Attenuated salmonella-derived bacterial outer membrane vesicle protein drug delivery system as well as preparation method and application thereof

Abstract

The invention discloses a bacterial outer membrane vesicle protein drug delivery system derived from attenuated salmonella as well as a preparation method and application of the bacterial outer membrane vesicle protein drug delivery system. According to the bacterial outer membrane vesicle protein drug delivery system, plug-and-play of a protein drug can be realized on the surface of a bacterial outer membrane vesicle. The invention constructs a bacterial outer membrane vesicle protein drug delivery system. OmpA of attenuated salmonella typhimurium VNP20009 is knocked out, recombinant OmpA of SpyTag inserted into an extracellular ring structural domain is supplemented, fusion protein of SpyCatcher and a protein drug is displayed on the surface of the bacterial outer membrane vesicle by means of the property that an isopeptide bond is spontaneously formed between SpyTag and SpyCatcher, the preparation method is simple and easy to operate, various proteins are displayed on the surface of the bacterial outer membrane vesicle, and the bacterial outer membrane vesicle has a good application prospect. And protein drugs are efficiently protected and loaded. And by combining the immunostimulation characteristic of the bacterial outer membrane vesicles, efficient treatment of tumors is realized.

Description

Technical Field

[0001] The invention relates to the field of microbial technology, and in particular to a bacterial outer membrane vesicle protein drug-carrying system derived from attenuated Salmonella, and a preparation method and application thereof. Background Art

[0002] Bacterial outer membrane vesicles (OMVs) are nano-sized vesicles secreted by Gram-negative bacteria under normal growth conditions. OMVs are derived from bacteria and are mainly composed of outer membrane proteins, LPS, phospholipids, DNA, and a portion of bacterial periplasm wrapped by the outer membrane during the formation process (Kaparakis-Liaskos M, et al., Nat Rev Immunol 2015 Jun; 15 (6): 375-87.). Since OMVs carry a variety of bacterial antigens and their particle size of 20-250 nm can enter lymphatic vessels and be taken up by antigen-presenting cells, they have immunostimulatory properties (Bachmann MF, et al., Nat Rev Immunol. 2010 Nov; 10 (11): 787-96.). In addition, the nanovesicle properties of OMVs make them suitable as drug delivery carriers. Drugs can be chemically covalently coupled to the surface of OMVs or encapsulated into the interior of OMVs to achieve drug delivery. At present, OMVs are usually used as drug delivery carriers to encapsulate chemical drugs and nucleic acid drugs in the cavity of OMVs. However, it is difficult to specifically encapsulate protein drugs into the cavity of OMVs during the formation process, and the drug loading capacity is limited. Since OMVs themselves carry abundant bacterial outer membrane proteins, modifying bacterial outer membrane proteins to display protein drugs that are not easily encapsulated on the surface of OMVs is an effective means to achieve protein drug loading in OMVs.

[0003] The outer membrane protein OmpA is one of the most abundant proteins in the bacterial outer membrane. They provide permeability to the outer membrane and maintain the structural stability of the outer membrane. OmpA can be divided into two independent domains, the N-terminal β-barrel domain present in the outer membrane and the C-terminal that interacts with peptidoglycan (PARK SH, et al., Theranostics, 2016, 6 (10): 1672-82.). The N-terminal β-barrel domain has four ring domains protruding outward. Studies have found that inserting short peptides into it does not affect the folding and transport of OmpA (Hermansen S, et al., Front Mol Biosci. 2022 Jul 14; 9: 918480.). Therefore, OmpA has the potential to display protein drugs on the surface of OMVs as a scaffold protein.

[0004] In 2012, the present invention obtained a protein pair SpyTag / SpyCatcher that can spontaneously form isopeptide bonds by splitting the domain of the fibronectin binding protein FbaB of Streptococcus pyogenes and rationally designing it. SpyTag is a 13-amino acid polypeptide. After mixing with its protein partner SpyCatcher, the Asp on it will form a spontaneous isopeptide bond with the Lys of SpyCatcher (Zakeri B, et al., Proc Natl Acad Sci US A. 2012 Mar 20; 109 (12): E690-7.). The reaction has good specificity, and the reaction conditions are simple, and an irreversible reaction can be carried out under mild conditions. Some studies have connected SpyCatcher to the C-terminus of ClyA, and with the help of the traction effect of ClyA, SpyCatcher was expressed on the outer surface of bacteria, thereby achieving the "display" of SpyCatcher on the outer surface of bacterial-derived OMVs (Cheng K, et al., Nat Commun, 2021, 12(1): 2041.).

[0005] The N-termini of the light chain and heavy chain of the antibody have extremely high amino acid sequence diversity, which is called the variable region. The single-domain antibody obtained by cloning the variable region of the heavy chain antibody is called VHH antibody, also known as nano-antibody (nb). In recent years, more and more monoclonal antibodies have been used for tumor treatment and have shown satisfactory clinical effects, but these monoclonal antibodies have complex production processes and high costs, and are large in size, have limited tumor penetration, and are slowly distributed. Nano-antibodies make up for these shortcomings, and have weak immunogenicity and good biocompatibility, but naked nano-antibodies will be quickly cleared from the blood, and the affinity is not high enough, which greatly limits the application of nano-antibodies in the anti-tumor field. Studies have shown that after covalently linking nano-antibodies to nanoparticles, the residence time of nano-antibodies in the blood can be increased, and the simultaneous connection of multiple nano-antibodies to nanoparticles will significantly increase their affinity (Kijanka M, et al., Nanomedicine (Lond), 2015, 10 (1): 161-74.). Displaying nanoantibodies on the surface of OMVs through covalent linkage can protect nanoantibodies and keep them in the blood and tumor sites for a longer time. In addition, OMVs can effectively activate innate immunity and can be combined with nanoantibodies to achieve a better anti-tumor effect. The present invention hopes to use the outer membrane protein OmpA as a scaffold and use the SpyTag / SpyCatcher protein pair to construct a universal bacterial outer membrane vesicle protein drug delivery system, so as to better protect and deliver protein drugs, and combine the characteristics of OMVs to stimulate the body to produce immune responses, so as to achieve the purpose of combined treatment of tumors.

[0006] Currently, there is a lack of a bacterial outer membrane vesicle protein drug delivery system derived from attenuated Salmonella, and a preparation method and application thereof. Summary of the invention

[0007] In order to solve the problems of the prior art, the purpose of the present invention is to provide a bacterial outer membrane vesicle protein drug delivery system derived from attenuated Salmonella that realizes "plug and play" of proteins on bacterial outer membrane vesicles, as well as a preparation method and application thereof.

[0008] In order to achieve the above-mentioned objectives, the present invention adopts the following technical solutions: In the first aspect, the present application provides a method for preparing a bacterial outer membrane vesicle protein drug delivery system derived from attenuated Salmonella.

[0009] In a second aspect, the present application provides a bacterial outer membrane vesicle protein drug delivery system derived from attenuated Salmonella.

[0010] In a third aspect, the present application provides an application of a bacterial outer membrane vesicle protein drug delivery system derived from attenuated Salmonella in the preparation of anti-tumor drugs.

[0011] The first aspect of the present application provides a method for preparing a bacterial outer membrane vesicle protein drug delivery system derived from attenuated Salmonella, comprising the following steps:

[0012] (1) Knockout of OmpA protein of attenuated Salmonella typhimurium VNP20009: step 1: design sgRNA and upstream and downstream homologous recombination primers, the nucleotide sequence of sgRNA is shown in SEQ ID NO.3, the nucleotide sequence of the first upstream homologous recombination primer in the first homologous recombination primer pair is shown in SEQ ID NO.4, and the nucleotide sequence of the first downstream homologous recombination primer is shown in SEQ ID NO.5; in the second homologous recombination primer pair, the nucleotide sequence of the second upstream homologous recombination primer is shown in SEQ ID NO.6, and the nucleotide sequence of the second downstream homologous recombination primer is shown in SEQ ID NO.7; step 2: construct PTAT-ΔOmpA-RFP; step 3: construct pCas-VNP strain, and induce recombinase expression with arabinose; step 4: electrotransform the PTAT-ΔOmpA-RFP plasmid into the pCas-VNP strain; step 5: remove the PTAT-ΔOmpA-RFP plasmid and the pCas plasmid; the nucleotide sequence of attenuated Salmonella typhimurium VNP20009 is SEQ The polynucleotide fragment of SEQ ID NO.1 is deleted, and SEQ ID NO.1 is replaced by SEQ ID NO.2;

[0013] (2) Using genetic engineering methods, construct OmpA-SpyTag and SpyCatcher-target protein fusion protein expression plasmids respectively: step 1 design homologous recombination primers; step 2 PCR obtain DNA fragments; step 3 chemically transform the recombinant products into chemically competent cells of Escherichia coli DH5α; wherein the amino acid sequence of SpyTag is shown in SEQ ID NO.8, and the amino acid sequence of SpyCatcher is shown in SEQ ID NO.9.

[0014] (3) Construction of attenuated Salmonella recombinant engineering bacteria expressing OmpA-SpyTag fusion protein: The expression plasmid was electroporated into attenuated Salmonella typhi VNP20009 in which OmpA protein was knocked out to obtain attenuated Salmonella recombinant engineering bacteria expressing OmpA-SpyTag;

[0015] (4) Extraction of bacterial outer membrane vesicles of attenuated Salmonella recombinant engineering bacteria: step 1: culturing attenuated Salmonella recombinant engineering bacteria at 37°C and 150rpm; step 2: collecting bacterial solution by low-speed centrifugation; step 3: purifying and concentrating the bacterial solution by filter membrane and ultrafiltration tube; step 4: removing the supernatant after ultracentrifugation, adding PBS to the ultracentrifuge tube for resuspending and ultracentrifuging, and finally removing the supernatant, resuspending the precipitate with PBS to obtain the desired OmpA-SpyTag bacterial outer membrane vesicles OMVs;

[0016] (5) Purification of SpyCatcher-target protein fusion protein: step 1 extract recombinant plasmid; step 2 chemically transform the recombinant plasmid into chemically competent cells of Escherichia coli BL21 (DE3); step 3 IPTG induces fusion protein expression; step 4 low-speed centrifugation to collect bacterial liquid, and high-pressure cell disruptor is used to lyse bacteria; step 5 high-speed centrifugation to collect supernatant, and purification is performed through filter membrane; step 6 purifies the fusion protein by nickel column affinity chromatography;

[0017] (6) Construction of bacterial outer membrane vesicle protein drug delivery system: The target protein carrying SpyCatcher was mixed and incubated with OmpA-SpyTag OMVs.

[0018] Furthermore, in step (1), the coding gene of the SpyTag protein is inserted into the expression plasmid of the bacterial outer membrane protein OmpA by gene recombination, comprising the constitutive promoter J23100, and fused and expressed in attenuated Salmonella to obtain bacterial outer membrane vesicles; the attenuated Salmonella is a recombinant engineered bacterium derived from attenuated Salmonella typhimurium VNP20009, in which the coding gene of the OmpA protein is knocked out, and carries the expression plasmid of the OmpA-SpyTag fusion protein.

[0019] Further, in step (2), SpyTag is connected to flexible linkers on both sides and inserted into the extracellular loop domain of OmpA, and an HA tag is connected at the C-terminus, and the fusion protein encoding gene is cloned into an expression vector containing the promoter J23100 and the anti-plasmid loss element AT; SpyCatcher is connected to the target protein through a flexible linker, and a 6×His tag is connected at the C-terminus, and the fusion protein encoding gene is cloned into the pET-28a expression vector.

[0020] Furthermore, in step (2), the target protein includes but is not limited to EGFP, RFP fluorescent protein, nano-antibodies and tumor antigens; in step (4), the low-speed centrifugation speed is 5000 rpm, and the centrifugation is 20 min; the filter membrane pore size is 0.45 μm and 0.22 μm; the retention molecular weight of the ultrafiltration tube is 100 kDa, and the supernatant liquid is filtered through 0.45 μm and 0.22 μm filter membranes in turn before ultrafiltration; the speed used for ultracentrifugation is 120,000 g, and the centrifugation time is 3 h.

[0021] Furthermore, in step (5), the inducer is IPTG, and the optimal induction concentration is 1 mM; the high-speed centrifugation speed is 12000 rpm, and the centrifugation is 10 min; the OmpA-SpyTag OMVs and SpyCatcher-target protein are mixed and incubated at a mass ratio of 1:5-1:50 (1:10-1:20 is the best condition), and the mixing time is 5 h.

[0022] The second aspect of the present application provides a bacterial outer membrane vesicle protein drug delivery system derived from attenuated Salmonella prepared by the preparation method.

[0023] Furthermore, the invention comprises bacterial outer membrane vesicles and a protein drug carrying SpyCatcher. SpyTag expressed by fusion with OmpA on the bacterial outer membrane vesicles can be connected to the protein carrying SpyCatcher in the form of an isopeptide bond, thereby displaying the protein on the surface of the bacterial outer membrane vesicles.

[0024] The third aspect of the present application provides an application of a bacterial outer membrane vesicle protein drug delivery system derived from attenuated Salmonella in the preparation of anti-tumor drugs.

[0025] Furthermore, the bacterial outer membrane vesicle protein drug delivery system derived from the attenuated Salmonella prepared above can promote the polarization of RAW264.7 cells to the M1 phenotype after co-culture with the macrophage cell line RAW264.7 cells, and significantly promote the proliferation of RAW264.7 cells, and has immunostimulatory properties.

[0026] Furthermore, the SpyCatcher-nanoantibody fusion protein was co-incubated with OmpA-SpyTag OMVs, and the tumor growth in mice was inhibited after tail vein administration. The nanoantibodies included but were not limited to anti-PD1 nanoantibodies and anti-TNFα nanoantibodies, and the tumors included but were not limited to melanoma and breast cancer solid tumors.

[0027] Beneficial effects: The present invention constructs a bacterial outer membrane vesicle protein drug delivery system that can realize "plug and play" of proteins. Under mild reaction conditions, the protein drug carrying SpyCatcher can be connected to the surface of bacterial outer membrane vesicles through isopeptide bonds, thereby better protecting and delivering protein drugs, delaying their clearance rate in the blood, and improving the affinity of protein drugs. The bacterial outer membrane vesicle protein drug delivery system constructed by the present invention has the performance of OMVs stimulating innate immunity, and can achieve better anti-tumor efficacy when used in combination with protein drugs.

[0028] Compared with the prior art, the present invention has the following advantages:

[0029] (1) The present invention uses the bacterial outer membrane protein OmpA and the SpyTag / SpyCatcher protein pair for the first time to construct a bacterial outer membrane vesicle surface protein drug delivery system. By constructing the SpyCatcher-protein drug fusion protein, different protein drugs can be efficiently and flexibly displayed on the surface of bacterial outer membrane vesicles, thereby better protecting and delivering protein drugs.

[0030] (2) The bacterial outer membrane vesicle surface protein drug delivery system constructed by the present invention can combine protein drug therapy with the ability of OMVs to stimulate innate immunity, and can have a double blow to tumors. After tail vein injection, it can significantly inhibit tumor growth in mice.

[0031] (3) The present invention utilizes the ability of SpyTag / SpyCatcher protein pairs to spontaneously form isopeptide bonds, and can assemble any target protein carrying SpyCatcher onto the surface of bacterial outer membrane vesicles containing SpyTag tags, for flexible and efficient display of protein drugs on the surface of bacterial outer membrane vesicles. While better protecting and delivering protein drugs, combined with the inherent immunostimulatory properties of bacterial outer membrane vesicles, the therapeutic effect on tumors is enhanced.

[0032] (4) Compared with the existing technical solution of using ClyA as an OMVs loading antigen protein, the present invention can present a variety of antigen proteins to the surface of OMVs by fusion at the C-terminus of ClyA, and thus be developed as anti-tumor or antiviral vaccines. However, during the transport process, the ClyA fusion protein needs to cross the cell membrane and the bacterial outer membrane. The transport of the double membrane may reduce the loading or transport efficiency of proteins with too large molecular weight or too complex structure, thus having certain application limitations. The present invention directly realizes the loading between the SpyTag / SpyCatcher protein pair on the OmpA protein in the outer membrane, which is efficient and simple. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0034] Figure 1 Schematic diagrams of the construction of each fusion protein vector of the present invention. A is a schematic diagram of the construction of the pJ23100-OmpA-SpyTag vector, and B is a schematic diagram of the construction of the SpyCatcher-target protein-28a vector;

[0035] Figure 2 Characterization of bacterial outer membrane vesicles of the present invention: wherein A is the electron microscopy and particle size characterization of bacterial outer membrane vesicles; B is the protein immunoblot band result of bacterial outer membrane vesicle OmpA-SpyTag fusion protein;

[0036] Figure 3 The effect of the bacterial outer membrane vesicles of the present invention on macrophage polarization and proliferation: wherein A is the effect of bacterial outer membrane vesicles on macrophage polarization, and the detection markers are TNFα, iNOS, and IL-1β; B is a statistical graph of the effect of bacterial outer membrane vesicles on macrophage proliferation;

[0037] Figure 4 The results of macrophage uptake of the bacterial outer membrane vesicle drug delivery system observed by fluorescence confocal microscopy after the bacterial outer membrane vesicles of the present invention were co-incubated with SpyCatcher-EGFP;

[0038] Figure 5 This is a flow cytometry image of the bacterial outer membrane vesicles of the present invention after being co-incubated with SpyCatcher-EGFP and then co-cultured with RAW264.7 cells;

[0039] Figure 6The conditions for constructing the bacterial outer membrane vesicle protein drug delivery system of the present invention are optimized: wherein A is a Western blot grayscale statistical graph after incubation of OmpA-SpyTag OMVs with SpyCatcher-RFP for different time periods; B is a Western Blot grayscale statistical graph after incubation of OmpA-SpyTag OMVs with different concentrations of SpyCatcher-RFP;

[0040] Figure 7 The bacterial outer membrane vesicle protein drug delivery system of the present invention is constructed and characterized: wherein A is a Western Blot result diagram after co-incubation of OmpA-SpyTagOMVs and SpyCatcher-PD1 nb (6His tag); B is a Western Blot result diagram after co-incubation of OmpA-SpyTagOMVs and SpyCatcher-TNFαnb (6His tag);

[0041] Figure 8 The results of the bacterial outer membrane vesicle protein drug delivery system of the present invention loaded with anti-TNFα nanoantibodies to treat the subcutaneous model of breast cancer in mice: A is a graph showing the weight changes of mice; B is a graph showing the tumor growth curve;

[0042] Fig. 9 The results of monitoring the survival of mice after the bacterial outer membrane vesicle protein drug delivery system of the present invention was loaded with anti-TNFα nanoantibodies to treat a subcutaneous mouse breast cancer model;

[0043] Fig.10 The results of the bacterial outer membrane vesicle protein drug delivery system of the present invention loaded with anti-PD1 nanoantibodies to treat mouse melanoma pixie model: A is a graph showing the changes in mouse weight; B is a graph showing the tumor growth curve. DETAILED DESCRIPTION

[0044] The present invention can be better understood according to the following examples. However, it is easy for those skilled in the art to understand that the contents described in the examples are only used to illustrate the present invention, and should not and will not limit the present invention described in detail in the claims.

[0045] In this application, the term "and / or" describes the association relationship of associated objects, indicating that there may be three relationships. For example, A and / or B can mean: A exists alone, A and B exist at the same time, and B exists alone. A and B can be singular or plural. The character " / " generally indicates that the associated objects are in an "or" relationship.

[0046] In the present application, "at least one" means one or more, and "plurality" means two or more. "At least one of the following" or similar expressions refers to any combination of these items, including any combination of single items or plural items. For example, "at least one of a, b, or c", or "at least one of a, b, and c" can all represent: a, b, c, ab (i.e., a and b), ac, bc, or abc, where a, b, and c can be single or multiple, respectively.

[0047] It should be understood that in the various embodiments of the present application, the size of the serial numbers of the above-mentioned processes does not mean the order of execution, some or all of the steps can be executed in parallel or sequentially, and the execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of the present application.

[0048] The terms used in the embodiments of the present application are only for the purpose of describing specific embodiments, and are not intended to limit the present application. The singular forms "a", "said" and "the" used in the embodiments of the present application and the appended claims are also intended to include plural forms, unless the context clearly indicates other meanings.

[0049] The first aspect of the present application provides a method for preparing a bacterial outer membrane vesicle protein drug delivery system derived from attenuated Salmonella, comprising the following steps:

[0050] (1) Knockout of OmpA protein of attenuated Salmonella typhimurium VNP20009: step 1: design sgRNA and upstream and downstream homologous recombination primers, the nucleotide sequence of sgRNA is shown in SEQ ID NO.3, the nucleotide sequence of the first upstream homologous recombination primer in the first homologous recombination primer pair is shown in SEQ ID NO.4, and the nucleotide sequence of the first downstream homologous recombination primer is shown in SEQ ID NO.5; in the second homologous recombination primer pair, the nucleotide sequence of the second upstream homologous recombination primer is shown in SEQ ID NO.6, and the nucleotide sequence of the second downstream homologous recombination primer is shown in SEQ ID NO.7; step 2: construct PTAT-ΔOmpA-RFP; step 3: construct pCas-VNP strain, and induce recombinase expression with arabinose; step 4: electrotransform the PTAT-ΔOmpA-RFP plasmid into the pCas-VNP strain; step 5: remove the PTAT-ΔOmpA-RFP plasmid and the pCas plasmid; the nucleotide sequence of attenuated Salmonella typhimurium VNP20009 is SEQ The polynucleotide fragment of SEQ ID NO.1 is deleted, and SEQ ID NO.1 is replaced by SEQ ID NO.2;

[0051] (2) Using genetic engineering methods, construct OmpA-SpyTag and SpyCatcher-target protein fusion protein expression plasmids respectively: step 1 design homologous recombination primers; step 2 PCR obtain DNA fragments; step 3 chemically transform the recombinant products into chemically competent cells of Escherichia coli DH5α; wherein the amino acid sequence of SpyTag is shown in SEQ ID NO.8, and the amino acid sequence of SpyCatcher is shown in SEQ ID NO.9.

[0052] (3) Construction of attenuated Salmonella recombinant engineering bacteria expressing OmpA-SpyTag fusion protein: The expression plasmid was electroporated into attenuated Salmonella typhi VNP20009 in which OmpA protein was knocked out to obtain attenuated Salmonella recombinant engineering bacteria expressing OmpA-SpyTag;

[0053] (4) Extraction of bacterial outer membrane vesicles of attenuated Salmonella recombinant engineering bacteria: step 1: culturing attenuated Salmonella recombinant engineering bacteria at 37°C and 150rpm; step 2: collecting bacterial solution by low-speed centrifugation; step 3: purifying and concentrating the bacterial solution by filter membrane and ultrafiltration tube; step 4: removing the supernatant after ultracentrifugation, adding PBS to the ultracentrifuge tube for resuspending and ultracentrifuging, and finally removing the supernatant, resuspending the precipitate with PBS to obtain the desired OmpA-SpyTag bacterial outer membrane vesicles OMVs;

[0054] (5) Purification of SpyCatcher-target protein fusion protein: step 1 extract recombinant plasmid; step 2 chemically transform the recombinant plasmid into chemically competent cells of Escherichia coli BL21 (DE3); step 3 IPTG induces fusion protein expression; step 4 low-speed centrifugation to collect bacterial liquid, and high-pressure cell disruptor is used to lyse bacteria; step 5 high-speed centrifugation to collect supernatant, and purification is performed through filter membrane; step 6 purifies the fusion protein by nickel column affinity chromatography;

[0055] (6) Construction of bacterial outer membrane vesicle protein drug delivery system: The target protein carrying SpyCatcher was mixed and incubated with OmpA-SpyTag OMVs.

[0056] In some embodiments, in step (1), the coding gene of the SpyTag protein is inserted into the expression plasmid of the bacterial outer membrane protein OmpA by gene recombination, comprising the constitutive promoter J23100, and fused expressed in attenuated Salmonella to obtain bacterial outer membrane vesicles; the attenuated Salmonella is a recombinant engineered bacterium derived from attenuated Salmonella typhimurium VNP20009, in which the coding gene of the OmpA protein is knocked out, and carries the expression plasmid of the OmpA-SpyTag fusion protein; wherein the amino acid sequence of SpyTag is as shown in SEQ ID NO.8.

[0057] In some embodiments, in step (2), SpyTag is connected to flexible linkers on both sides and inserted into the extracellular loop domain of OmpA, and an HA tag is connected at the C-terminus, and the fusion protein encoding gene is cloned into an expression vector containing promoter J23100 and anti-plasmid loss element AT; SpyCatcher is connected to the target protein through a flexible linker and a 6×His tag is connected at the C-terminus, and the fusion protein encoding gene is cloned into the pET-28a expression vector.

[0058] In some embodiments, in step (2), the target protein includes but is not limited to EGFP, RFP fluorescent protein, nano-antibodies and tumor antigens; in step (4), the low-speed centrifugation speed is 5000rpm, and the centrifugation is 20min; the pore size of the filter membrane is 0.45μm and 0.22μm; the retention molecular weight of the ultrafiltration tube is 100kDa, and the supernatant liquid is filtered through 0.45μm and 0.22μm filter membranes in turn before ultrafiltration; the speed used for ultracentrifugation is 120000g, and the centrifugation time is 3h.

[0059] In some embodiments, in step (5), the inducer is IPTG, and the optimal induction concentration is 1 mM; the high-speed centrifugation speed is 12000 rpm, and the centrifugation is 10 min; the OmpA-SpyTag OMVs and SnoopTag-target protein are mixed and incubated at a mass ratio of 1:5-1:50 (1:10-1:20 is optimal), and the mixing time is 5 h.

[0060] The bacterial outer membrane vesicle protein drug delivery system derived from attenuated Salmonella is prepared by the preparation method provided in the second aspect of the embodiment of the present application.

[0061] In some embodiments, comprising bacterial outer membrane vesicles and a protein drug carrying SpyCatcher, SpyTag expressed by fusion with OmpA on the bacterial outer membrane vesicles can be linked to the protein carrying SpyCatcher in the form of an isopeptide bond, thereby displaying the protein on the surface of the bacterial outer membrane vesicles.

[0062] A third aspect of the embodiments of the present application provides an application of a bacterial outer membrane vesicle protein drug delivery system derived from attenuated Salmonella in the preparation of anti-tumor drugs.

[0063] In some embodiments, the SpyCatcher-nanobody fusion protein is co-incubated with OmpA-SpyTag OMVs, and the growth of mouse tumors can be inhibited after tail vein administration. The nanobodies include but are not limited to anti-PD1 nanobodies and anti-TNFα nanobodies, and the tumors include but are not limited to melanoma and breast cancer solid tumors.

[0064] Example 1

[0065] In this example, an attenuated Salmonella typhimurium VNP20009 outer membrane protein OmpA encoding gene knockout strain was constructed by the following method:

[0066] (1) Design of sgRNA and primers: Select 350 bp upstream and downstream of the target gene, search for the 5'-NGG-3' sequence, and the 20 bp after the 5' end is the sequence of sgRNA (SEQ ID NO: 3). Design primers 20 bp before and after the upstream and downstream homologous arms of the gene OmpA, and the primer pairs are SEQ ID NO: 4 and SEQ ID NO: 5, respectively. Design plasmid PTAT-ΔOmpA-RFP, and PCR amplify each fragment. Use a multi-fragment recombination kit, chemically transform into Escherichia coli DH5α competent cells, and sequence to verify the construction of the knockout plasmid.

[0067] (2) VNP20009 containing the pCas plasmid was grown at 30°C.

[0068] (3) Arabinose-induced recombinase production and preparation of competent cells: Pick a pCas-VNP bacterial monoclone and inoculate it in 3mL LB (kanamycin resistance) at 30°C overnight. The next morning, repeat the transfer to 3mL LB medium and continue to culture at 30°C shaking until OD600 is 0.5-0.8. Transfer 1% of pCas-VNP to 25mL LB medium, culture and grow at 30°C 200rpm for 2-3h. When OD600 is 0.2-0.3, add arabinose at a final concentration of 10mM to induce, until OD600 is about 0.6-0.8, centrifuge at 5000rpm 4°C for 4min, wash three times with 10% pre-cooled glycerol, resuspend in 500μL 10% glycerol, and dispense into 1.5mL EP tubes.

[0069] (4) Electroporation of PTAT-ΔOmpA-RFP: Extract the PTAT-ΔOmpA-RFP plasmid, electroporate the plasmid into the pCas-VNP competent medium, resuscitate for 2-3 h, spread on a double-resistance plate (kanamycin resistance / ampicillin resistance, 30°C), grow for 24-36 h, and pick a single colony for PCR to verify the absence of the OmpA gene and the presence of the RFP gene.

[0070] (5) Removal of PTAT and pCas plasmids and preservation of defective strains: Select the strain that is correct by PCR detection, add IPTG (0.5mM) to LB (kanamycin resistance), and culture twice at 30°C overnight to remove PTAT, followed by streaking. Pick a single colony and streak it on a double-antibiotic plate and a K+ plate respectively. No colony grows on the double-antibiotic plate, and growth on the K+ plate indicates that the strain is a defective bacterium with pCas. Pick a single colony and culture it at 42°C overnight in an antibiotic-free liquid culture medium to remove pCas. Streaking and picking a single clone for culture and preservation will obtain OmpA-deficient bacteria, namely ΔOmpA-VNP.

[0071] Example 2

[0072] Extraction of bacterial outer membrane vesicles and acquisition of SpyCatcher-target protein fusion protein

[0073] (1) Construction of OmpA-SpyTag and SpyCatcher-target protein fusion protein expression plasmid: Figure 1 The schematic diagram of the vector construction is shown, and the required plasmids are constructed using a multi-fragment recombination kit. The J23100-OmpA-SpyTag-HA-AT plasmid is electroporated into ΔOmpA-VNP. SpyCatcher-EGFP-28a plasmid, SpyCatcher-RFP-28a plasmid, SpyCatcher-TNFαnb-28a plasmid, SpyCatcher-PD1 nb-28a plasmid, SpyCatcher-PDL1 nb-28a plasmid, are constructed, and the plasmids are first chemically transformed into Escherichia coli competent DH5α, sequenced and verified, and then chemically transformed into Escherichia coli competent BL21 (DE3).

[0074] (2) Extraction of bacterial outer membrane vesicles: A single colony of recombinant VNP20009 was picked from the plate and placed in 1 mL of antibiotic-free LB, shaken overnight at 37°C, 150 rpm, and then transferred to 1 mL of fresh antibiotic-free LB at a ratio of 1:100 and continued to be cultured until the OD600 value was about 1. The colony was transferred to 500 mL of fresh antibiotic-free LB at a ratio of 1:1000 and shaken overnight at 37°C, 150 rpm for 12 h. Centrifuge at 5000 rpm and 4°C for 20 min to remove most of the bacteria, collect the supernatant, and vacuum filter the supernatant twice using a 0.45 μm filter and a 0.22 μm filter. Use a MW 100 kDa ultrafiltration tube to concentrate the sterilized culture medium 10 times and ultracentrifuge at 120,000 g for 3 h. Discard the supernatant, resuspend the precipitate with pre-cooled PBS to obtain an OMVs suspension, and store it at -80°C.

[0075] (3) Characterization of bacterial outer membrane vesicles: NTA was used to detect the particle size of OMVs, TEM was used to observe the morphology of bacterial outer membrane vesicles, and Western blot was used to characterize the expression of OmpA-SpyTag protein. Figure 2 As shown, Figure 2 A in the middle is the NTA test result and transmission electron microscopy image of the obtained OMVs. It can be seen from the figure that the prepared OMVs are spherical and the particle size is relatively uniform. 95.4% of the OMVs have a particle size distribution between 30nm and 200nm, and the average particle size is about 126nm. B is the protein immunoblot band result of the bacterial outer membrane vesicle OmpA-SpyTag fusion protein, indicating that OmpA-SpyTag is normally expressed in the VNPs supplemented with OmpA-SpyTag after knocking out OmpA.

[0076] (4) Obtaining SpyCatcher-target protein fusion protein: Purify the SpyCatcher-target protein fusion protein by Ni column affinity chromatography, confirm the presence of the target protein in the eluate by SDS-PAGE, and dialyze three times with PBS to replace the protein loading buffer and imidazole in the target protein. After dialysis, filter with a 0.22 μm filter, aliquot and freeze at -80°C.

[0077] Example 3

[0078] Verification and optimization of bacterial outer membrane vesicle protein drug delivery system

[0079] (1) Detection of bacterial outer membrane vesicles connected to SpyCatcher-EGFP: 1 mg of OmpA-SpyTag OMVs was co-incubated with 20 mg of SpyCatcher-EGFP (37°C, 6 h) to produce OMVs-EGFP, which was then washed three times by ultracentrifugation with PBS (4°C, 120,000 g, 3 h). After washing, the precipitate was resuspended in 1 mL of PBS, filtered through a 0.22 μm filter, and retained for later use.

[0080] RAW264.7 cells were cultured in 6-well plates, and drugs were administered when the cell growth density reached 60%. The drug administration groups were set as follows: PBS (NC group), OMVs (5μg), OMVs-EGFP (5μL, 10μL, 20μL, 40μL, 80μL). After drug administration, static culture was continued for 4 hours, the culture solution was discarded, the cells were collected, the cells were washed 3 times with PBS, and kept on ice for later use. The signal intensity of the samples in the FITC channel was detected by flow cytometry to determine the phagocytosis of OMVs-EGFP by RAW264.7 cells. Figure 4-5 , RAW264.7 cells can take up bacterial outer membrane vesicle protein drug delivery system. As the dose of OMVs-EGFP in the RAW264.7 cell co-culture system increases, RAW264.7 cells show stronger and stronger FITC signals in flow cytometry. This shows that OmpA-SpyTag OMVs can be covalently linked to SpyCatcher-EGFP, RAW264.7 can engulf OMVs-EGFP, and the autofluorescence function of EGFP is not affected after engulfment.

[0081] (2) Explore the incubation conditions of bacterial outer membrane vesicles and SpyCatcher-target proteins: Use OmpA-SpyTag OMVs and SpyCatcher-RFP to explore the optimal co-incubation conditions by changing the incubation time with a fixed incubation dose, and changing the incubation dose with a fixed incubation time. Use Western blot to detect the location of the HA tag carried by OmpA-SpyTag OMVs, and compare the binding efficiency by grayscale analysis of the bands. Figure 6 , the mass ratio of OmpA-SpyTag OMVs to SpyCatcher was 1:20, the incubation conditions were 37°C, and the tags on OmpA-SpyTag OMVs were bound with maximum efficiency at 5 h.

[0082] (2) Construction of bacterial outer membrane vesicle protein drug delivery system: Western blot was used to detect the changes in the position of the 6His tag carried by SpyCatcher-nanoantibody to verify whether it binds to OmpA-SpyTag OMVs. Figure 7 Both SpyCatcher-nanoantibodies showed obvious binding bands at around 50KDa, indicating that they can bind to OmpA-SpyTagOMVs, proving that the bacterial outer membrane vesicle protein drug delivery system was successfully constructed.

[0083] (3) The present invention realizes the step-by-step and plug-and-play OMVs extraction and protein or antigen connection by designing the abundant outer membrane protein OmpA and using the SpyTag / SpyCatcher system. In order to reduce the background expression level of the outer membrane protein OmpA in VNP20009, the present invention uses CRISPR-Cas9 to knock out the OmpA gene, and finds that the growth limit of bacteria lacking the OmpA gene is reduced, the Zeta potential of the bacterial surface is significantly reduced, and the particle size of ΔOmpA-OMVs is reduced. In addition, during the experiment, the present invention also found that compared with VNP20009, the plasmid is more difficult to transfer into the defective strain ΔOmpA-VNP with lower surface charge, and the conversion efficiency is relatively low. It can be seen that OmpA is very important for maintaining the normal growth of bacteria and resisting stress environments. After complementing the overexpressed OmpA-N terminus and the OmpA-N terminus variants inserted with SpyTag, the particle size distribution of OMVs from each defective strain is still smaller than that of VNP-OMVs, and is concentrated at around 20 to 80 nm. The surface Zeta potential of ΔOmpA-OMVs expressing the natural OmpA-N terminus was restored to the normal level of VNP20009, and the surface Zeta potential of the two defective bacteria expressing the OmpA-N terminus variants inserted with SpyTag was slightly higher than that of the defective bacteria, but still lower than the normal level, indicating that the insertion of SpyTag affected the efficiency of the OmpA-N terminus inserting into the outer membrane. Combined with the Western Blot method, the present invention proves that the overexpressed OmpA-SpyTag variant can still be inserted into the bacterial outer membrane. By co-incubating with SpyCatcher-EGFP, the present invention found that only the OmpA-SpyTag variant with GS sequences inserted on both sides can bind to SpyCatcher-EGFP, and the binding bands are verified by Western Blot. It is proved that OmpA-GS-SpyTag-OMVs can effectively load the corresponding protein through the SpyTag / SpyCatcher system by microplate reader, fluorescence microscope and flow analysis.

[0084] Test Example 1

[0085] Exploring the effects of bacterial outer membrane vesicles on macrophages

[0086] (1) Culture and treatment of RAW264.7 cells: RAW264.7 cells were cultured in six-well plates. When the cell density reached about 60%, the following groups were set: NC (i.e., adding an equal volume of PBS), LPS (final concentration of 10 μg / mL), OmpA-SpyTag OMVs-5 μg / mL, 10 μg / mL, 20 μg / mL, 40 μg / mL. After the treatment, the cells were cultured for 24 h. After discarding the cell culture medium, each well was washed twice with PBS, 1 mL of Trizol was added, and the cells were allowed to stand at room temperature for 3 min, then gently pipetted and transferred to a 1.5 mL EP tube.

[0087] (2) RNA extraction and reverse transcription: Total RNA was extracted using Trizol reagent; Total RNA was extracted using ReverTra cDNA was obtained by reverse transcription using qPCR RT kit.

[0088] (3) Real-time fluorescence quantitative PCR determination of M1 polarization markers TNFα, iNOS, and IL-1β: The cDNA obtained by reverse transcription was diluted 40 times with deionized water to prepare the qPCR reaction system. The nucleotide sequences of the qPCR primers are as follows:

[0089] 18s F:GTAACCCGTTGAACCCCATT

[0090] R:CCATCCAATCGGTAGTAGCG

[0091] TNFαF:ACCACGCTCTTCTGTCTACT

[0092] R:AGGAGGTTGACTTTCTCCTG

[0093] iNOS F:GTTCTCAGCCCAACAATACAAGA

[0094] R:GTGGACGGGTCGATGTCAC

[0095] IL-1βF:GAAATGCCACCTTTTGACAGTG

[0096] R:TGGATGCTCTCATCAGGACAG

[0097] Add to 96-well plate for qPCR under light-proof condition, centrifuge and test on the machine. Figure 3As shown in AC, OmpA-SpyTagOMVs can significantly promote the upregulation of the expression of M1 polarization markers TNFα, iNOS, and IL-1β in RAW264.7 cells, indicating that SpyTag-OMVs can promote the polarization of RAW264.7 cells to the M1 phenotype.

[0098] (4) RAW264.7 cell proliferation detection: A small amount of RAW264.7 cells were evenly spread in a 96-well plate. When the cell density grew to about 60%, the following groups were set: NC (i.e., adding equal volume of PBS), OmpA-SpyTag OMVs-1μg / mL, 2μg / mL, 4μg / mL, 8μg / mL, 16μg / mL, with 6 replicate wells in each group. After the drug treatment, the cells were cultured for 24 hours. The proliferation of RAW264.7 was then detected using the CCK-8 method. Figure 3 As shown in D, OmpA-SpyTag OMVs can significantly promote the proliferation of RAW264.7 cells.

[0099] Test Example 2

[0100] Evaluation of the therapeutic effect of bacterial outer membrane vesicle protein drug delivery system on tumors

[0101] (1) Construction of subcutaneous breast cancer tumor model: Female BALB / c mice were adaptively raised for 7 days. 75 mm 2 4T1 cells were cultured in a cell culture flask, digested and resuspended with trypsin, washed twice with PBS, and finally resuspended with PBS to a final cell concentration of 10 6 The hair under the right armpit of the mice was removed, and 100 μL of 4T1 cell suspension was injected subcutaneously into each mouse.

[0102] (2) Treatment plan for 4T1 subcutaneous tumor-bearing mice: When the volume of the subcutaneous tumor of the mouse grows to about 100 mm 3 At 14:00 pm, mice were randomly divided into cages and divided into groups: PBS, TNFαnb (0.2 mg / kg), OmpA-SpyTag OMVs (1 mg / kg), and OMVs-TNFαnb (1 mg / kg + 0.2 mg / kg). The drug was administered via tail vein, and then again via tail vein every 4 days, for a total of 3 times. The body weight and tumor size of the mice were monitored every 2 days during the treatment.

[0103] The test results are as follows Figure 8-9As shown in the figure, the first tail vein administration caused the weight of mice to decrease, and then the weight gradually recovered, indicating that OMVs have good biocompatibility. At the same time, OMVs-TNFαnb can significantly inhibit tumor growth compared with other single-drug administration groups. It can also be seen from the survival curve that compared with other single-drug administration groups, OMVs-TNFαnb can significantly prolong the tumor-bearing survival period of mice.

[0104] (5) Construction of subcutaneous melanoma tumor model: Female C57BL / 6 mice were adaptively raised for 7 days. 75 mm 2 B16F10 cells were cultured in a cell culture flask, digested and resuspended with trypsin, washed twice with PBS, and finally resuspended with PBS to a final cell concentration of 10 6 The hair under the right armpit of the mice was removed, and 100 μL of B16F10 cell suspension was injected subcutaneously into each mouse.

[0105] (6) Treatment plan for B16F10 subcutaneous tumor-bearing mice: When the volume of the subcutaneous tumor of the mouse grows to about 100 mm 3 At 4 d, mice were randomly divided into cages and divided into groups: PBS, PD1 nb (0.2 mg / kg), OmpA-SpyTag OMVs (1 mg / kg), and OMVs-PD1 nb (1 mg / kg + 0.2 mg / kg). The drug was administered via tail vein, and then again via tail vein every 4 days, for a total of 3 times. The body weight and tumor size of the mice were monitored every 2 days during the treatment.

[0106] The test results are as follows Fig.10 As shown in the figure, three tail vein administrations of OMVs caused a decrease in the weight of mice, but the weight of mice recovered the next day, indicating that OMVs have good biocompatibility. In addition, OMVs-PD1 nb can significantly inhibit tumor growth compared with other single-drug administration groups.

[0107] In the Lewis lung cancer subcutaneous tumor-bearing mouse model, the present invention used OMVs-TNFαnb and OMVs-PD1nb to carry out the same anti-tumor experiment as 4T1 and B16F10, and obtained the same Figure 8-10 Similar results.

[0108] In summary, the present invention is based on bacterial outer membrane vesicles derived from attenuated Salmonella typhimurium VNP20009, combined with microbial synthetic biology technology to construct a universal bacterial outer membrane vesicle protein drug delivery system, which uses SpyTag / SpyCatcher protein pairs to flexibly display multiple proteins on the surface of OMVs, achieve in vivo delivery of protein drugs, and protect them from being cleared. At the same time, combined with the immunostimulatory properties of OMVs themselves, the purpose of combined tumor treatment is achieved, and it has a certain biosafety. The present invention describes an efficient, flexible and convenient bacterial outer membrane vesicle protein drug delivery system, which makes up for the defect of difficult protein drug delivery and lays a good foundation for carrying more protein drugs for tumor treatment.

[0109] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments, and the above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, and the scope of protection of the present invention is defined by the attached claims, description and their equivalents.

Claims

1. A method for preparing a bacterial outer membrane vesicle protein drug delivery system derived from attenuated Salmonella, characterized in that The steps include: (1) Knockout of OmpA protein of attenuated Salmonella typhimurium VNP20009: step 1: design sgRNA and upstream and downstream homologous recombination primers, the nucleotide sequence of sgRNA is shown in SEQ ID NO.3, the nucleotide sequence of the first upstream homologous recombination primer in the first homologous recombination primer pair is shown in SEQ ID NO.4, and the nucleotide sequence of the first downstream homologous recombination primer is shown in SEQ ID NO.5; in the second homologous recombination primer pair, the nucleotide sequence of the second upstream homologous recombination primer is shown in SEQ ID NO.6, and the nucleotide sequence of the second downstream homologous recombination primer is shown in SEQ ID NO.7; step 2: construct PTAT-ΔOmpA-RFP; step 3: construct pCas-VNP strain, and induce recombinase expression with arabinose; step 4: electrotransform the PTAT-ΔOmpA-RFP plasmid into the pCas-VNP strain; step 5: remove the PTAT-ΔOmpA-RFP plasmid and the pCas plasmid; the nucleotide sequence of attenuated Salmonella typhimurium VNP20009 is SEQ The polynucleotide fragment of SEQ ID NO.1 is deleted, and SEQ ID NO.1 is replaced by SEQ ID NO.2; (2) using genetic engineering methods to construct OmpA-SpyTag and SpyCatcher-target protein fusion protein expression plasmids respectively: step 1 design homologous recombination primers; step 2 PCR to obtain DNA fragments; step 3 chemically transforming the recombinant products into chemically competent cells of Escherichia coli DH5α; wherein the amino acid sequence of SpyTag is shown in SEQ ID NO.8, and the amino acid sequence of SpyCatcher is shown in SEQ ID NO.9; (3) Construction of attenuated Salmonella recombinant engineering bacteria expressing OmpA-SpyTag fusion protein: The expression plasmid was electroporated into attenuated Salmonella typhi VNP20009 in which OmpA protein was knocked out to obtain attenuated Salmonella recombinant engineering bacteria expressing OmpA-SpyTag; (4) Extraction of bacterial outer membrane vesicles of attenuated Salmonella recombinant engineering bacteria: step 1: culturing attenuated Salmonella recombinant engineering bacteria at 37°C and 150rpm; step 2: collecting bacterial solution by low-speed centrifugation; step 3: purifying and concentrating the bacterial solution by filter membrane and ultrafiltration tube; step 4: removing the supernatant after ultracentrifugation, adding PBS to the ultracentrifuge tube for resuspending and ultracentrifuging, and finally removing the supernatant, resuspending the precipitate with PBS to obtain the desired OmpA-SpyTag bacterial outer membrane vesicles OMVs; (5) Purification of SpyCatcher-target protein fusion protein: step 1 extract recombinant plasmid; step 2 chemically transform the recombinant plasmid into chemically competent cells of Escherichia coli BL21 (DE3); step 3 IPTG induces fusion protein expression; step 4 low-speed centrifugation to collect bacterial liquid, and high-pressure cell disruptor is used to lyse bacteria; step 5 high-speed centrifugation to collect supernatant, and purification is performed through filter membrane; step 6 purifies the fusion protein by nickel column affinity chromatography; (6) Construction of bacterial outer membrane vesicle protein drug delivery system: The target protein carrying SpyCatcher was mixed and incubated with OmpA-SpyTagOMVs.

2. The method for preparing the bacterial outer membrane vesicle protein drug delivery system derived from attenuated Salmonella according to claim 1, characterized in that: In step (1), the coding gene of the SpyTag protein is inserted into the expression plasmid of the bacterial outer membrane protein OmpA by gene recombination, comprising the constitutive promoter J23100, and fused and expressed in attenuated Salmonella to obtain bacterial outer membrane vesicles; the attenuated Salmonella is a recombinant engineered bacterium derived from attenuated Salmonella typhimurium VNP20009, in which the coding gene of the OmpA protein is knocked out, and carries the expression plasmid of the OmpA-SpyTag fusion protein.

3. The method for preparing the bacterial outer membrane vesicle protein drug delivery system derived from attenuated Salmonella according to claim 1, characterized in that: In step (2), SpyTag is connected to flexible linkers on both sides and inserted into the extracellular loop domain of OmpA, and an HA tag is connected to the C-terminus. The fusion protein encoding gene is cloned into an expression vector containing the promoter J23100 and the anti-plasmid loss element AT; SpyCatcher is connected to the target protein through a flexible linker and a 6×His tag is connected to the C-terminus. The fusion protein encoding gene is cloned into the pET-28a expression vector.

4. The method for preparing the bacterial outer membrane vesicle protein drug delivery system derived from attenuated Salmonella according to claim 1, characterized in that: In step (2), the target protein includes but is not limited to EGFP, RFP fluorescent protein, nano-antibodies and tumor antigens; in step (4), the low-speed centrifugation speed is 5000 rpm, and the centrifugation is 20 min; the pore size of the filter membrane is 0.45 μm and 0.22 μm; the molecular weight cutoff of the ultrafiltration tube is 100 kDa, and the supernatant liquid is filtered through 0.45 μm and 0.22 μm filter membranes in turn before ultrafiltration; the speed used for ultracentrifugation is 120,000 g, and the centrifugation time is 3 h.

5. The method for preparing the bacterial outer membrane vesicle protein drug delivery system derived from attenuated Salmonella according to claim 1, characterized in that: In step (5), the inducing agent is IPTG, and the optimal induction concentration is 1 mM; the high-speed centrifugation speed is 12000 rpm, and the centrifugation is 10 min; the OmpA-SpyTag OMVs and SpyCatcher-target protein are mixed and incubated at a mass ratio of 1:5-1:50, and the mixing time is 5 h.

6. A bacterial outer membrane vesicle protein drug delivery system derived from attenuated Salmonella obtained by the preparation method according to any one of claims 1 to 3.

7. The bacterial outer membrane vesicle protein drug delivery system derived from attenuated Salmonella according to claim 6, characterized in that: The method comprises the bacterial outer membrane vesicles as claimed in claim 1, and a protein drug carrying SpyCatcher, wherein the SpyTag expressed by fusion with OmpA on the bacterial outer membrane vesicles can be connected to the protein carrying SpyCatcher in the form of an isopeptide bond, thereby displaying the protein on the surface of the bacterial outer membrane vesicles.

8. Use of the bacterial outer membrane vesicle protein drug delivery system derived from attenuated Salmonella according to claim 7 in activating macrophages, characterized in that: Co-culturing the bacterial outer membrane vesicle protein drug delivery system prepared according to claim 7 with the macrophage cell line RAW264.7 cells can promote the polarization of RAW264.7 cells to the M1 phenotype and significantly promote the proliferation of RAW264.7 cells, and has immunostimulatory properties.

9. Use of the bacterial outer membrane vesicle protein drug delivery system derived from attenuated Salmonella according to claim 6 in the preparation of anti-tumor drugs.

10. The use according to claim 9, characterized in that: The SpyCatcher-nanobody fusion protein is co-incubated with OmpA-SpyTag OMVs and can inhibit tumor growth in mice after tail vein administration. The nanobodies include but are not limited to anti-PD1 nanobodies and anti-TNFα nanobodies, and the tumors include but are not limited to melanoma, lung cancer, and breast cancer.

Images