thereby bringing the circulating tag into proximity with the recoding tag within the affinity complex; (g) transferring the information of the recoded nucleic acid associated with the binding agent to the circulating tag of the immobilized conjugated complex to produce a recoding block; (j) obtaining sequence information of the recoding block; and (k) determining the identity and position information of the amino acid residues of the peptide based on the obtained sequence information. Recode Tags

[0235] In some embodiments, recoding tags are disclosed herein. The recoding tag can be part of a binding agent. The recoding tag can correspond to a binding agent. For example, the recoding tag can convey information about a molecule (e.g., an amino acid or a PTM) to which the binding agent binds. The recoding tag can include a nucleic acid, such as a recoding nucleic acid. In some embodiments, the recoding nucleic acid includes DNA or RNA. In some embodiments, the recoding tag is a DNA sequence. In some embodiments, the recoding tag is an RNA sequence. The recoding nucleic acid can be used to encode amino acid information in a nucleic acid. The recoding tag can be used in the methods described herein, such as methods for determining protein information (e.g., amino acid location or identity). Re-encode Block

[0236] In some embodiments, recoding blocks are disclosed herein. Recoding blocks can include a cyclic tag and a recoding tag or its reverse complement. Recoding blocks can include a cyclic tag or its reverse complement and a recoding tag. Recoding blocks can include a cyclic tag or its reverse complement, and a recoding tag or its reverse complement. Recoding blocks can include a cyclic tag and a recoding tag, or information corresponding to a cyclic tag and a recoding tag. For example, a recoding block can include a cyclic nucleic acid, a cyclic nucleic acid sequence, or its reverse complement, and can include a recoding nucleic acid, a recoding nucleic acid sequence, or its reverse complement. Recoding blocks can be used to join synthetic memory oligonucleotides, either of which can convey information about amino acid location and identity in a protein. Recoding blocks can be used in methods described herein, such as methods for determining protein information (such as amino acid location or identity).

[0237] In some embodiments, the recoding block comprises a recoding nucleic acid, a sequence of a recoding nucleic acid, or a reverse complement of a sequence of a recoding nucleic acid joined or combined with a circulating nucleic acid, a sequence of a circulating nucleic acid, or a reverse complement of a sequence of a circulating nucleic acid. In some embodiments, the recoding block comprises a recoding nucleic acid or a reverse complement of a sequence of a recoding nucleic acid joined with a circulating tag. In some embodiments, the recoding block comprises a recoding nucleic acid, a sequence of a recoding nucleic acid, or a reverse complement of a sequence of a recoding nucleic acid. In some embodiments, the recoding block comprises a circulating nucleic acid, a sequence of a circulating nucleic acid, or a reverse complement of a sequence of a circulating nucleic acid. Transfer of Information

[0238] In some embodiments, disclosed herein are methods comprising transferring information. For example, the method can include transferring the information of a recoding nucleic acid to a circulating nucleic acid of a fixed conjugated complex to produce a recoding block. The transfer of information can form a recoding block, or can be used to form a memory oligonucleotide. The transfer of information can be included in the methods described herein, such as methods for determining protein information (such as amino acid location or identity).

[0239] In some embodiments, the transfer information includes performing amplification based on nucleic acid sequences, such as to generate a sequence of recoded nucleic acids or a sequence of circulating nucleic acids. In some embodiments, the transfer information includes performing polymerase chain reaction (PCR) to generate a sequence of recoded nucleic acids or a sequence of circulating nucleic acids. In some embodiments, PCR includes real-time PCR, digital PCR, multiplex PCR, nested PCR, hot start PCR, touchdown PCR or quantitative PCR. In some embodiments, the transfer information includes performing or performing ligase chain reaction, helicase-dependent amplification, strand displacement amplification, loop-mediated isothermal amplification, rolling circle amplification, recombinase polymerase amplification, nickase amplification reaction, whole genome amplification, transcription-mediated amplification, multiple displacement amplification or multiple amplification cycles based on annealing and looping, such as to generate a sequence of recoded nucleic acids or a sequence of circulating nucleic acids. Amplification or other programs can be used to generate a sequence of recoded nucleic acids, a sequence of circulating nucleic acids, a reverse complement or a combination thereof. In some embodiments, the information of the recoded nucleic acids includes a sequence of the recoded nucleic acids or a reverse complement of the sequence of the recoded nucleic acids.

[0240] In some embodiments, the transfer of information involves polymerase chain reaction. In some embodiments, the transfer of information involves reverse transcription polymerase chain reaction. In some embodiments, the transfer of information involves real-time polymerase chain reaction. In some embodiments, the transfer of information involves digital polymerase chain reaction. In some embodiments, the transfer of information involves multiple polymerase chain reaction. In some embodiments, the transfer of information involves nested polymerase chain reaction. In some embodiments, the transfer of information involves hot start polymerase chain reaction. In some embodiments, the transfer of information involves touchdown polymerase chain reaction. In some embodiments, the transfer of information involves quantitative polymerase chain reaction. In some embodiments, the transfer of information involves ligase chain reaction. In some embodiments, the transfer of information involves helicase-dependent amplification. In some embodiments, the transfer of information involves strand displacement amplification. In some embodiments, the transfer of information involves loop-mediated isothermal amplification. In some embodiments, the transfer of information involves rolling circle amplification. In some embodiments, the transfer of information involves recombinase polymerase amplification. In some embodiments, the transfer of information involves nickase amplification reaction. In some embodiments, the transfer of information involves whole genome amplification. In some embodiments, the transfer of information involves transcription-mediated amplification. In some embodiments, the transfer of information involves multiple displacement amplification. In some embodiments, the transfer of information involves multiple amplification cycles based on annealing and looping. In some embodiments, the transfer of information involves amplification based on nucleic acid sequences.

[0241] In some embodiments, the transferring of information comprises joining the recoded nucleic acid or the reverse complement of the recoded nucleic acid to the circulating nucleic acid. join

[0242] In some embodiments, methods comprising joining are disclosed herein. For example, a recoding nucleic acid or its reverse complement can be joined to a circulating nucleic acid or its reverse complement. The joining can form a recoding block, or can be used to form a memory oligonucleotide. The joining can be included in the methods described herein, such as methods for determining protein information (such as amino acid location or identity).

[0243] In some embodiments, joining comprises enzymatic joining. In some embodiments, joining comprises splint joining. In some embodiments, joining comprises chemical joining. In some embodiments, joining comprises template-assisted joining. In some embodiments, joining comprises the use of ligase. In some embodiments, joining comprises the use of splint oligonucleotides. In some embodiments, joining comprises the use of catalysts. In some embodiments, joining comprises the use of bridging molecules. In some embodiments, joining comprises the use of condensing agents. In some embodiments, joining comprises the use of coupling agents. In some embodiments, joining comprises the use of polymerases. In some embodiments, joining comprises the use of complementary nucleic acid sequences. In some embodiments, joining comprises the use of nicking enzymes. In some embodiments, joining comprises the use of nucleic acid modifying enzymes. In some embodiments, joining comprises the use of recombinases. In some embodiments, joining comprises the use of strand displacement polymerases. In some embodiments, joining comprises the use of single-stranded binding proteins. In some embodiments, joining comprises click chemistry reactions. In some embodiments, joining comprises phosphodiester bond formation. In some embodiments, joining comprises peptide nucleic acid-mediated joining. In some embodiments, each binding agent comprises a recoded tag having a unique nucleic acid sequence. In some embodiments, a plurality of binding agents comprise recoded tags having the same nucleic acid sequence. In some embodiments, binding agents comprise recoded tags that can have unique sequence portions and common sequence portions.

[0244] In some embodiments, joining a recoding nucleic acid or a sequence of a recoding nucleic acid with a circulating nucleic acid or a sequence of a circulating nucleic acid to generate a recoding block includes: (i) joining a recoding nucleic acid with a circulating nucleic acid, (ii) joining a recoding nucleic acid with a sequence of a circulating nucleic acid, (iii) joining a sequence of a recoding nucleic acid with a circulating nucleic acid, or (iv) joining a sequence of a recoding nucleic acid with a sequence of a circulating nucleic acid. Some embodiments include performing amplification based on a nucleic acid sequence to generate a sequence of a recoding nucleic acid or a sequence of a circulating nucleic acid. Some embodiments include performing a polymerase chain reaction (PCR) to generate a sequence of a recoding nucleic acid or a sequence of a circulating nucleic acid. In some embodiments, PCR includes real-time PCR, digital PCR, multiplex PCR, nested PCR, hot start PCR, touchdown PCR, or quantitative PCR. Some embodiments include performing or conducting ligase chain reaction, helicase-dependent amplification, strand displacement amplification, loop-mediated isothermal amplification, rolling circle amplification, recombinase polymerase amplification, nicking enzyme amplification reaction, whole genome amplification, transcription-mediated amplification, multiple displacement amplification, or multiple amplification cycles based on annealing and circularization to produce the sequence of the recoded nucleic acid or the sequence of the circulating nucleic acid.

[0245] In some embodiments, joining includes enzymatic ligation, splint ligation, chemical ligation, template-assisted ligation, use of a ligase, use of a splint oligonucleotide, use of a catalyst, use of a bridging molecule, use of a condensing agent, use of a coupling agent, use of a polymerase, use of complementary nucleic acid sequences, use of a nicking enzyme, use of a nucleic acid modifying enzyme, use of a recombinase, use of a strand-displacing polymerase, use of a single-stranded binding protein, click chemistry, phosphodiester bond formation, or peptide nucleic acid-mediated ligation.

[0246] Some embodiments include contacting an additional fixed amino acid complex with a second binding agent. In some embodiments, the binding agent and the second binding agent comprise different recoding tags having recoding nucleic acids that are different from each other. In some embodiments, the binding agent and the second binding agent comprise recoding tags having recoding nucleic acids that are identical to each other. In some embodiments, the binding agent and the second binding agent comprise different recoding tags having recoding nucleic acids that contain sequences that are different from each other and having the same recoding nucleic acid portion.

[0247] In some embodiments, the transferring information comprises joining or combining a recoding nucleic acid, a sequence of a recoding nucleic acid, or a reverse complement of a sequence of a recoding nucleic acid with a circulating nucleic acid, a sequence of a circulating nucleic acid, or a reverse complement of a sequence of a circulating nucleic acid to produce a recoding block. Memory oligonucleotide readout

[0248] In some embodiments, methods comprising memory oligonucleotides are disclosed herein. The memory oligonucleotides may comprise a plurality of recoding blocks, a plurality of reverse complements of recoding blocks, or one or more recoding blocks and a reverse complement of one or more recoding blocks. The memory oligonucleotides may be used in the methods described herein, such as methods for determining protein information such as amino acid location or identity.

[0249] In some embodiments, obtaining sequence information of the recoding block comprises performing sequencing. In some embodiments, obtaining sequence information of the memory oligonucleotide comprises performing sequencing. The memory oligonucleotide may comprise one recoding block or a plurality of recoding blocks. In some embodiments, sequencing comprises Sanger sequencing. In some embodiments, sequencing comprises next generation sequencing. In some embodiments, sequencing comprises pyrophosphate sequencing, sequencing by synthesis, sequencing by ligation, Illumina sequencing, Ion Torrent sequencing, Pacific Biosciences sequencing, Oxford Nanopore sequencing, SOLiD sequencing, nanopore sequencing, single molecule real-time (SMRT) sequencing, 454 sequencing, Complete Genomics sequencing, Helicos sequencing, MinION sequencing, direct RNA sequencing, Linked-Read sequencing, double-end sequencing, or targeted gene sequencing.

[0250] In some embodiments, the sequence information of the memory oligonucleotide is obtained by sequencing. In some embodiments, the sequence information of the memory oligonucleotide is obtained by Sanger sequencing. In some embodiments, the sequence information of the memory oligonucleotide is obtained by next generation sequencing. In some embodiments, the sequence information of the memory oligonucleotide is obtained by pyrophosphate sequencing. In some embodiments, the sequence information of the memory oligonucleotide is obtained by sequencing while synthesis. In some embodiments, the sequence information of the memory oligonucleotide is obtained by ligation sequencing. In some embodiments, the sequence information of the memory oligonucleotide is obtained by Illumina sequencing. In some embodiments, the sequence information of the memory oligonucleotide is obtained by Ion Torrent sequencing. In some embodiments, the sequence information of the memory oligonucleotide is obtained by Pacific Biosciences sequencing. In some embodiments, the sequence information of the memory oligonucleotide is obtained by Oxford Nanopore sequencing. In some embodiments, the sequence information of the memory oligonucleotide is obtained by SOLiD sequencing. In some embodiments, the sequence information of the memory oligonucleotide is obtained by nanopore sequencing. In some embodiments, the sequence information of the memory oligonucleotide is obtained by single molecule real-time (SMRT) sequencing. In some embodiments, the sequence information of the memory oligonucleotide is obtained by 454 sequencing. In some embodiments, the sequence information of the memory oligonucleotide is obtained by Complete Genomics sequencing. In some embodiments, the sequence information of the memory oligonucleotide is obtained by Helicos sequencing. In some embodiments, the sequence information of the memory oligonucleotide is obtained by MinION sequencing. In some embodiments, the sequence information of the memory oligonucleotide is obtained by direct RNA sequencing. In some embodiments, the sequence information of the memory oligonucleotide is obtained by chain read sequencing. In some embodiments, the sequence information of the memory oligonucleotide is obtained by double-end sequencing. In some embodiments, the sequence information of the memory oligonucleotide is obtained by targeted gene sequencing.

[0251] Some embodiments include the gathering of information only from the subset of cycles.Some embodiments include the analysis of peptide information to all amino acids not including peptides, such as using sequencing information (e.g., memory oligonucleotides from the sequence formation of free recoding tags and cycle tags) not including all amino acids of peptides generated by the recoding process. In some embodiments, only some amino acids of protein are recoded as recoding blocks. Memory oligonucleotides can include all amino acids corresponding to peptides or only some amino acids of recoding blocks. When reconstructing peptides or identifying peptides, the amino acid information lost can be considered. Some memory oligonucleotides include recoding blocks with recoding tags and cycle tag sequences. Binder

[0252] In some embodiments, binding agents are disclosed herein. The binding agent may comprise a recoded tag and a binding moiety. The recoded tag may comprise a recoded nucleic acid. The binding agent may be used in the methods described herein, such as methods for determining protein information (such as amino acid location or identity).

[0253] In some embodiments, the binding moiety comprises a peptide. In some embodiments, the binding moiety comprises an antibody. In some embodiments, the antibody comprises a monoclonal antibody, a polyclonal antibody, an antibody fragment, an antibody derivative, a bispecific antibody, a nanobody or a single domain antibody. In some embodiments, the antibody comprises an antibody fragment containing Fab, F(ab')2 or scFv. In some embodiments, the binding moiety comprises an antibody derivative including an antibody-drug conjugate, a synthetic antibody, an antibody mimetic, an engineered protein binder including a DARPin or an affinity body, an aptamer, a ligand of a peptide receptor, a small molecule, a lectin, an enzyme substrate, an RNA molecule or a DNA molecule.

[0254] In some embodiments, the binding agent comprises an antibody. In some embodiments, the binding agent comprises a monoclonal antibody. In some embodiments, the binding agent comprises a polyclonal antibody. In some embodiments, the binding agent comprises an antibody fragment, such as Fab, F(ab')2 or scFv. In some embodiments, the binding agent comprises an antibody derivative, such as an antibody-drug conjugate. In some embodiments, the binding agent comprises a bispecific antibody. In some embodiments, the binding agent comprises a synthetic antibody or an antibody mimetic. In some embodiments, the binding agent comprises an aptamer. In some embodiments, the binding agent comprises a nanobody or a single domain antibody. In some embodiments, the binding agent comprises an engineered protein binding agent, such as a DARPin or an affinity body. In some embodiments, the binding agent comprises a peptide. In some embodiments, the binding agent comprises a ligand of a peptide receptor. In some embodiments, the binding agent comprises a small molecule. In some embodiments, the binding agent comprises a lectin. In some embodiments, the binding agent comprises an enzyme substrate. In some embodiments, the binding agent comprises an RNA molecule. In some embodiments, the binding agent comprises a DNA molecule.

[0255] In some embodiments, the binding agent further comprises a second label. In some embodiments, the second label comprises a fluorescent label for visualization, a biotin label for interaction with streptavidin, a radioactive label for detection, a quantum dot for visualization, a mass spectrometry-based detection label, a colorimetric label for visualization, a chemiluminescent label for detection, a photoacoustic imaging label, a single molecule imaging label, or a dual-modal imaging label.

[0256] In some embodiments, the binding agent is labeled with a second tag for visualization. In some embodiments, the binding agent is labeled with a fluorescent tag for visualization. In some embodiments, the binding agent is labeled with a biotin tag for subsequent interaction with streptavidin. In some embodiments, the binding agent is labeled with a radioactive tag for detection. In some embodiments, the binding agent is labeled with quantum dots for visualization. In some embodiments, the binding agent is labeled with a second tag for mass spectrometry-based detection. In some embodiments, the binding agent is labeled with a chromogenic tag for visualization. In some embodiments, the binding agent is labeled with a chemiluminescent tag for detection. In some embodiments, the binding agent is labeled with a second tag for photoacoustic imaging. In some embodiments, the binding agent is labeled with a second tag for single molecule imaging. In some embodiments, the binding agent is labeled with a second tag for dual-modality imaging.

[0257] In some embodiments, the binding moiety binds to any of the following amino acids: Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In some embodiments, the binding moiety binds to Ala. In some embodiments, the binding moiety binds to Arg. In some embodiments, the binding moiety binds to Asn. In some embodiments, the binding moiety binds to Asp. In some embodiments, the binding moiety binds to Cys. In some embodiments, the binding moiety binds to Gln. In some embodiments, the binding moiety binds to Glu. In some embodiments, the binding moiety binds to Gly. In some embodiments, the binding moiety binds to His. In some embodiments, the binding moiety binds to Ile. In some embodiments, the binding moiety binds to Leu. In some embodiments, the binding moiety binds to Lys. In some embodiments, the binding moiety binds to Met. In some embodiments, the binding moiety binds to Phe. In some embodiments, the binding moiety binds to Pro. In some embodiments, the binding moiety binds to Ser. In some embodiments, the binding moiety binds to Thr. In some embodiments, the binding moiety binds Trp. In some embodiments, the binding moiety binds Tyr. In some embodiments, the binding moiety binds Val. In some embodiments, the binding moiety binds a combination of any of the above amino acids. A variety of binding agents can be used, wherein each binding agent has a binding moiety that binds a different amino acid and has a different recoding tag corresponding to the different amino acids. A variety of binding agents can be used, wherein each binding agent has a binding moiety that binds multiple amino acids, groups of amino acids, or slightly preferentially binds some amino acids compared to other amino acids. A variety of binding agents can be used, wherein the binding agents have a combination of properties, including some binding to different amino acids and other binding to groups of amino acids.

[0258] In some embodiments, the binding moiety binds to a dipeptide. In some embodiments, the binding moiety binds to a tripeptide. In some embodiments, the binding moiety binds to any of the following: a natural amino acid, a post-translationally modified (PTM) amino acid, a derivative form of an amino acid, a derivative or stabilized form of a post-translationally modified amino acid, a synthetic amino acid, an amino acid with a specific side chain, an amino acid with a phosphorylated side chain, an amino acid with a glycosylated side chain, an amino acid with a methylated modification, or a D-amino acid. In some embodiments, the binding moiety binds to a combination of any of the above amino acids. In some embodiments, the binding moiety binds to an amino acid group. For example, the binding moiety can bind to a plurality of many amino acids, such as all positively charged, or a phosphorylated PTM. In some embodiments, the binding moiety has a weak specificity for an amino acid or an amino acid group. For example, in some embodiments, the binding moiety has only a slight preference for one amino acid or amino acid group relative to another amino acid or amino acid group. In some embodiments, PTMs such as phosphotyrosine, phosphothreonine, or phosphoserine are recognized. The binding moiety can bind to a phosphorylated amino acid. The binding moiety can bind to a glycosylated amino acid. The binding moiety can bind to a methylated amino acid. The binding moiety can bind to an ubiquitinated amino acid. A plurality of different binding moieties can be used in a plurality of binding agents, and each binding agent can comprise a recoded tag corresponding to each of the plurality of different binding moieties. The binding moieties can bind to a derivative or stabilized form of an amino acid, a post-translationally modified amino acid, or other natural or synthetic amino acid. The binding moieties can bind to an amino acid that has undergone SUMOylation, prenylation, nitrosylation, sulfation, ADP-ribosylation, palmitoylation, myristoylation, carboxylation, hydroxylation, or other modification. The binding moieties can bind to groups or classes of amino acids that are modified or have similar modifications. For example, the binding moieties can bind to a group, such as any amino acid with a certain PTM, such as all phosphorylated amino acids. Solid support

[0259] In some embodiments, solid supports are disclosed herein. Peptides can be coupled to solid supports. Chemically reactive conjugates can be bound to solid supports. Solid supports can be used in methods described herein, such as methods for determining protein information (such as amino acid location or identity).

[0260] In some embodiments, the solid support includes beads, plates or chips. In some embodiments, the solid support includes glass slides, silica, resins, gels, films, polystyrene, metals, nitrocellulose, minerals, plastics, polyacrylamide, latex or ceramics. In some embodiments, the solid support includes magnetic beads, glass slides, microarray chips, nanoparticles, silica gel, resins, polystyrene beads, gold plates, silicon chips, nitrocellulose membranes, quartz slides, porous plates, cellulose paper, agarose beads, plastic beads, polyacrylamide gels, magnetic nanoparticles, latex beads or ceramic beads. In some embodiments, the solid support is contained in a flow cell or in a well plate.

[0261] In some embodiments, the solid support is a bead, a plate or a chip. In some embodiments, the solid support is a magnetic bead. In some embodiments, the solid support is a glass slide. In some embodiments, the solid support is a microarray chip. In some embodiments, the solid support is a nanoparticle. In some embodiments, the solid support is a silica gel. In some embodiments, the solid support is a resin. In some embodiments, the solid support is a polystyrene bead. In some embodiments, the solid support is a gold plate. In some embodiments, the solid support is a silicon chip. In some embodiments, the solid support is a nitrocellulose membrane. In some embodiments, the solid support is a quartz slide. In some embodiments, the solid support is a porous plate. In some embodiments, the solid support is cellulose paper. In some embodiments, the solid support is agarose beads. In some embodiments, the solid support is a plastic bead. In some embodiments, the solid support is a polyacrylamide gel. In some embodiments, the solid support is a magnetic nanoparticle. In some embodiments, the solid support is a latex bead. In some embodiments, the solid support is a ceramic bead. In some embodiments, the solid support is contained within a flow cell. In some embodiments, the solid support is contained within a well plate.

[0262] In some embodiments, the solid support comprises beads, plates, chips, polymers, metals, or glass. In some embodiments, the solid support is a bead. In some embodiments, the solid support is a plate. In some embodiments, the solid support is a chip. In some embodiments, the solid support is composed of a polymer. In some embodiments, the solid support is composed of a metal. In some embodiments, the solid support is composed of glass. Peptides

[0263] In some embodiments, peptides are disclosed herein. The peptides can be the subject of methods seeking to obtain information about the peptides, such as information about the identity or location of one or more amino acids of the peptides. The peptides can be included in methods described herein, such as methods for determining protein information (such as amino acid location or identity).

[0264] In some embodiments, the peptide comprises a polypeptide or a protein. In some embodiments, the peptide comprises a hormone, a neurotransmitter, an enzyme, an antibody, a viral protein, a bacterial protein, a synthetic peptide, a biologically active peptide, a peptide hormone, an oligopeptide, a polypeptide, a fusion protein, a cyclic peptide, a branched peptide, a recombinant protein, a tumor marker, a therapeutic peptide, an antigenic peptide, or a signaling peptide.

[0265] In some embodiments, the peptide is a polypeptide or protein. In some embodiments, the peptide is a hormone. In some embodiments, the peptide is a neurotransmitter. In some embodiments, the peptide is an enzyme. In some embodiments, the peptide is an antibody. In some embodiments, the peptide is a viral protein. In some embodiments, the peptide is a bacterial protein. In some embodiments, the peptide is a synthetic peptide. In some embodiments, the peptide is a biologically active peptide. In some embodiments, the peptide is a peptide hormone. In some embodiments, the peptide is an oligopeptide. In some embodiments, the peptide is a polypeptide. In some embodiments, the peptide is a fusion protein. In some embodiments, the peptide is a cyclic peptide. In some embodiments, the peptide is a branched peptide. In some embodiments, the peptide is a recombinant protein. In some embodiments, the peptide is a tumor marker. In some embodiments, the peptide is a therapeutic peptide. In some embodiments, the peptide is an antigenic peptide. In some embodiments, the peptide is a signaling peptide.

[0266] In some embodiments, disclosed herein is a peptide coupled to a solid support. In some embodiments, the peptide is coupled to a solid support so that the N-terminal amino acid residue of the peptide is not directly coupled to the solid support. For example, the peptide can be directly coupled to the solid support by the C-terminal amino acid residue, or can be directly coupled to the solid support by internal (e.g., non-N-terminal and non-C-terminal) amino acid residues. In some embodiments, the N-terminal of the peptide is indirectly connected or coupled to the solid support via other amino acids of the peptide chain.

[0267] In some embodiments, the peptide is coupled to a solid support so that the N-terminal amino acid residue is exposed to reaction conditions. For example, the N-terminal amino acid residue can be on the outside of the peptide. In some embodiments, the N-terminal amino acid residue exposed to reaction conditions is exposed to a solvent.

[0268] In some embodiments, the peptide is derived from humans, plants, bacteria, fungi, animals, viruses, mammals, birds, marine organisms, insects, reptiles, amphibians, synthetic sources, protists, yeast, primates, cell cultures, parasites, patient samples, environmental samples, or genetically modified organisms.

[0269] In some embodiments, the peptide is derived from a cell lysate, a blood sample, a plasma sample, a serum sample, a tissue biopsy, a saliva sample, a urine sample, a cerebrospinal fluid sample, a sweat sample, a synovial fluid sample, a stool sample, a gut microbiome sample, an environmental water sample, a soil sample, a bacterial culture, a viral culture, an organoid, a tumor biopsy, a sputum sample, or a hair sample.

[0270] In some embodiments, the peptides are derived from humans. In some embodiments, the peptides are derived from plants. In some embodiments, the peptides are derived from bacteria. In some embodiments, the peptides are derived from fungi. In some embodiments, the peptides are derived from animals. In some embodiments, the peptides are derived from viruses. In some embodiments, the peptides are derived from mammals. In some embodiments, the peptides are derived from birds. In some embodiments, the peptides are derived from marine organisms. In some embodiments, the peptides are derived from insects. In some embodiments, the peptides are derived from reptiles. In some embodiments, the peptides are derived from amphibians. In some embodiments, the peptides are derived from synthetic sources. In some embodiments, the peptides are derived from protists. In some embodiments, the peptides are derived from yeast. In some embodiments, the peptides are derived from primates. In some embodiments, the peptides are derived from cell cultures. In some embodiments, the peptides are derived from parasites. In some embodiments, the peptides are derived from patient samples. In some embodiments, the peptides are derived from environmental samples. In some embodiments, the peptides are derived from genetically modified organisms.

[0271] In some embodiments, the peptides are derived from cell lysates. In some embodiments, the peptides are derived from plasma samples. In some embodiments, the peptides are derived from tissue biopsies. In some embodiments, the peptides are derived from serum samples. In some embodiments, the peptides are derived from saliva samples. In some embodiments, the peptides are derived from urine samples. In some embodiments, the peptides are derived from cerebrospinal fluid samples. In some embodiments, the peptides are derived from sweat samples. In some embodiments, the peptides are derived from synovial fluid samples. In some embodiments, the peptides are derived from fecal samples. In some embodiments, the peptides are derived from intestinal microbiome samples. In some embodiments, the peptides are derived from environmental water samples. In some embodiments, the peptides are derived from soil samples. In some embodiments, the peptides are derived from bacterial cultures. In some embodiments, the peptides are derived from viral cultures. In some embodiments, the peptides are derived from organoids. In some embodiments, the peptides are derived from tumor biopsies. In some embodiments, the peptides are derived from sputum samples. In some embodiments, the peptides are derived from hair samples.

[0272] In some embodiments, the peptide is associated with a disease state. In some embodiments, the peptide is associated with a cancer disease state, an autoimmune disease state, a neurodegenerative disease state, a cardiovascular disease state, a metabolic disease state, a genetic disease state, a viral infection, a bacterial infection, a fungal infection, a parasitic infection, an inflammatory condition, an endocrine disorder, an immunodeficiency, a respiratory disorder, a skin disorder, a gastrointestinal disorder, a psychiatric disorder, the aging process, a muscle disorder, or a kidney disorder.

[0273] In some embodiments, the peptides are associated with specific disease states. In some embodiments, the peptides are associated with cancer disease states. In some embodiments, the peptides are associated with autoimmune disease states. In some embodiments, the peptides are associated with neurodegenerative disease states. In some embodiments, the peptides are associated with cardiovascular disease states. In some embodiments, the peptides are associated with metabolic disease states. In some embodiments, the peptides are associated with genetic disease states. In some embodiments, the peptides are associated with viral infections. In some embodiments, the peptides are associated with bacterial infections. In some embodiments, the peptides are associated with fungal infections. In some embodiments, the peptides are associated with parasitic infections. In some embodiments, the peptides are associated with inflammatory conditions. In some embodiments, the peptides are associated with endocrine disorders. In some embodiments, the peptides are associated with immunodeficiency. In some embodiments, the peptides are associated with respiratory disorders. In some embodiments, the peptides are associated with skin disorders. In some embodiments, the peptides are associated with gastrointestinal disorders. In some embodiments, the peptides are associated with mental disorders. In some embodiments, the peptides are associated with the aging process. In some embodiments, the peptides are associated with muscle disorders. In some embodiments, the peptides are associated with kidney disorders.

[0274] In some embodiments, the peptide is a biomarker for a disease or condition, a drug target for a disease or condition, an antigen for developing a vaccine, for patient stratification in clinical trials, a therapeutic for a disease or condition, for producing a biosimilar or generic drug, for evaluating the efficacy of a drug treatment, for personalized medicine for a specific disease or condition, for immuno-oncology research, for validation of diagnostic tests, for developing peptide-based therapeutics, a component of a cell signaling pathway, for structure-activity relationship studies, for developing immunoassays, for studying protein-protein interactions, for designing drug delivery systems, for high throughput screening assays, for pharmacokinetic studies, for formulating nutraceuticals, for developing probiotic products, or for proteomics studies.

[0275] In some embodiments, the peptide is a biomarker for a disease or condition. In some embodiments, the peptide is a drug target for a specific disease or condition. In some embodiments, the peptide is an antigen for developing a vaccine. In some embodiments, the peptide is used for patient stratification in clinical trials. In some embodiments, the peptide is a therapeutic agent for a specific disease or condition. In some embodiments, the peptide is used to produce a biosimilar or generic drug. In some embodiments, the peptide is used to evaluate the efficacy of drug therapy. In some embodiments, the peptide is used for personalized medicine for a specific disease or condition. In some embodiments, the peptide is used for immuno-oncology research. In some embodiments, the peptide is used for validation of diagnostic tests. In some embodiments, the peptide is used to develop a peptide-based therapeutic agent. In some embodiments, the peptide is a component of a cell signaling pathway. In some embodiments, the peptide is used for structure-activity relationship research. In some embodiments, the peptide is used to develop an immunoassay. In some embodiments, the peptide is used for the study of protein-protein interactions. In some embodiments, the peptide is used for the design of a drug delivery system. In some embodiments, the peptide is used for high-throughput screening assays. In some embodiments, the peptide is used for pharmacokinetic studies. In some embodiments, the peptide is used for the formulation of nutraceutical products. In some embodiments, the peptides are used to develop probiotic products.In some embodiments, the peptides are used in proteomics studies. Deprotection and reprotection of oligonucleotides

[0276] In some embodiments, disclosed herein are methods comprising protection and / or deprotection. For example, some embodiments comprise Fig.28 Any or all of the aspects shown in . Some embodiments include continuous repetitions of deprotecting and reprotecting oligonucleotides during protein sequencing methods to minimize the effects of peptide cleavage chemistry on the molecular structure of the oligonucleotides. Protection, deprotection or reprotection can be used in methods described herein, such as methods for determining protein information (such as amino acid sequence, identity or location).

[0277] Some embodiments include the following method, the method includes protecting and deprotecting the oligonucleotide continuously. Continuous protection and deprotection can alleviate DNA damage. Some embodiments include the method of protecting and deprotecting the oligonucleotide cycle directly or indirectly bound to the solid support in the presence of a peptide directly or indirectly bound to the solid support. This can be used to alleviate DNA damage during the biochemistry subsequent to the degradation of the cyclic n-terminal of the peptide and each cycle. Some embodiments include the method for protecting and deprotecting the oligonucleotide cycle in a peptide sequencing method, wherein the nucleic acid is not directly or indirectly bound to the solid support.

[0278] Any or all of the following steps may be included within the peptide sequencing methods described herein: (1) deprotecting oligonucleotides associated with cyclic or amino acid or peptide identities to enable polymerization, ligation or DNA manipulation by enzymes known in the art to modify, extend, amplify, transform or ligate DNA (2) reprotecting the oligonucleotide; (3) Cleavage of terminal amino acid (4) Repeat

[0279] Cleavage can be performed with a chemically reactive conjugate (CRC).In some aspects, protection and deprotection of serial repeats of an oligonucleotide is performed in the context of a protein sequencing protocol (eg, within a protein sequencing method, or within a barcode generation and / or detection method).

[0280] In some embodiments, the protection and deprotection steps can be iterated. The circulating tags can be deprotected. In some embodiments, the positioning oligonucleotides can be protected, deprotected and / or reprotected.

[0281] Oligonucleotides can be protected using protection chemistry developed for phosphoramidite oligonucleotide synthesis and utilized during this period. These blocking groups can tolerate anhydrous TCA as the key of synthesis. For example, N (6)-benzoyl A, N (4)-benzoyl C and N (2)-isobutyryl G can be used during DNA synthesis, and may be suitable for protection in protein sequencing methods. In addition, removable blocking groups under mild alkaline conditions can be used, for example, dA protected by phenoxyacetyl (Pac) and dG protected by 4-isopropyl-phenoxyacetyl (iPr-Pac), and dC protected by acetyl. As a non-limiting example, protecting independent bases A, G and C can be achieved by acylation reaction with suitable acyl chlorides. The specific acyl chlorides used can be benzoyl chloride for adenine and cytosine, isobutyryl chloride for guanine. Solutions of benzoyl chloride in a solvent such as dimethylformamide (DMF) and solutions of isobutyl chloride in DMF can be prepared and applied to reprotect the oligonucleotide bound to the solid support. In some embodiments, thymine is not protected, but can be protected if desired, for example using diphenylcarbamoyl chloride.

[0282] In some embodiments, methods are disclosed herein, comprising: (a) protecting an oligonucleotide of a binding or reactive molecule; (b) contacting the molecule with the N-terminus of a peptide bound to a solid support; (c) cleaving one or more amino acid residues from the peptide; (d) deprotecting the oligonucleotide of the binding or reactive molecule; (e) contacting the deprotected oligonucleotide with one or more reagents to transfer information by enzyme ligation, polymerase extension, chemical ligation. Some embodiments include repeating any of the above steps. The chemically reactive substance may include a chemically reactive conjugate as described herein.

[0283] In some embodiments, methods are disclosed herein, comprising: (a) protecting an oligonucleotide conjugated to a peptide; (b) contacting the N-terminus of the peptide with one or more reagents to cleave one or more amino acid residues from the peptide; (c) deprotecting the oligonucleotide bound to the peptide; (d) contacting the deprotected oligonucleotide with one or more reagents to transfer information by enzyme ligation, polymerase extension, chemical ligation. Some embodiments include repeating any of the above steps. The chemically reactive substance may include a chemically reactive conjugate as described herein.

[0284] In some embodiments, methods are disclosed herein, comprising: (a) protecting an oligonucleotide associated with the location or identity of a peptide; (b) contacting the N-terminus of the peptide with one or more reagents to cleave one or more amino acid residues from the peptide; (c) deprotecting the oligonucleotide bound to the peptide; (d) contacting the deprotected oligonucleotide with one or more reagents to transfer information by enzyme ligation, polymerase extension, chemical ligation. Some embodiments include repeating any of the above steps. The chemically reactive species may include a chemically reactive conjugate as described herein.

[0285] In some embodiments, methods are disclosed herein, comprising: (a) protecting an oligonucleotide coupled to a solid support; (b) binding a chemically reactive substance to the terminal amino acid of a peptide coupled to a solid support; (c) deprotecting the oligonucleotide; (d) reacting a reagent with the oligonucleotide; and (e) reprotecting the oligonucleotide. Some embodiments include cleaving the terminal amino acid of the peptide after reprotecting the oligonucleotide. Some embodiments include deprotecting the oligonucleotide after cleaving the terminal amino acid of the peptide, and then reacting a second reagent with the oligonucleotide. Some examples include washing steps before or after (a), (b), (c), (d), or (e). Washing can include replacing a solution, removing excess reagents or solutions. In some embodiments, any of the above steps (e.g., step (e)) or a combination of the steps can be optional.

[0286] In some embodiments, methods are disclosed herein, comprising: (a) protecting an oligonucleotide coupled to a solid support; (b) cleaving the terminal amino acid of a peptide coupled to a solid support; (c) deprotecting the oligonucleotide; (d) reacting a reagent with the oligonucleotide; and (e) reprotecting the oligonucleotide. Some embodiments include binding a chemically reactive substance to the terminal amino acid of the peptide after reprotecting the oligonucleotide. Some embodiments include deprotecting the oligonucleotide after binding a chemically reactive substance to the terminal amino acid of the peptide, and then reacting a second reagent with the oligonucleotide. Some examples include washing steps before or after (a), (b), (c), (d), or (e). Washing can include replacing a solution, removing excess reagents or solutions. In some embodiments, any of the above steps (e.g., step (e)) or a combination of the steps may be optional.

[0287] Some embodiments relate to a method. The method may include providing a conjugate comprising a reactive molecule coupled to a protected oligonucleotide. The method may include contacting the reactive moiety with the terminal amino acid of the peptide, for example, so that the reactive moiety is bound to the terminal amino acid. The method may include optionally cutting the terminal amino acid from the peptide. The method may include deprotecting the oligonucleotide. The method may include contacting the deprotected oligonucleotide with an enzyme or reagent for connection or polymerization. In some embodiments, methods are disclosed herein, comprising: providing a conjugate comprising a reactive molecule coupled to a protected oligonucleotide; contacting the reactive moiety with the terminal amino acid of the peptide, so that the reactive moiety is bound to the terminal amino acid, and optionally cutting the terminal amino acid from the peptide; deprotecting the oligonucleotide; and contacting the deprotected oligonucleotide with an enzyme or reagent for connection or polymerization. Some embodiments include reprotecting the oligonucleotide. In some embodiments, the reactive moiety cuts the terminal amino acid from the peptide to expose the next terminal amino acid, and wherein the method further includes contacting the next amino acid with another conjugate after reprotecting the oligonucleotide. In some embodiments, the terminal amino acid is an N-terminal amino acid. In some embodiments, the peptide is fixed to a solid support. In some embodiments, the conjugate comprises an organic small molecule. In some embodiments, the conjugate comprises a chemically reactive conjugate (CRC) comprising: (A) an oligonucleotide; (B) a reactive portion; and (C) an immobilization portion. In some embodiments, the oligonucleotide comprises a circulating nucleic acid.

[0288] Some embodiments relate to a method. The method may include providing a conjugate comprising a peptide coupled to a protected oligonucleotide. The method may include contacting the terminal amino acid of the peptide, for example, so that the reactive portion is bound to the terminal amino acid. The method may include optionally cutting the terminal amino acid from the peptide. The method may include deprotecting the oligonucleotide. The method may include contacting the deprotected oligonucleotide with an enzyme or reagent for connection or polymerization. In some embodiments, methods are disclosed herein, comprising: providing a conjugate comprising a peptide coupled to a protected oligonucleotide; contacting the terminal amino acid of the peptide so that the reactive portion is bound to the terminal amino acid, and optionally cutting the terminal amino acid from the peptide; deprotecting the oligonucleotide; and contacting the deprotected oligonucleotide with an enzyme or reagent for connection or polymerization. Some embodiments include reprotecting the oligonucleotide. In some embodiments, the reactive portion cuts the terminal amino acid from the peptide to expose the next terminal amino acid, and wherein the method further includes contacting the next amino acid with another conjugate after reprotecting the oligonucleotide. In some embodiments, the terminal amino acid is an N-terminal amino acid. In some embodiments, the peptide is fixed to a solid support. In some embodiments, the conjugate comprises a small organic molecule. Subset Sequencing

[0289] Disclosed herein is a method for sequencing a subset of nucleotides or nucleotides, or excluding a subset of nucleotides or nucleotides from sequencing. The method for sequencing a subset of nucleotides can be included as a part of a method for determining protein information (such as amino acid sequence, identity or positioning). The method can be used in different methods related to DNA sequencing. In some embodiments, only a subset of nucleotides is sequenced. In some embodiments, some nucleotides are not sequenced. For example, in some embodiments, only two nucleotides of a sequence (such as A and C) are sequenced, and other nucleotides are not sequenced. This can reduce sequencing costs because it reduces the demand for sequencing reagents.

[0290] When oligonucleotides are needed to work during physiological and chemical activities (such as primers or spacer oligonucleotides for PCR) and for storing information, subset sequencing may be particularly useful. In some embodiments, the nucleotides of the sequence that works during physiological and chemical activities provide redundant storage information. Aspects such as barcode nucleic acids or re-encoded nucleic acids can include nucleotides such as A, G, C and T, and the information content of physiological and chemical functional sequences can be represented by a subset of nucleotides (such as A and C, or T and G). In some embodiments, re-encoding tags, cycle tags and / or re-encoding block nucleic acids include sequences that can be used to obtain. In some aspects, this information can be obtained by sequencing a subset of nucleotides that constitute the nucleic acid. When sequencing an oligonucleotide containing redundant information, a subset of nucleotides can be skipped during sequencing.

[0291] In some embodiments, disclosed herein is a method for sequencing a subset of nucleotides of an oligonucleotide. The method may include (a) providing a combination of reversibly terminated nucleotides and non-reversibly terminated nucleotides in a nucleic acid sequencing reaction. In some embodiments, the reversibly terminated nucleotides are fluorescent. In some embodiments, the non-reversibly terminated nucleotides are fluorescent. In some embodiments, the nucleotides corresponding to the non-reversibly terminated nucleotides in the sequenced nucleic acid are not sequenced. In some embodiments, only a subset of the nucleotides of the nucleic acid is sequenced. In some embodiments, a subset of the nucleotides of the nucleic acid is excluded from sequencing. The method may include providing a combination of reversibly terminated nucleotides and non-reversibly terminated nucleotides in a nucleic acid sequencing reaction, wherein the nucleotides corresponding to the non-reversibly terminated nucleotides in the sequenced nucleic acid are not sequenced. The method may include identifying the nucleotides corresponding to the reversibly terminated nucleotides in the sequenced nucleic acid. In some embodiments, the sequenced nucleic acid comprises a region comprising only a subset of nucleotides selected from A, C, G and T, and wherein the subset of the nucleotides is not sequenced. In some embodiments, the subset of nucleotides selected from A, C, G, and T comprises 2 nucleotides selected from A, C, G, and T. In some embodiments, the subset of nucleotides selected from A, C, G, and T comprises 3 nucleotides selected from A, C, G, and T. In some embodiments, the region comprises a primer sequence. In some embodiments, the region does not comprise a barcode sequence, a recoded nucleic acid sequence or a portion thereof, or a circular nucleic acid sequence or a portion thereof. The unsequenced region may comprise 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 500, 750, 1000 or more nucleotides, or a range of nucleotides defined by any two or more of the foregoing integers. The sequenced portion can comprise 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 500, 750, 1000 or more nucleotides, or a range of nucleotides bounded by any two or more of the foregoing integers.

[0292] In some embodiments, the subset includes a combination of A, G, C, or T. In some embodiments, the subset of nucleotide components identified by DNA sequencing is 2 of the 4 natural nucleotides (e.g., 2 of A, G, C, and T). The subset may include A and G, A and C, A and T, G and C, G and T, or C and T. The subset may exclude A and G, A and C, A and T, G and C, G and T, or C and T. In some embodiments, the subset of nucleotides identified by DNA sequencing is A and C.

[0293] In some embodiments, the sequenced subset includes all four natural nucleotides, wherein non-natural nucleotides are incorporated and not sequenced and are skipped by non-reversibly terminating nucleotides.

[0294] In some embodiments, the subset of nucleotide components identified by DNA sequencing is 3 of the 4 natural nucleotides (e.g., 3 of A, G, C, and T). The subset may include A, G, and C; A, G, and T; A, C, and T; or G, C, and T. The subset may exclude A, G, and C; A, G, and T; A, C, and T; or G, C, and T.

[0295] A subset of nucleotides can be sequenced using modified nucleotides (e.g., dideoxynucleoside triphosphates (ddNTPs), as can be used in Sanger sequencing). The modified nucleotides can include reversible termination chemistry. The modified nucleotides can include dyes or labels, such as fluorescent dyes or labels. Modified nucleotides can be provided in a sequencing reaction. In some embodiments, other nucleotides not included in the subset are not sequenced (e.g., skipped). Nucleotides not included in the subset can exclude modification. For example, unmodified nucleotides corresponding to nucleotides skipped or not included in the subset can be used in a sequencing reaction mixture.

[0296] In some embodiments, disclosed herein are methods that may include sequencing a subset of nucleotides of an oligonucleotide molecule, the method comprising: (a) providing a solution comprising an oligonucleotide to be sequenced; (b) providing a sequencing reagent comprising one or more nucleotides as a predominantly reversibly terminated nucleotide and one or more nucleotides as a predominantly non-terminated nucleotide; (c) preparing (a) for sequencing according to a protocol of a sequencing system; (d) sequencing the prepared solution of (a) using the sequencing reagent of (b) as at least one component of the sequencing reagent for at least one DNA sequencing cycle; and (e) obtaining the sequence order of the subset of nucleotides in the initial oligonucleotide sequence. In some embodiments, the oligonucleotide has been designed to contain information about the composition of a peptide or amino acids from a peptide. In some embodiments, the oligonucleotide is a memory oligonucleotide, a recoding tag, a recoding block, or a cycle tag. In some embodiments, the oligonucleotide is derived from a protein sequencing method that produces barcoded nucleic acid information representing a protein sequence and / or a protein identity. In some embodiments, the oligonucleotide is any nucleic acid sequence that embodies information related to a peptide or amino acid sequence or composition. In some embodiments, the information of memory oligonucleotide is obtained via DNA sequencing of a subset of nucleotides constituting memory oligonucleotide. In some embodiments, any suitable subset of nucleotides is identified by DNA sequencing process. In some embodiments, DNA sequencing method is next generation sequencing (NGS). In some embodiments, DNA sequencing is a sequencing method while synthesis using Illumina sequencer or PacBio sequencer. In some embodiments, DNA sequencing is carried out by using a connection method, a sequence hybridization method and / or a connection-based method. In some embodiments, the subset of nucleotides identified by DNA sequencing is A and C. In some embodiments, the subset of nucleotide components identified by DNA sequencing is 2 of 4 natural nucleotides. In some embodiments, the subset is one of the combinations of A, G, C or T. Some embodiments include introducing non-fluorescent, non-reversibly terminated nucleotides into NGS sequencing reagent mixtures. In some embodiments, the nucleotides in the oligonucleotides are natural nucleotides (e.g., A, C, G and / or T). In some embodiments, the nucleotides in the oligonucleotides include non-natural nucleotides.

[0297] In some embodiments, disclosed herein is a method for analyzing one or more peptides from a sample containing a plurality of peptides, proteins, and / or protein complexes, the method comprising: (a) designing oligonucleotides comprising 2, 3, 4, 5, 6 or more different types of nucleotide components and using a subset of the nucleotide components to represent cycle, amino acid, positioning, and / or protein information; (b) utilizing the physicochemical properties of the designed oligonucleotides within a protein sequencing method, as may be described herein; (c) collecting DNA sequence information of nucleotides representing protein information; and (d) analyzing the DNA sequence information of a subset of nucleotides to infer protein information. In some embodiments, the oligonucleotide is a memory oligonucleotide, a recoding tag, a recoding block, or a cycle tag. In some embodiments, the oligonucleotide is derived from a protein sequencing method that produces barcoded nucleic acid information representing a protein sequence and / or protein identity. In some embodiments, the oligonucleotide is any nucleic acid sequence that embodies information related to a peptide or amino acid sequence or composition. In some embodiments, the information of the memory oligonucleotide is obtained via DNA sequencing of a subset of nucleotides that constitute the memory oligonucleotide. In some embodiments, the DNA sequencing method is NGS. In some embodiments, DNA sequencing is a sequencing-by-synthesis method using an Illumina sequencer or a PacBio sequencer. In some embodiments, DNA sequencing is performed by using a connection method, a sequence hybridization method, and / or a connection-based method. In some embodiments, a subset of nucleotides identified by DNA sequencing is A and C. In some embodiments, a subset of nucleotide components identified by DNA sequencing is 2 of 4 natural nucleotides. In some embodiments, the subset is one of a combination of A, G, C, or T. In some embodiments, any suitable subset of nucleotides is identified by a DNA sequencing process. In some embodiments, the method includes introducing non-fluorescent, non-reversibly terminated nucleotides into an NGS sequencing reagent mixture.

[0298] In some embodiments, disclosed herein is an SBS sequencing reagent mixture.Some embodiments include an SBS sequencing reagent mixture comprising one or more nucleotides that are predominantly reversibly terminating nucleotides and one or more nucleotides that are predominantly non-terminating nucleotides. Chemically reactive conjugates

[0299] In some embodiments, disclosed herein are chemically reactive conjugates (CRCs). CRCs can be used in methods described herein, such as methods for determining protein information (such as amino acid sequence, identity, or location). Chemically reactive conjugates (CRCs) can include nucleic acid sequence tags. Chemically reactive conjugates can include reactive moieties. The reactive moieties can bind to and cleave the N-terminal amino acid residue of a peptide. Chemically reactive conjugates can include fixed moieties. The fixed moieties can bind to a solid support and can therefore be used to be fixed to a solid support. Chemically reactive conjugates can include (A) a circulating tag; (B) a reactive moiety for binding to and cleaving the N-terminal amino acid residue of a peptide; and (C) a fixed moiety for fixing to a solid support.

[0300] CRC can contain the following structures: CRC can contain the following structures: The CRC may comprise the structure of Formula I or Formula II, or any suitable structure linking A, B, and C. In either formula, A is or comprises a circulating tag, B is or comprises a reactive moiety (e.g., for binding and cleaving the N-terminal amino acid residue of the peptide), and C is or comprises an immobilization moiety (e.g., for immobilization to a solid support). A , L B and L C is an optional linker in Formula I. In addition, in Formula I, Can contain center section. AB and L BC is an optional linker in Formula II. Additional arms or aspects may be included or added to Formula I or Formula II.

[0301] The chemically reactive conjugate may include a central portion. The central portion may be or include a central carbon. The central carbon may be attached to other carbons, such as attached to 3 other carbons, and connected to the arms of the chemically reactive conjugate. The central portion may include a heterocycle, a carbocycle, or a trivalent nitrogen. The trivalent nitrogen may include an amine. The amine may include a tertiary amine. The central portion may include trivalent boron, trivalent or higher valent phosphorus, tetravalent silicon, caged polysilsesquioxane (POSS), siloxane, branched siloxane, polyether, phosphazene, phosphonium, ammonium, imidazolium, methane, propane, butane, pentane, hexane, C1-C24 alkyl, benzene, toluene, xylene, phenol, N,N-disubstituted aniline, anisole, trihydroxybenzene, trimesic acid, phthalic acid, trimesic acid, cyclopropane, glycol, glycerol, ethylene glycol, oligoethylene glycol, branched oligoethylene glycol, Multi-arm oligoethylene glycol, dendrimer, propylene glycol, oligopropylene glycol, trimethylolpropane, pentaerythritol, dipentaerythritol, sugar, glycoside, sugar, glucose, fructose, furanose, galactose, mannose, cyclohexane, cyclooctane, cycloheptane, cyclopentane, cyclobutene, cyclononane, cyclohexene, cyclobutene, cyclopentene, cyclooctene, cyclononane, adamantane, naphthalene, anthracene, pyrene, annulene, pyridine, N-substituted piperidine, N,N-disubstituted piperazine, thiophene, indole, pyrazine, isoquinoline, pyran, furan furan, pyrimidine, purine, oxazole, benzofuran, carbazole, xanthene, coumarin, oxazine, benzothiophene, benzoxazole, acridine, dibenzofuran, fluorene, N-substituted azapine, N-substituted azine, thiocane, N-substituted azacyclononane, spirocyclic compound, indolizine, benzimidazole, isoindole, azoindole, cyclotrisiloxane, cyclotetrasiloxane, polycyclic aromatic hydrocarbons, olefins, biphenyl, terphenyl, triphenyl Methane, decalin, phenanthrene, phosphonate, trisubstituted phosphine, phosphonic acid, phosphite, borate, norbornene, oxa-norbornene, norbornene, oxa-norbornene, dioxane, di-tertiary amine, tri-tertiary amine, tetra-tertiary amine, amide, N,N-dialkylamide, sulfonamide, phosphoramide, phthalimide, gallate, ether, thioether, sulfamide, mesitylene, carboxylic acid functional molecule, diene, cyanurate, guanidine, urea, substituted urea, thiourea, hydrazone, oxime, dibenzocyclooctene, triazole, or ester. The central part can be joined to the A, B and C elements of the chemically reactive conjugate.

[0302] In some embodiments, chemically reactive conjugates are prepared by organic synthesis methods. Some examples of multi-component reaction schemes are shown in Figure 29-32B middle.

[0303] In some embodiments, disclosed herein are chemically reactive conjugates comprising (A) a circulating tag; (B) a reactive moiety; and (C) a fixed moiety. In some embodiments, (A), (B), and (C) are linearly oriented relative to each other. In some embodiments, (A), (B), and (C) are oriented in any of the following order: (A)-(B)-(C) (such as Formula II), (A)-(C)-(B), or (B)-(A)-(C). In some embodiments, (A), (B), and (C) are linearly similar to Formula II, and an optional linker is included between (A), (B), and (C), but in the following order: (A)-(C)-(B). In some embodiments, (A), (B), and (C) are linearly similar to Formula II, and an optional linker is included between (A), (B), and (C), but in the following order: (B)-(A)-(C). In some embodiments, each of (A), (B), and (C) are on separate arms relative to each other.

[0304] In some embodiments, the CRC is linear in the order of (A)-(B)-(C). In some embodiments, the CRC is linear in the order of (A)-(C)-(B). In some embodiments, the CRC is linear in the order of (B)-(A)-(C). In some embodiments, each of (A), (B), and (C) of the CRC is on an independent arm.

[0305] Some embodiments include a cleavable group between (A) and (B), between (B) and (C), between (A) and (C), between (A) and (B+C), between (B) and (A+C), or between (C) and (A+B), or any combination thereof. Some embodiments include a cleavable group between (A) and (B). Some embodiments include a cleavable group between (B) and (C). Some embodiments include a cleavable group between (A) and (C). Some embodiments include a cleavable group between (A) and (B+C). Some embodiments include a cleavable group between (C) and (A+C). Some embodiments include a cleavable group between (C) and (A+B).

[0306] Some embodiments include non-nucleic acid labels (e.g., element A). In some embodiments, detectable labels include fluorophores, radioactive labels, isotope labels, mass labels, chemiluminescent labels, or imaging labels. Some embodiments include detectable labels. In some embodiments, detectable labels are fluorophores. In some embodiments, detectable labels are radioactive labels.

[0307] In some embodiments, the CRC comprises a precursor nucleic acid sequence tag, and the tag comprises a group for attaching a nucleic acid sequence. In some embodiments, the group for attaching a nucleic acid sequence includes a hydroxylamine group, a tetrazine, an azide, an alkyne, an alkene, a trans-cyclooctene, a DBCO, a bicyclononyne, a norbornene, a strained alkyne, a strained alkene, or a derivative thereof. In some embodiments, the group for attaching a nucleic acid sequence is subsequently used to attach a nucleic acid sequence. In some embodiments, a nucleic acid sequence tag is generated after the nucleic acid sequence is conjugated to a group for attaching a nucleic acid sequence, and the group includes a hydroxylamine group, a tetrazine, an azide, an alkyne, an alkene, a trans-cyclooctene, a DBCO, a bicyclononyne, a norbornene, a strained alkyne or a strained alkene, or a derivative thereof. In some embodiments, the nucleic acid sequence tag is generated after conjugating the nucleic acid sequence to a group for attaching the nucleic acid sequence, the group comprising a protected hydroxylamine group, a protected thiol, a protected amine, a protected hydrazine, a tetrazine, an azide, an alkyne, an alkene, a trans-cyclooctene, DBCO, a bicyclononyne, a norbornene, a strained alkyne or a strained alkene, or a derivative thereof. In some embodiments, the conjugation occurs before the peptide sequencing step. In some embodiments, the conjugation occurs after the CRC reacts with the N-terminal amino acid. In some embodiments, the conjugation occurs after the CRC reacts with the N-terminal amino acid and then cuts from the N-terminal amino acid, but before the next cycle begins.

[0308] In some embodiments, the CRC includes a precursor reactive portion that includes a group for joining the reactive portion (e.g., as element B). In some embodiments, the precursor reactive portion for attaching the reactive portion includes a tetrazine, an azide, an olefin, an alkyne, a trans-cyclooctene, DBCO, a bicyclononyne, a norbornene, a strained alkyne, a strained olefin, or a derivative thereof. In some embodiments, the group for attaching the reactive portion is then used to attach a reactive portion for binding and cleaving the N-terminal amino acid. In some embodiments, the group for attaching the reactive portion is used to join the CRC to the reactive portion that is bound to the N-terminal amino acid.

[0309] Some examples of chemically reactive conjugates are included in Table 1. Table 1 Loop Tags

[0310] In some embodiments, cycle tags are disclosed herein. The cycle tag can be associated with a cycle number. The cycle number can correspond to the number of amino acids, such as the number of amino acids of a peptide when numbered from N to C. The cycle tag can be part of a chemically reactive conjugate.

[0311] The circulating tag may include a circulating nucleic acid. In some embodiments, the circulating nucleic acid includes DNA or RNA. In some embodiments, the circulating tag nucleic acid includes RNA, a peptide, a synthetic small molecule, or a peptide nucleic acid. In some embodiments, the circulating tag is a fluorescent tag.

[0312] In some embodiments, the circulating tags include peptides. In some embodiments, the circulating tags include peptide nucleic acids. In some embodiments, the circulating tags include fluorescent tags. In some embodiments, the circulating tags include small molecules. In some embodiments, the circulating tags include nucleic acids. In some embodiments, the circulating tags are synthetic.

[0313] In some embodiments, nucleic acid tags are disclosed herein. Nucleic acid tags can be contained in chemically reactive conjugates. Nucleic acid tags of chemically reactive conjugates can be mentioned or included as examples of circulating nucleic acid tags. In some embodiments, the nucleic acid sequence tag comprises a DNA or RNA sequence. In some embodiments, the nucleic acid sequence tag comprises at least 10 nucleotides. In some embodiments, the nucleic acid sequence tag is connected or combined with another oligonucleotide.

[0314] In some embodiments, the nucleic acid sequence tag is a DNA sequence. In some embodiments, the nucleic acid sequence tag is an RNA sequence. In some embodiments, the nucleic acid sequence tag is a sequence of at least 10 nucleotides. In some embodiments, the nucleic acid sequence tag is a site for connecting or binding to another oligonucleotide and may not include the nucleic acid itself. Reactive part

[0315] In some embodiments, reactive moieties are disclosed herein.The reactive moiety can be included as part of a chemically reactive conjugate.

[0316] In some embodiments, the reactive moiety comprises an Edman degradation reagent. In some embodiments, the reactive moiety comprises phenyl isothiocyanate (PITC). In some embodiments, the reactive moiety comprises isothiocyanate (ITC) or some derivative thereof. In some embodiments, the reactive moiety comprises dansyl chloride or some derivative thereof. In some embodiments, the reactive moiety comprises dinitrofluorobenzene (DNFB) or some derivative thereof.

[0317] In some embodiments, the reactive portion includes an enzyme or a peptide. In some embodiments, the reactive portion is an enzyme. In some embodiments, the reactive portion is a peptide. In some embodiments, the reactive portion specifically cuts at a specific amino acid. In some embodiments, the reactive portion specifically cuts at a specific amino acid that is not the N-terminal. In some embodiments, the reactive portion specifically cuts at a specific amino acid that is not the N-terminal acid. In some embodiments, the enzyme or peptide has aminopeptidase activity. In some embodiments, the enzyme or peptide is a modified aminopeptidase. In some embodiments, the reactive portion cuts more than a single amino acid. In some embodiments, the reactive portion cuts 2, 3, 4, 5 or more amino acids. In some embodiments, the reactive portion cuts amino acids at a specific motif. In some embodiments, the motif is located at the carboxyl side of lysine (K) and arginine (R) amino acid residues, as long as the next residue is not proline. In some embodiments, the reactive portion binds and cuts to the c-terminal amino acid. In some embodiments, the reactive portion that binds and cuts to the c-terminal amino acid comprises a modified carboxypeptidase. In some embodiments, the reactive portion cuts more than a single amino acid. Examples of reactive moieties that can bind and cleave more than a single amino acid may include peptidyl dipeptidases or modified peptidyl dipeptidases, such as modified angiotensin converting enzyme (ACE). The reactive moiety may include ACE or modified ACE.

[0318] Some embodiments include C-terminal peptide degradation, for example, according to the alkylated thiohydantoin method described in the following literature: DuPont et al. Dupont DR, Bozzini M, Boyd VL. The alkylated thiohydantoin method for C-terminal sequence analysis. EXS. 2000; 88: 119-31 (https: / / doi.org / 10.1007 / 978-3-0348-8458-7_8). The C-terminal carboxyl group can be converted to thiohydantoin by treating with acetic anhydride under acidic conditions and then treating with thiocyanate ions. Optionally, the C-terminus can be converted to thiohydantoin by reacting with diphenylphosphoisothiocyanate (DPP-ITC). The alkylation of thiohydantoin can be achieved by reacting with an alkyl halide functional chemically reactive conjugate under alkaline conditions, which results in alkylation at the sulfur of thiohydantoin. This is useful for connecting the C-terminus to CRC. Cleavage of the C-terminal amino acid conjugate can be achieved using thiocyanate ions under acidic conditions.

[0319] In some embodiments, the reactive moiety comprises a group on the CRC for attachment to a cleavable derivatized N-terminal amino acid, the group comprising a tetrazine, an azide, an olefin, an alkyne, trans-cyclooctene, DBCO, a bicyclononyne, norbornene, a strained alkyne, or a strained olefin, or a derivative thereof. Fixed part

[0320] In some embodiments, disclosed herein are immobilization moieties.The immobilization moiety can be included as part of a chemically reactive conjugate.

[0321] In some embodiments, the fixed part includes a thiol group, an amine group or a carboxyl group. In some embodiments, the fixed part includes a protected thiol group, a protected amine group or a carboxyl group, an azide, an alkyne, an alkene, an aryl boronic acid, an aryl halide, a halogenated alkyne, a silyl alkyne, a Si-H group, a protected or photoprotected reactive group, or a photoactivated reactive group. In some embodiments, the fixed part is an azide, an alkyne, an alkene, an aryl boronic acid, an aryl halide, a halogenated alkyne, a silyl alkyne, a Si-H group, a protected or photoprotected reactive group, or a photoactivated reactive group. The fixed part may include a thiol. The fixed part may include an amine. The fixed part may include an alkyne. The fixed part may include an azide. The fixed part may include an alkene. The fixed part may include an aryl boronic acid. The fixed part may include an aryl halide. The fixed part may include a halogenated alkyne. The fixed part may include a silyl alkyne. The fixed part may include a Si-H group. The immobilization moiety may include protected or photoprotected reactive groups (e.g., pyridyl disulfide, phenylacyl protected thiol, nitrobenzyl protected thiol, photocaged DBCO). The immobilization moiety may include photoactivated reactive groups (e.g., aziridine, tetrazole, sydney ketone, 3-hydroxynaphthalen-2-ol).

[0322] In some embodiments, the immobilization moiety is a thiol group. In some embodiments, the immobilization moiety is an amine group. In some embodiments, the immobilization moiety is a carboxyl group. In some embodiments, the moiety comprises a protected amine, a protected hydroxylamine, a protected hydrazine, or a blocked isocyanate. Connectors

[0323] Any components of the CRC may be linked. The linking may be achieved by a linker. The components may have the same or different linkers. When the CRC comprises the structure of Formula I, L A , L B or L C Can include connectors. A Can include connectors. B A linker may be included. When CRC comprises the structure of Formula II, L AB or L BC .L A Can include connectors. AB Can include connectors. BC A linker may be included. In some embodiments, the CRC comprises a A , L B and / or L C of the connector.

[0324] In some embodiments, the linker comprises polyethylene glycol (PEG), a hydrocarbon, an ether, a carboxyl group, an amine, an amide, an azide, a thiol, an azide-thiol, an alkylene, a heteroalkylene, a cyclic group, a phenyl group, or a combination thereof. The linker may include polyethylene glycol (PEG). PEG may include PEG n , such as PEG 1-20 .

[0325] In some cases, the linker comprises an alkylene group. In some cases, the alkylene group is a C1-C20 alkylene group or a derivative thereof. In some cases, the C1-C20 alkylene group may optionally be a substituted variant thereof. In some cases, the alkylene group is a C1-C10 alkylene group or a derivative thereof. In some cases, the linker comprises a heteroalkylene group. In some cases, the heteroalkylene group comprises a PEG. 1-n , wherein n is any suitable integer. In some cases, n is an integer of 2-100. In some cases, n is an integer of 2-50. In some cases, n is an integer of 2-25. In some cases, n is an integer of 2-20. In some cases, heteroalkylene comprises PEG1-20 (e.g., polyethylene glycol of 1 to 20 units) or a derivative thereof. In some cases, PEG1-20 may optionally be a substituted variant thereof. The joint may comprise oligoethylene glycol, peptide, oligopropylene glycol, oligoamide, oligosaccharide, siloxane, fully alkylated polyamine, polyol, oligopolyester, nucleic acid or oligopoly (tetrahydrofuran). In some respects, the joint can be modified, for example, with one or more of the following to modify: heterocycle, carbocycle, thioester, ether, thioether, tertiary amine, amide, carbamate, sulfonamide, dibenzocyclooctene, triazole, thioamide, oxime, hydrazone, urea, thiourea, carbonyl (such as ester or amide) or carbonate. The number of carbon atoms in the PEG unit in the PEG joint or the alkylene joint can be reduced or increased as required. The number of PEG or carbon atoms in the change joint can have different effects on the accessible range of chemically reactive arms. For example, longer PEG arms can be used for allowing greater flexibility or miscellaneity, and shorter PEG arms can provide greater rigidity or specificity.

[0326] The linker may include -C(O)-, -O-, -S-, -S(O)-, -C(O)O-, -C(O)C1-C10 alkyl, -C(O)C1-C10 alkyl-O-, -C(O)C1-C10 alkyl-CO2-, -C(O)C1-C10 alkyl-S-, -C(O)C1-10 alkyl-NH-C(O)-, -C1-C10 alkyl-, -C1-C10 alkyl-O-, -C 1-C10 alkyl-CO2-, -C1-C10 alkyl-S-, -C1-C10 alkyl-NH-C(O)-, -CH2CH2SO2-C1-C10 alkyl-, CH2C(O)-C1-C10 alkyl-, =N-(O or N)-C1-C10 alkyl-O-, =N-(O or N)-C1-C10 alkyl-CO2-, =N-(O or N)-C1-C10 alkyl-S-, Any or all connectors (such as L A , L B , L C , L AB or L BC ) may independently include or be selected from any of the aforementioned linkers. A Can be cuttable. B Can be cuttable. C Can be cuttable. AB Can be cuttable. BC Any combination of the foregoing linkers may be used.

[0327] A linker may be included between the circulating tag and the reactive portion (e.g., in a linear form of a CRC), and the linker may be cleavable. A linker may be included between the circulating tag and the fixed portion (e.g., in a linear form of a CRC), and the linker may be cleavable. A linker may be included between the reactive portion and the fixed portion (e.g., in a linear form of a CRC), and the linker may be cleavable. Any combination of the aforementioned linkers may be used.

[0328] In some embodiments, one or more joints are cleavable. In some embodiments, one or more cleavable joints comprise disulfides. The joint may include a cleavable portion. In some aspects, the cleavable portion may be cleaved by light, an enzyme, or a combination thereof. In some aspects, the light comprises UV light, visible light, IR light, laser, or a combination thereof. In some aspects, the cleavable portion comprises a photo-cleavable portion. In some aspects, the photo-cleavable portion comprises o-nitrobenzyloxy, o-nitrobenzylamino, o-nitrobenzyl, o-nitrovaratyl, phenacyl, p-alkoxyphenacyl, benzoin group, or pivaloyl. In some aspects, the photo-cleavable portion comprises o-nitrobenzyl. In some aspects, o-nitrobenzyl is substituted with methoxy or ethoxy.

[0329] The cleavable portion can be cleaved by light, under acidic conditions, under alkaline conditions, by an enzyme or a combination thereof. In some cases, the light can include UV light, visible light, IR light, laser or a combination thereof. In this case, the cleavable portion can be a photocleavable portion. The photocleavable portion can include an electron withdrawing group, such as but not limited to a nitro or halide group. In alternative cases, the cleavable portion can be an enzyme cleavable portion.

[0330] The cleavable portion may include a pH-sensitive cleavable bond that can be cleaved under acidic or alkaline conditions. In some non-limiting examples, the cleavable portion may include a pH-sensitive cleavable bond that is cleaved by acidifying the solution. In some non-limiting examples, the cleavable portion may include a pH-sensitive cleavable bond that is cleaved by making the solution alkaline. pH-sensitive cleavable bonds are advantageous because the molecule can be delivered but will not react until it is in a slightly acidified environment, which may be beneficial for protein sequencing methods.

[0331] The cleavable portion may include a disulfide bond. The disulfide bond may be formed chemically or enzymatically. The disulfide bond may be cleaved by a reducing agent. The disulfide bond may be enzyme cleavable. The cleavable portion may include a protein or peptide sequence that the enzyme recognizes and cleaves. For example, the cleavable portion may include the peptide sequence ENLYFQ*S (where * represents a cleavage site). The disulfide bond may be included as part of a peptide.

[0332] The enzyme that cuts the cleavable part can include an enzyme that cuts a disulfide bond. Some examples of enzymes that can cut a disulfide bond include thioredoxin or glutaredoxin. The enzyme can include trypsin. The enzyme can include a virus that cuts a specific peptide sequence. For example, the tobacco etch virus (TEV) protein of the specific cutting peptide sequence ENLYFQ*S (wherein * represents a cleavage site) can be used. This or another peptide sequence can be present between the central part and one (or any) arm. After connection and enrichment, the bond can be cut, thereby releasing the target molecule.

[0333] The photo-cleavable part can be cut by UV light. The UV light can have a wavelength in the following range: about 100nm to about 400nm, about 200nm to about 400nm, about 250nm to about 400nm, about 280nm to about 400nm, about 100nm to about 370nm, about 200nm to about 370nm, about 250nm to about 370nm, or about 280nm to about 370nm. In some cases, the photo-cleavable part includes nitrobenzyloxy, nitrobenzylamino, nitrobenzyl, nitroveratyl, phenacyl, alkoxyphenacyl, benzoin group or pivaloyl. In some examples, the nitro group can be located at the ortho position of benzyl, veratrol, phenacyl, benzoin or pivaloyl relative to the cleavage site (e.g., o-nitrobenzyloxy, o-nitrobenzylamino, o-nitrobenzyl, o-nitroveratyl). In some examples, the alkoxy group can be located in the para position of benzyl, veratryl, phenacyl, benzoin or pivaloyl relative to the cleavage site (e.g., p-alkoxyphenacyl). In one aspect, the photocleavable part comprises nitrobenzyl. The nitro group can be located in the ortho position of the benzyl group relative to the cleavage site (o-nitrobenzyl). The o-nitrobenzyl group can be substituted by a methoxy or ethoxy group. In some cases, the methoxy or ethoxy group can be substituted in the para position relative to the nitro group of the o-nitrobenzyl group. In another example, the o-nitrobenzyl group can include a connection to a joint (such as those described herein), which is further connected to the central part. The connection can be in the meta position relative to the nitro group. The connection can include esters, ethers, amines, amides, carbamates, -O-C1-C10 alkyl-or any other connection described herein. In some examples, the photocleavable part can include a structure represented by the following formula: In such examples, n can be 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.

[0334] Any or all connectors (such as L A , L B , L C , L AB or L BC ) may independently comprise or be selected from any of the above-mentioned cleavable linkers or non-cleavable linkers or a combination of cleavable and non-cleavable linkers. Reagent test kit

[0335] In some embodiments, kits are disclosed herein. The kits may include any of the components herein, or any of the aspects described. The kits may be used to analyze polymeric macromolecules, including polymeric macromolecules such as peptides, polypeptides, and proteins.

[0336] Some embodiments include instructions, such as written instructions for use. For example, a kit may include instructions for use in a method for determining the identity and position information of amino acid residues of a peptide.

[0337] In some embodiments, the kit comprises a chemically reactive conjugate.

[0338] In some embodiments, the kit comprises a binding agent.

[0339] In some embodiments, the kit comprises reagents for transferring the information of the recoding nucleic acid to the circulating nucleic acid of the conjugation complex to produce a recoding block.

[0340] Some embodiments include a method for analyzing polymeric macromolecules (such as polymeric macromolecules such as peptides, polypeptides or proteins), which comprises: a chemically reactive conjugate comprising (a) a nucleic acid sequence tag and (b) a reactive portion, wherein the reactive portion is coupled to the N-terminal amino acid residue of the peptide, thereby forming a conjugated complex, wherein the conjugated complex comprises the chemically reactive conjugate coupled to the N-terminal amino acid of the peptide; a binding agent, wherein the binding agent comprises a binding portion for preferentially binding to the conjugated complex and a recoding tag containing a recoded nucleic acid corresponding to the binding agent; and a reagent for transferring the information of the recoded nucleic acid to the circulating nucleic acid of the conjugated complex to produce a recoding block.

[0341] In some embodiments, the kit comprises any or all of the following: (a) a solid support for coupling a peptide to the solid support such that the N-terminal amino acid residue of the peptide is not directly coupled to the solid support and exposed to the reaction conditions; (b) one or more reagents having a chemically reactive conjugate comprising: (x) a circulating tag comprising a circulating nucleic acid associated with a cycle number, (y) a reactive portion for binding to the N-terminal amino acid residue of the peptide, and (z) an immobilization portion for immobilization to the solid support; (c) a reagent for coupling the chemically reactive conjugate to the N-terminal amino acid residue of the peptide to form a conjugated complex when the peptide is contacted with the chemically reactive conjugate; (d) one or more reagents for immobilizing the conjugated complex to the solid support via the immobilization portion; (e) one or more reagents for cleaving and thereby separating the N-terminal amino acid residue from the peptide, thereby providing an immobilized amino acid residue. (f) one or more reagents having one or more binding agents, the one or more binding agents comprising: (i) a binding portion for preferentially binding to the fixed amino acid complex, and (ii) a recoding tag, the recoding tag comprising a recoded nucleic acid corresponding to the binding agent, wherein when the fixed amino acid complex contacts the binding agent, the fixed amino acid complex and the binding agent form an affinity complex, the affinity complex comprising the fixed amino acid complex and the binding agent; (g) one or more reagents, the one or more reagents are used to transfer the information of the recoded nucleic acid to the circulating nucleic acid of the fixed conjugated complex to produce a recoding block; one or more reagents, the one or more reagents are used to join two or more members of a plurality of recoding blocks to form a memory oligonucleotide; and / or (j) one or more sequencing reagents, the one or more sequencing reagents are used to obtain sequence information of the recoding block.

[0342] The kit can be used to sequence a subset of nucleotides of an oligonucleotide and can include one or more reagents for sequencing a subset of nucleotides of an oligonucleotide. Some embodiments include an SBS sequencing reagent mixture comprising one or more nucleotides that are primarily reversibly terminating nucleotides and one or more nucleotides that are primarily non-terminating nucleotides.

[0343] The kits may comprise any reagent or aspect described herein. definition

[0344] As used in this disclosure, the term "amino acid" and the symbol "AA" refer to natural d-amino acids, l-amino acids, non-natural amino acids, and post-translationally modified amino acids. "N-terminal amino acid" refers to an amino acid that has a free amine group and is linked to only one other amino acid of a peptide via an amide bond. Similarly, "C-terminal amino acid" refers to an amino acid that has a free carboxyl group and is linked to only one other amino acid of a peptide via an amide bond.

[0345] The term "AA tag" refers to a nucleic acid molecule of any length (but typically in the range of 5-20 bases) containing a sequence defined as representing a specific amino acid or a class of amino acids with structural or functional similarity. If a polymer that does not contain amino acids is recoded, the AA tag sequence can be defined as representing a specific monomer or a class of monomers with structural or functional similarity. It can also refer to any construct that enables a method for subsequent identification of circulating information, such as a mass tag.

[0346] The terms "analyze" and "analyzing" refer to assigning a sequence and / or a quantity and / or an identity to a macromolecule or a portion of a macromolecular analyte.

[0347] The term "assembly oligonucleotide (assembly oligo)" (e.g., assembly oligonucleotide (assemblyOligo)) refers to a nucleic acid capable of hybridizing with a memory oligonucleotide tethered to a solid support and / or a hydrogel. Assembly oligonucleotides can be used to promote the connection assembly of complementary DNA chains and memory oligonucleotides, and the memory oligonucleotides are tethered to a hydrogel surface and / or a solid support as a template. The connection assembly of complementary chains avoids the need for polymerase extension to produce a liquid phase nucleic acid representing an analyte sequence by tethered nucleic acids. The assembly oligonucleotides include a sequence complementary to a circulating tag sequence and a sequence complementary to an amino acid sequence.

[0348] The term "binding agent" refers to an entity consisting of a binding moiety joined to a recoding tag. The binding moiety and the recoding tag may be joined via a linker.

[0349] The term "binding moiety" refers to a molecule or macromolecule that recognizes and binds to a target analyte or a feature of a target analyte. Exemplary binding moieties include antibodies, F(ab')2, Fab and scFv regions, nanobodies, DNA aptamers, RNA aptamers, modified aptamers, photoactive or non-photoactive cage compounds, oligopeptide permeases (Opp), amino-acyl t-RNA synthetases (aaRS), periplasmic binding proteins (PBPs), dipeptide permeases (Dpp), proton-dependent oligopeptide transporters (POTs), modified aminopeptidases, modified aminoacyl tRNA synthetases, modified anticalins, modified ClpS, lectins or clathrates. The binding moiety may form a covalent association or a non-covalent association with the target analyte, the target analyte including a fixed conjugated complex, such as a fixed PTC-AA-circulating tag-conjugated complex. Depending on the amino acids of the complex, the binding moiety may exhibit binding to one conjugated complex over another conjugated complex. The binding moiety may preferentially bind to structurally or functionally similar classes of amino acids within the conjugated complex.

[0350] In addition to caged drugs and bioactive small molecules, amino acids and derivatized amino acids offer many cage possibilities. For example, amines, carboxylates, and amino acid side chains offer many functional groups that are easily caged. More particularly, caged serine, threonine, tyrosine, cysteine, methionine, aspartic acid, glutamic acid, and lysine have been reported; see Pirrung et al., Synthesis of photodeprotectable serine derivatives-caged serine, Bioorg. Med. Chem. Lett. 2, 1489-1492 (1992); Tatsu et al., Solid-phase synthesis of caged peptides using tyrosine modified with a photocleavable protecting group, Biochem. Biophys. Res. Comm. 227, 688-693 (1996); Gee, KR, Carpenter, BK and Hess, GP, Synthesis, photochemistry, and biological characterization of photolabile protecting groups for carboxylic acids and neurotransmitters, Met. Enz. 291, 30-50 (1998); Tatsu et al., Synthesis of caged peptides using caged lysine: Application to the synthesis of caged AIP, a highly specific inhibitor of calmodulin-dependent protein kinase II, Bioorg.Med.Chem.Lett.9,1093-1096(1999); Okuno, T., Hirota, S. and Yamauchi, Ol., Folding character of cytochrome cstudied by onitrobenzyl modification of methionine 65and subsequentultraviolet light radiation, Biochem. 39, 7538-7545 (2000).

[0351] The terms "biochip" and "microarray" refer to consumable devices that support fluid manipulation and further support the recoding workflow. In some embodiments, these can include flow cells that are used directly by NGS sequencing instruments during DNA sequencing.

[0352] The term "sample of biological or synthetic origin" refers to a sample of macromolecules having an origin from a biological process, such as a cell lysate solution, or having an origin from a sample produced using synthetic biology techniques, or a sample of macromolecules produced using pure chemical synthesis, such as a solution of synthetic peptides, synthetic nucleic acids or chemically synthesized polymers.

[0353] The term "chemically reactive conjugate" refers to a conjugate that comprises (a) one or more reactive moieties that can bind to and cleave a terminal amino acid, (b) a reactive moiety that allows immobilization to a solid support, and (c) a cycle tag with identifying information about the workflow cycle.

[0354] The term "code space" refers to the range of codes associated with cycle labels and AA labels and used to represent workflow cycle and monomer identity information, respectively. The code space is defined by a set of rules that provide practical spacing distances between codes and improve fidelity and accuracy when reading information. For example, Hamming distance theory or other modern digital code space theories (e.g., Lee, Levenshtein-Tenengolts, Reed-Solomon, or others) can be applied to assign codes and enable error detection and error correction functions and account for: 1) NGS sequencing errors during analysis, 2) errors in oligonucleotide synthesis, 3) errors in reagents used in the recoding process, 4) errors that occur during the assembly of recoding blocks, 5) errors that occur during the assembly of memory oligonucleotides, or a combination of errors that may occur during any step of determining protein sequence and protein abundance by recoding amino acid polymers into DNA polymers and analyzing them.

[0355] The term "cognate binder" refers to a binder that is designed to and binds with high relative affinity to a cognate target analyte or a feature or portion of a cognate target analyte. This is in contrast to a "non-cognate binder" that is not designed to bind to a non-cognate target analyte or a feature or portion of a non-cognate target analyte and therefore interacts with the non-cognate target analyte or a feature or portion of a non-cognate target analyte with low relative affinity, such that the non-cognate binder does not effectively transfer recoded tag information to the recoding block under conditions suitable for recoding block assembly by the cognate binder.

[0356] The terms "conjugate complex" and "immobilized conjugate complex" refer to a chemically reactive conjugate that is optionally joined to: an amino acid (e.g., a monomer of a macromolecular analyte), a peptide, a linker, a solid support, and / or a circulating tag, as the case may be.

[0357] The term "complementary" refers to Watson-Crick base pairing between nucleotides, and specifically refers to nucleotides that are hydrogen bonded to each other, wherein a thymine or uracil residue is linked to an adenine residue by two hydrogen bonds, and a cytosine and guanine residues are linked by three hydrogen bonds. Typically, nucleic acids include nucleotide sequences that are described as having "percent complementarity" or "percent homology" to a specified second nucleotide sequence. For example, a nucleotide sequence can have 80%, 90%, or 100% complementarity to a specified second nucleotide sequence, indicating that 8 of 10 nucleotides, 9 of 10 nucleotides, or 10 of 10 nucleotides of the sequence are complementary to the specified second nucleotide sequence.

[0358] The term "cycle tag" (e.g., "cycleTag") refers to a nucleic acid molecule of any length (but typically in the range of 5-20 bases) having a sequence defined as representing a specific cycle of a recoding workflow. The length of the cycle tag may be different for different cycles of the workflow. The cycle tag may optionally include additional nucleic acid sequences that guide the assembly of memory oligonucleotides in subsequent steps, such as a universal assembly sequence that promotes the assembly of recoding blocks regardless of the assembly order. In some examples, the cycle tag may optionally include a restriction endonuclease sequence. The term "cycle tag" may also refer to any construct that enables a method for subsequently identifying cycle information, such as a mass tag.

[0359] The term "deprotection" refers to the removal of a protecting moiety that maintains the integrity of a functional group during exposure to conditions and potential reactants that might otherwise react to alter the functional group. Exemplary protecting agents for nucleic acids include: FMOC, acetyl (Ac), benzoyl (Bz), dimethylformamidine (DMFA), and phenoxyacetyl (PAC). See Radhakrishnan P. Iyer, Current Protocols in Nucleic Acid Chemistry.

[0360] The term "homology" or "identity" or "similarity" refers to the sequence similarity between two peptides or between two nucleic acid molecules.

[0361] The term "hydrogel" refers to a synthetic polymer, a natural polymer and / or a hybrid polymer. Exemplary monomers that can form a hydrogel include one or more: acrylamide, acrylate, vinyl pyridine, dihydroxy methacrylate, other methacrylates, HEMA, PHEMA, PVA, HPMC, PLGA, PEG, etc., in a linear, branched and cross-linked configuration, a block copolymer configuration, or other configurations that are conducive to sequencing macromolecules. See Faisal Raza, Hajra Zafar, Ying Zhu, Yuan Ren, Aftab-Ullah, Asif Ullah Khan, Xinyi He, Han Han, Md Aquib, Kofi OtiBoakye-Yiadom and Liang Ge, A Review on Recent Advances in Stabilizing Peptides / Proteins upon Fabrication in Hydrogels from Biodegradable Polymers, Pharmaceutics 2018, 10, 16. The hydrogel can be associated with a solid support by covalent or non-covalent interactions. The hydrogels can further contain orthogonal conjugation chemistry modalities to support recoding workflows.

[0362] The terms "i-th", "(i-1)-th", etc. refer to any position in the macromolecular analyte and its nearest position.

[0363] The term "ligation oligo" (e.g., "ligation oligo") refers to a nucleic acid that is connected to the circulating tag of a fixed conjugated complex when properly guided by the cognate binder via hybridization with the recoding tag of the cognate binder. In certain embodiments, the ligation oligonucleotide can contain information related to the assembly of amino acids and workflow cycles, and is complementary to the recoding tag of the cognate binder. It is also recognized that the ligation oligonucleotide can be another molecular form that is not a nucleic acid, and its recoding can be connected to the amino acid and workflow cycle information of the circulating tag via a chemical reaction. In certain embodiments, the ligation oligonucleotide can optionally include a sequence that promotes the connection, extension, connection or chemical connection of the recoding block to another other recoding block regardless of the assembly order. For example, by including 3' and / or 5' universal assembly sequences on multiple recoding blocks so that at least two recoding blocks share the same universal assembly sequence, such recoding blocks can be assembled into memory oligonucleotides in any given order.

[0364] The term "linker" or "spacer" refers to a molecule used to join two or more molecules. The composition of the molecule can be a polymer, a monomer, or a combination of the two. The linker may further comprise a reactive element that promotes covalent and / or non-covalent conjugation between the molecules. Exemplary linkers include those used to join the binding agent to the recoding tag or to join the circulating tag to other elements of the conjugated complex, such as a molecule with an NHS-ester at one end of the PEG molecule and an azide at the other end, or a molecule with biotin at one end of the nucleic acid and a maleimide moiety at the other end.

[0365] The term "linking oligo" (e.g., "linking oligo") refers to a nucleic acid that can facilitate the connection between a recoding block associated with a given workflow cycle of a recoding process and a second recoding block associated with any other workflow cycle. Linking oligonucleotides can be used to complete the assembly of memory oligonucleotides because they can replace errors, such as errors in upstream processes that result in incomplete or unexpected recoding block sequences for one or more workflow cycles, no recoding block assembly for one or more workflow cycles, or steric effects that hinder the interaction and assembly between recoding blocks. Linking oligonucleotides can optionally contain sequences complementary to the cycle tag sequence of one workflow cycle and the cycle tag sequence of any other workflow cycle. Connecting recoding blocks via linking oligonucleotides may result in a lack of information related to recoding blocks that were skipped in the assembly of memory oligonucleotides. In this case, it is recognized that memory oligonucleotides may still be valuable for the analysis of macromolecular information because information about the positions of known monomers separated by unknown (or multiple unknown) monomers can be inferred during analysis, and mapping to reference sequences allows macromolecular sequence and identity information. In certain embodiments, the linking oligonucleotide may optionally include a sequence for facilitating the connection between a recoding block associated with a workflow cycle of the recoding process and a second recoding block associated with another workflow cycle. For example, such connection may be facilitated via complementarity between universal assembly sequences of the cycle tags and / or the recoding tags.

[0366] The term "positioning linker" refers to any molecule configured to attach a peptide to a solid support and further configured to bind a nucleic acid. In some examples, a positioning linker refers to a molecule having 3 or more functional elements that facilitate the attachment of a peptide, a nucleic acid, and a solid support. In some examples, the nucleic acid may be a UMI that carries code information associated with the location of the separation of the isolated immobilized PTC-conjugate.

[0367] The term "location oligo" (e.g., "location Oligo") refers to a nucleic acid of any suitable length (but typically in the range of 10-40 bases) that contains a sequence representing the x, y, z coordinates of an immobilized macromolecular analyte and is held in the vicinity of the macromolecule via a location linker. Location oligonucleotides can be used to transfer location information to spatially adjacent immobilized recoding blocks.

[0368] The terms "macromolecule" and "macropolymer" refer to high molecular weight molecules composed of subunits. Examples of macromolecules include, but are not limited to, protein complexes (such as photosynthetic reaction center antenna complexes), multi-subunit proteins (such as photosynthetic reaction centers or porins), single-subunit proteins (such as cytochrome c), protein fragments, peptides, polypeptides, nucleic acids, carbohydrates, and polymers such as urethane or acrylamide. "Macromolecule" also describes natural and synthetic combinations of two or more macromolecular types, such as peptides covalently bound to nucleic acids or lectins bound to carbohydrates by electrostatic, van der Waals forces or any non-covalent forces.

[0369] The term "memory oligonucleotide" (e.g., "memory oligonucleotide") refers to a construct containing positioning information, monomer relative position information, and / or monomer identity information. It is usually assembled by aggregating the information of the recoding block. Typically, the memory oligonucleotide contains information of a related macromolecular analyte. However, it should be recognized that there are embodiments in which the memory oligonucleotide contains identification information of one or more macromolecular analytes. Optionally, the memory oligonucleotide may further contain: a sample index, a UMI, a universal priming site, a linker, and other identifiers of the origin of the macromolecule. The length of the memory oligonucleotide is usually between 25 and 25,000 base pairs. When fully assembled, the length of the memory oligonucleotide is equal to the length of the origin identifier plus the sum of the length of the cycle tag and the AA tag sequence multiplied by the number of workflow cycles. It should be recognized that the cycle tag length can be different for different workflow cycles. Note that incomplete assembly of the recoding block may produce a memory oligonucleotide that is shorter or longer than the fully assembled memory oligonucleotide and is valuable for the analysis of the macromolecule because the cycle and amino acid (e.g., monomer) information is transferred to adjacent registers of the memory oligonucleotide. It will be further appreciated that providing analytical memory oligonucleotides useful for analysis of macromolecular analytes does not require sequential assembly of the recoding block information into memory oligonucleotides.

[0370] The term "n" refers to the length of the target macromolecular analyte or the number of workflow cycles. It also refers to the terminal subunit of the macromolecular analyte, for example, the nth subunit. Thus, the next subunit is denoted n-1, then n-2, and so on along the length of the peptide. These labels can be assigned starting from the N-terminus or the C-terminus of the macromolecule.

[0371] The terms "n-1", "n-2", etc. refer to the cycle before the last cycle, etc. It can also refer to the subunit molecules closest and next closest to the terminal subunit of a macromolecular analyte.

[0372] The term "polynucleic acid" or "polynucleotide" refers to a polymer of deoxyribonucleotides linked by 3'-5' phosphodiester bonds. This also includes polymers with nucleotide analogs and non-natural nucleotides such as Iso-G and Iso-C. This also includes nucleotides linked by phosphorothioate bonds or peptidyl bonds, such as in PNA. This also encompasses RNA and polymers with one or more modified ribose moieties, such as LNA, XNA or BNA.

[0373] The term "nucleic acid sequencing", "NGS" or "next generation sequencing" refers to high throughput methods for determining the sequence of nucleic acid polymers. These methods are exemplified by commercially available products from Illumina, Pacific Biosciences and Oxford Nanopore.

[0374] The term "peptide" or "polypeptide" refers to a chain of two (2) or more amino acids, and the following terms do not imply distinction in length: peptide, polypeptide, or protein. Similarly, no distinction or limitation is implied in terms of l-amino acids, d-amino acids, unnatural amino acids, or post-translationally modified amino acid monomers constituting the peptide.

[0375] The term "PITC-conjugate" refers to a chemically reactive conjugate that has not yet reacted with an amino acid or a solid support. It should be recognized that the qualifier "PITC" is a representative term describing any number of molecules (or groups of molecules) that can similarly function to bind to the N-terminal or C-terminal amino acid and cleave the terminal subunit.

[0376] The terms conjugate complex, "PTC-conjugate" and "PTC-AA-circulating tag-conjugate complex" refer to a chemically reactive conjugate that has been reacted with an amino acid but is not necessarily fixed to a solid support. It should be recognized that the qualifier "PTC" is a representative term describing any number of alternative molecules (or groups of molecules) that can act similarly to bind to the N-terminal or C-terminal amino acid and cleave the terminal subunit. The terms "fixed conjugate complex", "fixed PTC-conjugate" and "fixed PTC-AA-circulating tag-conjugate complex" refer to a chemically reactive conjugate that has been reacted with an amino acid and fixed to a solid support. It should be recognized that the qualifier "PTC" is a representative term describing any number of alternative molecules (or groups of molecules) that can act similarly to bind to the N-terminal or C-terminal amino acid and cleave the terminal subunit.

[0377] The term "post-translational modification" refers to any biological or synthetic modification of an l-amino acid, a d-amino acid, or a non-natural amino acid. The modification may occur at the terminal amine, the terminal carboxyl, or any reactive portion of the peptide. Examples include, but are not limited to, phosphorylation, glycosylation, polysaccharidation, methylation, acetylation, ubiquitination, carboxylation, hydroxylation, biotinylation, pegylation, and succinylation. Further information on post-translational modifications may be found in DOI: 10.1021 / acs.biochem.7b00861.Biochemistry 2018, 57, 177-185, which is incorporated herein by reference in its entirety.

[0378] The term "recode block" (e.g., "recodeBlock") refers to a construct generated by the interaction between the circulating tag of a fixed conjugated complex and the recoding tag of a cognate binder. Typically, a recoding block is a chimeric nucleic acid molecule that contains information related to the workflow cycle and the amino acids or amino acid classes and compositions that constitute the conjugated complex. In addition, the recoding block contains information to guide the assembly of memory oligonucleotides and / or amplification of the recoding block. The recoding block can be formed by transferring information from the recoding tag to the recoding block using an extension-ligation method, or by performing a ligation reaction under appropriate conditions in the presence of a ligase and a ligating oligonucleotide. The form of the recoding block is not necessarily a nucleic acid. It can also take the form of a mass tag that can be used to assign identities to the amino acids of the circulating and cognate conjugated complexes, or other modalities that represent information of the fixed conjugated complex and are suitable for grouping the information for analysis.

[0379] The term "recode tag" (e.g., "recodeTag") refers to a nucleic acid molecule of any length (but typically in the range of 15-60 bases) having a sequence consisting of the complement of the i-th cycle tag, the complement of the AA tag, and the complement of the (i-1)th cycle tag. It provides information for identifying an amino acid (or monomer subunit) to its associated binder. It can uniquely identify an amino acid or can identify a class of amino acids with structural and / or functional similarities. The recode tag can provide a probabilistic estimate of the identity of the amino acid components of the fixed PTC-AA-cycle tag-conjugate complex, thereby providing sufficient information for analysis. In certain embodiments, the recode tag can optionally include the complement of the i-th cycle tag, the complement of the AA tag, and / or a universal assembly sequence or a complement of a universal assembly sequence that facilitates the assembly of memory oligonucleotides. In certain embodiments, the recode tag can optionally include universal assembly sequences at the 3' and 5' ends to facilitate the assembly of memory oligonucleotides, regardless of the assembly order of the constituent recoding blocks. In further embodiments, the recoding tag may comprise a sequence that facilitates amplification of the recoding block.

[0380] The term "sample index" refers to an identifier that is incorporated during post-recoding preparation of a DNA library for NGS analysis, or an identifier that can be attached as a component of a memory oligonucleotide during assembly of the memory oligonucleotide and used to identify the origin of an oligonucleotide in a DNA library during NGS analysis.

[0381] The term "solid support" or "surface" refers to any solid material matrix in a planar form, a spherical form, or a combination of forms, including but not limited to solid beads, porous beads, solid planar materials, porous planar materials, patterned or non-patterned solid materials, nanoparticles, or inorganic or polymeric microspheres, or capillaries. For example, the solid support can include a glass slide or wafer, a silicon slide or wafer, PC, PTC, polyethylene (PE), high-density polyethylene (HDPE) or other plastic slides, Teflon, nylon, nitrocellulose membranes, or borosilicate capillaries. Particles and beads can be formed from polystyrene, cross-linked polystyrene, agarose, or acrylamide. Beads or nanoparticles can be magnetic or paramagnetic to support separation or purification processes. The solid support can be passivated with glass, silicon oxide, tantalum pentoxide, DLC diamond-like carbon, or other passivating agents. "Solid supports" including membranes can be passivated or activated via corona or other plasma treatment methods. The solid support can be further assembled with other components to facilitate fluid transport and / or detection (e.g., flow cells, biochips, microtiter plates). The solid support can include an associated hydrogel that supports the engaged components for macromolecular recoding and / or analytical workflows. In certain examples, the term "solid support" can include any of the above solid supports further associated with a hydrogel.

[0382] The term "splint" refers to a nucleic acid having complementarity to the 5' end of one nucleic acid and the 3' end of another nucleic acid such that hybridization of the splint to the two nucleic acids brings the 5' and 3' ends into proximity to facilitate chemical or biological ligation.

[0383] The term "gated sequencing" refers to a method of sequencing (e.g., nucleic acids, peptides, and other polymers) in which gap reads or interspersed sub-reads are generated from continuous fragments rather than a single uninterrupted read. Such sub-reads are referred to as "gated" or "gated" reads.

[0384] As used in this disclosure, the term "unique molecular identifier" or "UMI" refers to a nucleic acid molecule of 10 to 40 bases in length that can be assembled into, for example, a memory oligonucleotide and provides a unique identification for computer deconvolution of NGS sequencing data regarding a specific memory oligonucleotide.

[0385] The term "universal priming site" or "universal primer" refers to a nucleic acid molecule that can be used for library amplification and / or used during NGS. Exemplary universal priming sequences can include P5, P7, P5', P7', SBS Read 1, and SBS Read 2 primers.

[0386] The term "universal sequence" or "universal assembly sequence" or "universal amplification sequence" refers to a common complementary polynucleotide sequence that can be appended to the 3' and / or 5' end of a tag (e.g., a recoded tag) to facilitate its amplification or assembly into an oligonucleotide (e.g., a memory oligonucleotide) using common primers. In certain embodiments, the universal sequence comprises a repeat sequence, such as a dinucleotide repeat sequence such as (GT) n Or other relatively short nucleotide motifs. The universal sequence can be silent during oligonucleotide sequencing to facilitate efficient detection and analysis of assembled components of the oligonucleotides.

[0387] The term "workflow cycle" or "cycle" refers to the number of iterations of any one operation of a process flow or method described herein.

[0388] Several references to oligonucleotides may be used and may alternatively be included or named as in Table 2. Table 2

[0389] It should be noted that, unless the context clearly dictates otherwise, as used herein and in the appended claims, the singular forms "a", "an", and "the" include plural indicators. Thus, for example, reference to an "oligonucleotide" refers to one or more oligonucleotides, and the like. In addition, it should be understood that terms such as "left", "right", "top", "bottom", "front", "back", "side", "height", "length", "width", "up", "down", "inside", "outside", "inside", "outside" that may be used herein only describe reference points, and do not necessarily limit the embodiments of the present disclosure to any particular orientation or configuration. In addition, terms such as "first", "second", "third" only identify one of a plurality of parts, components, steps, operations, functions and / or reference points as disclosed herein, and do not necessarily limit the embodiments of the present disclosure to any particular configuration or orientation as well.

[0390] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present disclosure belongs. All publications mentioned herein are incorporated by reference for the purpose of describing and disclosing devices, methods, and cell populations that may be used in conjunction with the disclosure described herein.

[0391] Where a range of values ​​is provided, it is understood that each intermediate value between the upper and lower limits of the range and any other stated or intermediate values ​​within the stated range are encompassed within the present disclosure. The upper and lower limits of these smaller ranges may be independently included within the smaller ranges and are also encompassed within the present disclosure, subject to any explicitly excluded limits within the stated range. Where the stated range includes one or both of the stated limits, ranges excluding either or both of those included limits are also encompassed within the present disclosure.

[0392] In this specification, many specific details are set forth to provide a more thorough understanding of the present disclosure. However, it will be clear to one of ordinary skill in the art that the present disclosure can be practiced without one or more of these specific details. In other cases, well-known features and procedures well known to those skilled in the art are not described to avoid obscuring the present disclosure.

[0393] Functionality described in conjunction with one embodiment is intended to apply to additional embodiments described herein unless expressly stated or to the extent that a feature or function is incompatible with the additional embodiment. For example, where a given feature or function is expressly described in conjunction with one embodiment but not expressly mentioned in conjunction with an alternative embodiment, it is understood that the feature or function may be deployed, utilized, or practiced in conjunction with the alternative embodiment unless the feature or function is incompatible with the alternative embodiment.

[0394] Unless otherwise indicated, the practice of the technology described herein can adopt the conventional techniques and descriptions of organic chemistry, polymer technology, molecular biology (including recombinant technology), cell biology, proteomics, biochemistry and sequencing technology, which are within the technical scope of those skilled in the art. Such conventional techniques include polymer array synthesis, hybridization and connection of polynucleotides and other polymers, and detection of hybridization using labels. Specific descriptions of suitable technologies can be obtained by reference to the embodiments herein. However, other equivalent conventional procedures can certainly be used. Such routine techniques and descriptions can be found in standard laboratory manuals, such as Green et al., eds. (1999), Genome Analysis: A Laboratory Manual Series (Volumes I-IV); Weiner, Gabriel, Stephens, eds. (2007), Genetic Variation: A Laboratory Manual; Dieffenbach, Dveksler, eds. (2003), PCR Primer: A Laboratory Manual; Mount (2004), Bioinformatics: Sequence and Genome Analysis; Sambrook and Russell (2006), Condensed Protocols from Molecular Cloning: A Laboratory Manual; and Sambrook and Russell (2002), Molecular Cloning: A Laboratory Manual (all from Cold Spring Harbor Laboratory Press); Stryer, L. (1995) Biochemistry (4th Edition) WH Freeman, New York NY; Gait, "Oligonucleotide Synthesis: A Practical Approach" 1984, IRL Press, London; Nelson and Cox (2000), Lehninger, Principles of Biochemistry 3rd ed., WH Freeman Pub., New York, NY; Berg et al. (2002) Biochemistry, 5th ed., WH Freeman Pub., New York, NY; all of which are incorporated herein by reference in their entirety for all purposes. Example

[0395] The following examples are presented to provide a complete disclosure and description of how to prepare and use the disclosure to those of ordinary skill in the art, and are not intended to limit the scope of the disclosures that the inventors consider to be theirs, nor are they intended to represent or imply that the following experiments are all or only experiments performed. It will be appreciated by those skilled in the art that numerous changes and / or modifications may be made to the disclosures shown in the specific aspects without departing from the spirit or scope of the disclosures broadly described. Therefore, aspects of the present invention are considered to be illustrative and non-restrictive in all respects. Example 1: Characterization and verification of the functionality of trifunctional chemically reactive conjugates (TCRCs)

[0396] The chemically reactive conjugate (CRC) may comprise (x) a circulating tag (or a moiety for covalent attachment to a circulating tag, such as an aminooxy group in this example), (y) a reactive moiety (such as PITC in this example) for binding to and cleaving the N-terminal amino acid residue of a peptide, thereby exposing the next amino acid residue as the N-terminal amino acid residue on the cleaved peptide, and (z) an immobilization moiety (such as a propargyl group in this example) for immobilization to a solid support. The ability to synthesize a trifunctional molecule, bind its reactive moiety to the N-terminal amino acid of an immobilized peptide, cleave the N-terminal amino acid, hybridize with a circulating tag, attach the circulating tag, and bind the CRC to a solid support via an immobilization moiety is demonstrated using PPO, which is an example of a CRC compound, such as Fig.32B shown.

[0397] Thus, an example shown to work in this article is PPO, which is an example of a CRC shown to work in this article. PPO (propargyl-PITC-oligonucleotide): 1-(1-deoxyribonucleotidyl-indol-3-yl)-N-(12-(4-(3-(4-isothiocyanatophenyl)-3,9-dihydro-8H-dibenzo[b,f][1,2,3]triazolo[4,5-d]azocin-8-yl)-4-oxobutanoyl)-3,6,9,15,18-pentaoxa-12-azahesin-20-yn-1-yl)-3,6,9,12,15-pentaoxa-2-azaoctadec-1-ene-18-amide.

[0398] Synthesis (such as Figure 32A-32B The chemical names of the intermediates that may be formed during the synthesis shown in FIG. 1 and FIG. 10 are as follows: PDA: N-(propargyl-PEG2)-DBCO-PEG3-amine (Broadpharm catalog number 29932) PDON: N-(12-(4-(11,12-didehydrodibenzo[b,f]azocine-5(6H)-yl)-4-oxobutanoyl)-3,6,9,15,18-pentaoxa-12-azahexa-20-yn-1-yl)-2,5,8,11,14-pentaoxa-1-azaheptadecan-17-amide ·PDON-tBOC: PDON tert-butyloxycarbonyl PDO: 1-(1-deoxyribonucleotidyl-indol-3-yl)-N-(12-(4-(11,12-didehydrodibenzo[b,f]azocin-5(6H)-yl)-4-oxobutanoyl)-3,6,9,15,18-pentaoxa-12-azahexa-20-yn-1-yl)-3,6,9,12,15-pentaoxa-2-azaoctadec-1-ene-18-amide

[0399] As a preliminary test, Fig.26 In the present invention, a model trifunctional molecule of approximately 1 kd was generated, which includes vanillin in place of an oligonucleotide, the molecule having: (1) phenyl isothiocyanate, (2) a propargyl group, and (3) a model vanillin at the oligonucleotide position to simplify analytical characterization of the base structure: NNN-(propargyl-PEG2)(6-oxo-6-(dibenzo[b,f]azocine-4-yn-1-yl)-hexanoic acid)(PEG3-1-acetamido-4-isothiocyanato-benzene). The molecular structure was confirmed using LC ESI-MS and its functionality was tested. HPLC analysis showed product formation with high yield, indicating functional activity of the key reactive isothiocyanate moiety. The trifunctional molecular base was generated using a modular design so that each component and linkage could be replaced with an alternative structure if desired. Its composition was designed to be stable under cyclic Edman conditions while retaining downstream functionality: PEG is inert to acid and base degradation. • The peptide linkages used to connect the modular components are similar to internal peptide bonds of proteins that are largely unaffected during the Edman degradation process. • 1,2,3-Triazole is believed to be stable to anhydrous acid and alkaline conditions within the range useful for protein sequencing as described herein. • The same oligonucleotide protecting groups as used during phosphoramidite synthesis can be used. Exposure to trichloroacetic acid (TCA) during long oligonucleotide synthesis exceeds the expected chemical stress of the protein sequencing steps herein. Synthesis of trifunctional CRC PPO

[0400] Synthesis of PDON-tBOC: N-(propargyl-PEG2)-DBCO-PEG3-amine, TFA salt (PDA, Broadpharm catalog number 29932, 4.56 mg, 0.0063 mmol) was dissolved in 200 μL of 100 mM pH 8.65 phosphate buffer and mixed with 15.8 μL of 400 mM carbonate buffer pH 9.6. t-Boc-aminooxy-PEG4-NHS ester (Broadpharm catalog number 24429, 10 mg, 0.021 mmol) was dissolved in 100 μL of DMSO. The solutions were combined and mixed by pipette, 200 μL of dimethyl sulfoxide (DMSO) was added, and the reaction was incubated at room temperature (RT) for 18 hours. The product was purified using high performance liquid chromatography (HPLC). At m / z=969 (positive mode) [M+H] + The electrospray ionization-mass spectrometry (ESI-MS) peak at indicated a successful synthesis.

[0401] Synthesis of PDON: PDON-tBOC was evaporated at 45 ° C under reduced pressure for 3 h and then dissolved in dichloromethane (100 ul). Trifluoroacetic acid (30 μL) was added, and the mixture was incubated at room temperature (RT) for 1.5 h, neutralized by adding 180 μL of 4.1 M imidazole in acetonitrile / methanol (2:3 v:v), and purified using HPLC. The successful synthesis of the intermediate PDON was confirmed by ESI-MS analysis. Specifically, a peak was observed at m / z=869 [M+H] + indicating the successful synthesis of PDON.

[0402] Synthesis of PDO: PDON was partially evaporated at 45°C under reduced pressure for 3h. The concentration was quantified using optical density measurement at 310nm (OD=45, 3.4mM). Sys3 SOC oligonucleotide ( / 5Phos / TGAAGGG / iFormInd / TGACCTAGCAATGGTGAAGTTAAT GCAGGTAGTTAAG (SEQ ID NO: 108), Integrated DNA Technology, 178.8nmol, where iFormInd represents formyl indole modification for subsequent tethering) was resuspended in 100μL 1xSSPE buffer (Sigma), and 10μL of the oligonucleotide solution was added to 10μL 11.3mM 5-aminoindole and 20μL 390mM pH 5.5 acetate buffer. To this mixture, 15μL PDON solution was added, the solution was mixed by pipetting, and the reaction was incubated at room temperature for 18h. After the reaction, the product was purified using high performance liquid chromatography (HPLC) and then dried under reduced pressure at a temperature of 45° C. for 4 h. The product was subjected to electrospray ionization time-of-flight mass spectrometry (ESI-TOF-MS) analysis, which produced a peak at m / z=14920 [M+H]+, indicating the successful synthesis of compound PDO. In a control experiment, the mass spectrum of the Sys3 SOC oligonucleotide alone was found to have a peak at m / z=14069 [M+H]+.

[0403] Synthesis of PPO: PDO was resuspended in 28 μL milli-Q water (OD260 = 20, 43 uM). 4-Azidophenylisothiocyanate (N3PITC, 1.30 mg, 0.0074 mmol) was dissolved in 1 mL DMSO to form a 7.4 mM solution. 90 μL of the N3PITC solution was added to the PDO solution and mixed with a pipette. The reaction was incubated at room temperature for 3 h. After this incubation period, the product was purified using high performance liquid chromatography (HPLC), which produced two major peaks at 14 minutes and 18 minutes. These product peaks were further analyzed using quadrupole time-of-flight mass spectrometry (QTOF MS). For the product corresponding to the 14 minute mark in the HPLC analysis, this analysis produced a peak at m / z = 15094 [M] +. For the product corresponding to the 18 minute mark, a peak was observed at m / z = 15095 [M + H] +, indicating successful completion of the synthesis step. Since the mass and functional tests appear identical, it can be assumed that the two peaks are isomers (eg, regioisomers of the DBCO-azide adduct). ITC function test

[0404] The functionality of the isothiocyanate (ITC) group is checked by the solution phase test of PPO. Using HPLC purified PPO fractions, these fractions are suspended in a solution of 35mM TEAA with 5% acetonitrile. To each 100 μL aliquot of these purified fractions, 10 μL of 400mM carbonate buffer (pH 9.6) is added, followed by a 10 mM solution of 1 μL of FAM-PEG3-NH2 (Broadpharm catalog number BP-20958) in DMSO. The reaction mixture is fully mixed using a pipette, and then incubated at room temperature for 1 h. After this incubation period, the reaction sample is analyzed using h...

Claims

1. A method for determining the identity and position information of amino acid residues of a peptide coupled to a solid support, the method comprising: (a) providing the peptide to the solid support, the peptide being coupled to the solid support such that the N-terminal amino acid residue of the peptide is not directly coupled to the solid support and exposed to reaction conditions; (b) providing a chemically reactive conjugate comprising: (x) a circulating tag comprising a circulating nucleic acid associated with a cycle number, (y) a reactive moiety for binding to the N-terminal amino acid residue of the peptide, and (z) an immobilization moiety for immobilization to the solid support; (c) contacting the peptide with the chemically reactive conjugate, thereby coupling the chemically reactive conjugate to the N-terminal amino acid of the peptide to form a conjugated complex; (d) immobilizing the conjugated complex to the solid support via the immobilization moiety; (e) cleaving and thereby separating the N-terminal amino acid residue from the peptide, thereby providing an immobilized amino acid complex comprising the cleaved and separated N-terminal amino acid residue; (f) contacting the immobilized amino acid complex with a binding agent, the binding agent comprising: a binding moiety for preferentially binding to the immobilized amino acid complex and a recoded tag comprising a recoded nucleic acid corresponding to the binding agent, thereby forming an affinity complex, the affinity complex comprising the immobilized amino acid complex and the binding agent, thereby bringing the circulating tag into proximity with the recoded tag within the affinity complex; (g) transferring the information of the recoded nucleic acid to the circulating nucleic acid of the immobilized conjugated complex to produce a recoded block; (j) obtaining sequence information of the re-encoded block; as well as (k) determining the identity and position information of the amino acid residues of the peptide based on the obtained sequence information.

2. The method of claim 1, wherein cleaving the N-terminal amino acid residue from the peptide exposes the next amino acid residue as the N-terminal amino acid residue on the cleaved peptide.

3. The method of claim 2, wherein the reactive portion of the chemically reactive conjugate cleaves the N-terminal amino acid residue from the peptide.

4. The method of claim 2, further comprising repeating steps (b) to (k) for each subsequent amino acid of the peptide.

5. The method according to claim 1, further comprising washing the immobilized amino acid complex before contacting the immobilized amino acid complex with a binding agent.

6. The method of claim 1, further comprising determining a possible three-dimensional structure of the peptide based on the sequence information.

7. The method of claim 1, wherein the recoded nucleic acid comprises DNA or RNA.

8. The method of claim 1, wherein the circulating nucleic acid comprises DNA or RNA.

9. The method of claim 1, wherein obtaining sequence information of the re-encoded block comprises performing sequencing.

10. The method of claim 1, wherein the binding moiety comprises a peptide, 11. Antibodies, 12. Antibody fragments, antibody derivatives or aptamers.

13. The method of claim 1, wherein the binding moiety binds to a natural amino acid, a post-translationally modified amino acid, a derivative form of an amino acid, a derivative or stabilized form of a post-translationally modified amino acid, a synthetic amino acid, an amino acid with a specific side chain, an amino acid with a phosphorylated side chain, an amino acid with a glycosylated side chain, an amino acid with a methylated modification or a D-amino acid, a phenylthiourea (PTH) derivative of an amino acid or an anilinothiazolinone (ATZ) derivative, or a combination thereof.

14. The method of claim 1, wherein the solid support comprises a bead, a plate, or a chip.

15. The method of claim 1, wherein the solid support comprises a glass slide, silica, a resin, a gel, a hydrogel, a membrane, polystyrene, a metal, nitrocellulose, a mineral, a plastic, a polyacrylamide, a latex, or a ceramic.

16. The method of claim 1, wherein the peptide comprises a hormone, a neurotransmitter, an enzyme, an antibody, a viral protein, a bacterial protein, a synthetic peptide, a bioactive peptide, a peptide hormone, an oligopeptide, a polypeptide, a fusion protein, a cyclic peptide, a branched peptide, a recombinant protein, a tumor marker, a therapeutic peptide, an antigenic peptide, or a signaling peptide.

17. The method of claim 1, wherein the peptide is derived from a cell lysate, a blood sample, a plasma sample, a serum sample, a tissue biopsy, a saliva sample, a urine sample, a cerebrospinal fluid sample, a sweat sample, a synovial fluid sample, a stool sample, a gut microbiome sample, an environmental water sample, a soil sample, a bacterial culture, a viral culture, an organoid, a tumor biopsy, a sputum sample, or a hair sample.

18. The method of claim 1, wherein the peptide is associated with a disease.

19. The method according to claim 1, wherein the transferring information comprises performing nucleic acid amplification, 20. Enzymatic ligation, splint ligation, chemical ligation, template-assisted ligation, use of ligase, use of splint oligonucleotide, use of catalyst, use of bridging molecule, use of condensing agent, use of coupling agent, use of polymerase, use of complementary nucleic acid sequence, use of nicking enzyme, use of nucleic acid modifying enzyme, use of recombinase, use of strand displacement polymerase, use of single-stranded binding protein, click chemistry reaction, phosphodiester bond formation or peptide nucleic acid-mediated ligation.

21. The method of claim 1, wherein the information of the recoded nucleic acid comprises the sequence of the recoded nucleic acid or the reverse complement of the sequence of the recoded nucleic acid.

22. The method of claim 1, wherein the transferring information comprises joining the recoded nucleic acid or the reverse complement of the recoded nucleic acid to the circulating nucleic acid.

23. A method for determining the identity and position information of a plurality of amino acid residues of a peptide, the peptide comprising n amino acid residues, the method comprising: (a) coupling the peptide to a solid support such that the N-terminal amino acid residue of the peptide is not directly coupled to the solid support and exposed to reaction conditions; (b) providing a chemically reactive conjugate comprising: (x) a circulating tag comprising a circulating nucleic acid associated with a cycle number, (y) a reactive moiety for binding to and cleaving the N-terminal amino acid residue of the peptide and exposing the next amino acid residue as the N-terminal amino acid residue on the cleaved peptide, and (z) an immobilization moiety for immobilization to the solid support; (c) contacting the peptide with the chemically reactive conjugate, thereby coupling the chemically reactive conjugate to the N-terminal amino acid of the peptide to form a conjugated complex; (d) immobilizing the conjugated complex to the solid support via the immobilization moiety; (e) cleaving and thereby separating the N-terminal amino acid residue from the peptide, thereby exposing the next amino acid residue as the N-terminal amino acid residue on the cleaved peptide and providing an immobilized amino acid complex comprising the cleaved and separated N-terminal amino acid residue; (f) repeating (b) to (e) n-1 times to assemble n-1 additional fixed amino acid complexes, each additional fixed amino acid complex comprising the nucleic acid associated with cycles 2 to n, respectively; (g) contacting the immobilized amino acid complexes with a binding agent, the binding agent comprising: a binding moiety for preferentially binding to one or a subset of the immobilized amino acid complexes and a recoded tag comprising a recoded nucleic acid corresponding to the binding agent, thereby forming one or more affinity complexes, each affinity complex comprising the immobilized amino acid complexes and the binding agent, thereby bringing the circulating tag into proximity with the recoded tag within each formed affinity complex; (h) within each formed affinity complex, conjugating a circulating tag or its reverse complement to a recoding tag to form a recoding block, or otherwise transferring the information of the recoding nucleic acid to the circulating nucleic acid of the fixed conjugated complex, thereby generating a plurality of recoding blocks, each recoding block corresponding to a formed affinity complex; (i) joining two or more members of the plurality of recoding blocks to form a memory oligonucleotide; (j) obtaining sequence information of the memory oligonucleotide; as well as (k) determining the identity and position information of multiple amino acid residues of the peptide based on the obtained sequence information.

24. The method of claim 23, wherein (g)-(h) are repeated 2, 3, 4 or more times.

25. The method of claim 23, wherein n is an integer greater than or equal to 2.

26. The method of claim 23, wherein each binding agent comprises a recoded tag having a unique nucleic acid sequence.

27. The method of claim 23, wherein the plurality of binders comprise recoded tags having the same nucleic acid sequence.

28. The method of claim 23, wherein the binding agent comprises a recoded tag having a unique sequence portion and a common sequence portion.

29. The method of claim 23, further comprising washing the immobilized amino acid complex prior to contacting the immobilized amino acid complex with a binding agent.

30. The method of claim 23, further comprising determining a possible three-dimensional structure of the peptide based on the sequence information.

31. The method of claim 23, wherein the recoded nucleic acid comprises DNA.

32. The method of claim 23, wherein the circulating nucleic acid comprises DNA.

33. The method of claim 23, wherein obtaining sequence information of the memory oligonucleotide comprises performing sequencing.

34. The method of claim 23, wherein the binding moiety comprises an antibody or fragment thereof or an aptamer.

35. The method of claim 23, wherein the binding moiety binds a natural amino acid, a derivatized amino acid, a synthetic amino acid, or a D-amino acid.

36. The method of claim 23, wherein the binding moiety binds a post-translational modification.

37. The method of claim 23, wherein the solid support comprises a bead, a plate, or a chip.

38. The method of claim 23, wherein the solid support comprises a glass slide, silica, a resin, a gel, a hydrogel, a membrane, polystyrene, a metal, nitrocellulose, a mineral, a plastic, a polyacrylamide, a latex, or a ceramic.

39. The method of claim 23, further comprising deprotecting the cycle tag between (f) and (g).

40. The method of claim 23, wherein the transferring information comprises performing nucleic acid amplification, enzymatic ligation, splint ligation, chemical ligation, template-assisted ligation, use of a ligase, use of a splint oligonucleotide, use of a catalyst, use of a bridging molecule, use of a condensing agent, use of a coupling agent, use of a polymerase, use of a complementary nucleic acid sequence, use of a nicking enzyme, use of a nucleic acid modifying enzyme, use of a recombinase, use of a strand-displacing polymerase, use of a single-stranded binding protein, click chemistry, phosphodiester bond formation, or peptide nucleic acid-mediated ligation.

41. The method of claim 23, wherein the information of the recoded nucleic acid comprises the sequence of the recoded nucleic acid or the reverse complement of the sequence of the recoded nucleic acid.

42. The method of claim 23, wherein the transferring information comprises joining the recoded nucleic acid or the reverse complement of the recoded nucleic acid to the circulating nucleic acid.

43. The method of claim 23, wherein determining the identity and position information of a plurality of amino acid residues of the peptide comprises determining the identity and position information of all amino acid residues of the peptide.

44. The method of claim 23, wherein determining the identity and position information of a plurality of amino acid residues of the peptide comprises determining the identity and position information of only a subset of the amino acid residues of the peptide.

45. The method of claim 23, further comprising identifying the peptide by comparing the identity and position information of the plurality of amino acid residues to a database.

46. ​​A chemically reactive conjugate (CRC) comprising: (A) a nucleic acid sequence tag; (B) a reactive portion for binding to and cleaving the N-terminal amino acid residue of a peptide or a cleavable derivative thereof, and (C) an immobilization portion for immobilization to a solid support.

47. A CRC represented by Formula I: A contains the circulating tag, B contains the reactive part, C contains the fixed part, and L A Contains optional connector, L B including an optional linker, and L C comprising an optional linker, and It is the central part.

48. A CRC represented by Formula II: A contains the circulating tag, B contains the reactive part, C contains the fixed part, and L AB including an optional linker, and L BC An optional linker is included.

49. The CRC of claim 46 or 47, comprising a cleavable group between (A) and (B), between (B) and (C), between (A) and (C), between (A) and (B+C), between (B) and (A+C), or between (C) and (A+B), or any combination thereof.

50. The CRC of claim 48, comprising a cleavable group between (A) and (B), between (B) and (C), or a combination thereof.

51. The CRC of claim 46, wherein (A), (B) and (C) are linearly oriented relative to each other in any of the following orders: (A)-(B)-(C), (A)-(C)-(B), or (B)-(A)-(C).

52. The CRC of any one of claims 46-48, wherein the reactive moiety comprises phenyl isothiocyanate (PITC), isothiocyanate (ITC), dansyl chloride, dinitrofluorobenzene (DNFB), an enzyme or a peptide, or a combination or derivative thereof.

53. The CRC of any one of claims 46-48, wherein the reactive portion specifically cleaves at a particular amino acid.

54. The CRC of any one of claims 46-48, wherein the reactive moiety cleaves more than a single amino acid or motif.

55. The CRC according to any one of claims 46-48, wherein the fixing part comprises a protected thiol group, a protected amine group, or a carboxyl group, an azide, an alkyne, an alkene, an aryl boronic acid, an aryl halide, a haloalkyne, a silylalkyne, a Si-H group, a protected or photoprotected reactive group, or a photoactivated reactive group.

56. A CRC according to any one of claims 46-48, wherein the nucleic acid sequence tag is produced after conjugating the nucleic acid sequence with a group for attaching the nucleic acid sequence, the group comprising a protected hydroxylamine group, a protected thiol, a protected amine, a protected hydrazine, a tetrazine, an azide, an alkyne, an alkene, trans-cyclooctene, DBCO, bicyclononyne, norbornene, strained alkyne or strained alkene, or a derivative thereof.

57. A CRC according to any one of claims 46-48, wherein the reactive portion comprises a group on the CRC for attachment to a cleavable derivative N-terminal amino acid, the group comprising a tetrazine, an azide, an olefin, an alkyne, trans-cyclooctene, DBCO, a bicyclononyne, norbornene, a strained alkyne or a strained olefin, or a derivative thereof.

58. A kit for determining the identity and position information of amino acid residues of a peptide, the kit comprising: A chemically reactive conjugate comprising (a) a nucleic acid sequence tag and (b) a reactive moiety coupled to an N-terminal amino acid residue of a peptide, thereby forming a conjugated complex comprising the chemically reactive conjugate coupled to the N-terminal amino acid residue of the peptide; a binding agent comprising a binding moiety for preferentially binding to the conjugated complex and a recoded tag comprising a recoded nucleic acid corresponding to the binding agent; and Reagents for transferring the information of the recoding nucleic acid to the circulating nucleic acid of the conjugated complex to produce a recoding block.

59. A method for sequencing a subset of nucleotides of an oligonucleotide, the method comprising: A combination of a reversibly terminating nucleotide and an irreversibly terminating nucleotide is provided in a nucleic acid sequencing reaction, wherein nucleotides corresponding to the irreversibly terminating nucleotide in the sequenced nucleic acid are not sequenced.

60. The method of claim 59, further comprising identifying the nucleotide in the sequenced nucleic acid that corresponds to the reversibly terminated nucleotide.

61. The method of claim 59, wherein the sequenced nucleic acid comprises a region comprising only a subset of nucleotides selected from A, C, G, and T, and wherein the subset of nucleotides is not sequenced.

62. The method of claim 61, wherein the subset of nucleotides selected from A, C, G and T comprises 2 nucleotides selected from A, C, G and T.

63. The method of claim 61, wherein the subset of nucleotides selected from A, C, G, and T comprises 3 nucleotides selected from A, C, G, and T.

64. The method of claim 61, wherein the region comprises a primer sequence.

65. The method of claim 61, wherein the region does not comprise a barcode sequence, a recoding nucleic acid sequence or a portion thereof, or a circulating nucleic acid sequence or a portion thereof.

66. A method comprising: providing a conjugate comprising a reactive molecule coupled to a protected oligonucleotide; contacting the reactive moiety with a terminal amino acid of a peptide, thereby binding the reactive moiety to the terminal amino acid, and optionally cleaving the terminal amino acid from the peptide; deprotecting the oligonucleotide; and The deprotected oligonucleotide is contacted with an enzyme or reagent for ligation or polymerization.

67. The method of claim 66, further comprising reprotecting the oligonucleotide.

68. The method of claim 67, wherein the reactive moiety cleaves the terminal amino acid from the peptide to expose a next terminal amino acid, and wherein the method further comprises contacting the next amino acid with another of the conjugates after reprotecting the oligonucleotide.

69. The method of claim 66, wherein the terminal amino acid is the N-terminal amino acid.

70. The method of claim 66, wherein the peptide is immobilized to a solid support.

71. The method of claim 66, wherein the conjugate comprises a small organic molecule.

72. The method of claim 66, wherein the conjugate comprises a chemically reactive conjugate (CRC) comprising: (A) the oligonucleotide; (B) the reactive portion; and (C) an immobilization portion.

73. The method of claim 66, wherein the oligonucleotides comprise circulating nucleic acids.

74. A method comprising: providing a conjugate comprising a peptide coupled to a protected oligonucleotide; contacting the terminal amino acid of the peptide, thereby binding a reactive moiety to the terminal amino acid, and optionally cleaving the terminal amino acid from the peptide; deprotecting the oligonucleotide; and The deprotected oligonucleotide is contacted with an enzyme or reagent for ligation or polymerization.

75. The method of claim 74, further comprising reprotecting the oligonucleotide.

76. The method of claim 75, wherein the reactive moiety cleaves the terminal amino acid from the peptide to expose a next terminal amino acid, and wherein the method further comprises contacting the next amino acid with another of the conjugates after reprotecting the oligonucleotide.

77. The method of claim 74, wherein the terminal amino acid is the N-terminal amino acid.

78. The method of claim 74, wherein the peptide is immobilized to a solid support.

79. The method of claim 74, wherein the conjugate comprises a small organic molecule.

Images