Omvogenic outer membrane protein engineering for outer membrane vesicle production
Engineered OMPs with PagC extracellular loops and histidine modifications enhance OMV production in response to pH, addressing the lack of understanding in OMV biogenesis and increasing production for biotechnological applications.
Patent Information
- Application Number
- PCT/US2025/035938
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-06-28
- Filing Date
- 2025-06-30
- Publication Date
- 2026-01-02
AI Technical Summary
A comprehensive mechanistic understanding of outer membrane vesicle (OMV) biogenesis in Gram-negative bacteria remains elusive, particularly regarding the role of outer membrane proteins in OMV production and their response to environmental pH changes.
Engineered outer membrane proteins (OMPs) comprising extracellular loops from Salmonella enterica serovar Typhimurium protein PagC, specifically modified with histidine residues to mimic acidic conditions, enhance OMV production by altering membrane curvature and flexibility in response to pH changes.
The engineered OMPs increase OMV production by 2-fold to 10-fold, providing a novel mechanism for controlling membrane dynamics and enhancing OMV production for applications like vaccine development and drug delivery.
Smart Images

Figure US2025035938_02012026_PF_FP_ABST
Abstract
Description
Docket No.650053.01207 OMVOGENIC OUTER MEMBRANE PROTEIN ENGINEERING FOR OUTER MEMBRANE VESICLE PRODUCTION CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional Patent Application Serial No. 63 / 666,045, filed June 28, 2024, the entire content of which is incorporated by reference in its entirety. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0002] This invention was made with government support under grant numbers GM118186, AI042347, and AI139982 awarded by the National Institutes of Health. The government has certain rights in this invention. REFERENCE TO AN ELECTRONIC SEQUENCE LISTING
[0003] This application includes an electronically submitted Sequence listing (65005301207.xml; Size: 63,754 bytes; and Date of Creation: June 26, 2025). The contents of the electronic sequence listing are herein incorporated by reference in their entirety. BACKGROUND
[0004] Gram-negative bacteria release outer membrane vesicles (OMVs) into the environment as a mechanism for secretion and maintenance of cell envelope homeostasis (1, 2). OMVs are spherical nanometer-sized structures that originate from the bacterial outer membrane (OM). They comprise a lipid bilayer composed of lipopolysaccharides (LPS), phospholipids, and proteins, and a lumen that is enriched for periplasmic components. OMVs are implicated in diverse processes that are fundamental for microbe-host interactions, including quorum sensing, interbacterial killing, biofilm formation, virulence, toxin delivery, immune evasion, and colonization (3-5). Moreover, OMVs provide an attractive platform for biotechnology applications, including vaccine development and drug delivery (2, 6). Despite their importance, a comprehensive mechanistic understanding of OMV biogenesis remains elusive. SUMMARY
[0005] In a first aspect, engineered outer membrane proteins (OMPs) modified to comprise one or more extracellular loop (EL) from Salmonella enterica serovar Typhimurium protein PagC (PagC) or a functional portion thereof are provided.
[0006] In a second aspect, polynucleotides that encode a disclosed engineered OMP are provided.
[0007] In a third aspect, cells that express a disclosed engineered OMP are provided.Docket No.650053.01207
[0008] In a fourth aspect, methods that comprise expressing a disclosed engineered OMP in a cell are provided. BRIEF DESCRIPTION OF THE DRAWINGS
[0009] FIGS.1A-1D show lipid A modifications of liposaccharides (LPS) from wild-type and pagC deletion mutant (^pagC) Salmonella enterica serovar Typhimurium (STm). LPS was purified from wild-type and ^pagC bacteria or outer membrane vesicles (OMVs), grown in PhoPQ-inducing conditions (5.8L media), non-PhoPQ-inducing conditions (7.6H media), or lysogeny broth (LB media). (A) Structure of the major form of STm LPS showing lipid A (blue) with GlcN (d-glucosamine); inner core (green) with KDO (2-keto-3- deoxyoctulosonic acid) and Hep (l-glycero-d-manno-heptose); outer core (pink) with Glu (d-glucose) and Gal (d- galactose); and O-antigen (pink) with GlcNAc (N-acetylglucosamine). PagP adds a palmitoyl chain (C16:0) to C2 of GlcNI (green). PagL deacylases C3 of GlcN-I 3 (red). (B) Mass spectrometry analysis of LPS isolated from bacteria grown under PhoPQ-inducing conditions (n≥3 biological replicates). Assignment of m / z peaks was based on previous work (26). (C) Gas chromatography analysis of LPS isolated from OMVs of wild-type and ^pagC STm grown in LB, 7.6H, or 5.8L media. Acyl chain moieties correspond to C12, C14, C16, 2OHC14, and 3OHC14 (n≥3 biological replicates). No statistically significant differences (p>0.05) were found between the groups grown in different conditions using one-way ANOVA multiple- comparison test. (D) SDS-PAGE analysis of LPS purified from wild-type and ^pagC bacteria, visualized with Pro-Q Emerald LPS gel stain (n≥3 biological replicates).
[0010] FIGS. 2A-2C show outer membrane vesicle (OMV) production by PagC-Rck chimeras. (A) Number of OMVs produced by pPagC, pRcK, pPagC-Rck chimeras, or pRS1 (empty plasmid) in a ΔpagC, Δrck, ΔompX, ΔpgtE STm mutant strain. Mean values with standard error of the mean (s.e.m.) are shown (n^3 biological replicates). Statistical significance was calculated using one-way ANOVA multiple-comparison test and set at a p value <0.05 (*: p<0.05; **: p<0.01; ns: p>0.05). The p-values indicated above the bars represent comparison to pPagC and p-values above the brackets represent comparison to pRck. (B) AlphaFold structural model of PagC showing basic side chains (yellow sticks). (C) Sequences of PagC, RcK, and Ail viewed in the context of the canonical eight-stranded β-barrel topology with four extracellular loops (EL1-EL4) and three intracellular turns (T1-T3). Colors reflect sidechains facing the barrel exterior (color-filled) or the barrel interior (white), basic (blue) or acidic (red) sidechains, and His (yellow). Dashed lines represent hydrogen bonds.Docket No.650053.01207
[0011] FIGS. 3A-3F show the conformation of the pH response motif of PagC. (A) Representative structure (taken at 3 µs) of one independent molecular dynamics (MD) simulation of His-neutral PagC in the STm OM. (B) Sequence alignment of the ascending and descending neighboring segments of EL2 and EL3 rendered with ClustalX coloring using Jalview (33). (C-E) MD simulations of His-neutral (C, D; 2394 ns) or His-protonated (E; 2668 ns) PagC. Models show key His and Phe sidechains (yellow stick) and basic and acidic sidechains (stick). The OM outer leaflet is LPS (blue, green, pink lines) and the inner leaflet is phospholipid (yellow lines). (F) Time-averaged root-mean-square-fluctuation (RMSF) of PagC residues calculated for carbon atoms. Each trace is the average over the last 2 µs of three independent 3 µs MD simulations of His-neutral (blue) or His-protonated (red) PagC. Protein secondary structure is shown above the data.
[0012] FIGS.4A-4E show the role of pH-responsive His residues in OMV production. (A-C) Number of OMVs produced by His mutants in the background of the pRcK-PagC2chimera (A) or pPagC (B, C). Bacteria transformed with empty plasmid pRS1 serve as negative control. In A and B, statistical significance was calculated using a one-way ANOVA multiple- comparison test set at a p value <0.05 (*, p<0.05; **, p<0.01; ns, p > 0.05). In C, statistical significance was calculated using a non-parametric unpaired t-test set at a p value <0.05 (*, p<0.05; **, p<0.01; ns, p > 0.05). Mean values with s.e.m. are shown (n≥3 biological replicates). (D) Probability distribution of His-His distances. Each trace is the average over the last 2 µs of three independent 3 µs MD simulations of PagC with neutral (blue) or protonated (red) His. (E) Model for PagC-dependent OM vesiculation in response to pH.
[0013] FIGS. 5A-5B show the sequence and structure of PagC, RcK, and Ail. (A) Structure-based sequence alignment of PagC, RcK, and Ail. Alignments are rendered with ClustalX coloring using Jalview (33). (B) Structural models of the proteins derived from AlphaFold (PagC, RcK) or determined experimentally (Ail), showing basic side chains (yellow stick with carbon atom as yellow sphere).
[0014] FIG.6 shows sequences of PagC-RcK chimeric mutants. PagC (black) and Rck (red) chimeras were expressed in quadruple mutant STm (ΔpagC, Δrck, ΔompX, ΔpgtE) bacterial cells.
[0015] FIGS. 7A-7B show a comparison of the growth of wild-type STm to that of ΔpagC, Δrck, ΔompX, and ΔpgtE mutants. (A) Growth curve of wild-type (WT), ΔpagC, and ΔpagCΔrckΔompXΔpgtE STm grown in LB media. STm was grown at 37℃, 180 rpm and the optical density at 600 nm (OD600) was measured every 10 minutes for 24 hours. Results represent three biological replicates. (B) Representative images of WT andDocket No.650053.01207 ΔpagCΔrckΔompXΔpgtE STm captured by transmission electron microscopy (TEM). The bacteria were grown in LB media or PhoPQ inducing 5.8L media, stained with 1% aqueous uranyl acetate and viewed under Tecnai 12 electron microscope.
[0016] FIGS. 8A-8B show results generated with PagC Ala substitution mutants. (A) Number of OMVs produced by wild-type (WT) and PagC mutants, with ^pagC serving as a negative control. Mean values with standard error of the mean (s.e.m.) are shown (n^3 biological replicates). Statistical significance was calculated using one-way ANOVA multiple- comparison test (****: p<0.0001). Expression of PagC protein in whole cell lysate and bacterial OM fraction was detected by western blotting with anti-PagC antibody as the primary antibody. (B) Chart showing the residues of RcK and Ail that correspond to the residues mutated in PagC.
[0017] FIGS. 9A-9E show MD simulations of PagC. (A, B) Probability distribution and time evolution of β-barrel tilt angle. (C-E) Probability distribution and time evolution of His-His atomic distance. Data represent His-neutral (blue) and His-protonated (red) PagC in an STm OM, analyzed over the last 2 µs of three independent 3 µs MD simulations, or His- neutral PagC in a symmetric lipid bilayer (black), analyzed over the last 1 µs of two independent 1.5 µs MD simulations. Each time evolution trace is one independent MD simulation.
[0018] FIGS. 10A-10F show PagC–LPS polar contacts established during MD simulation. Contacts between PagC Arg, Lys, and His side chain atoms and LPS phosphate P atoms (Pi) were selected with a cutoff distance of 10 Å and a cutoff MD simulation lifetime longer than 100 ns. Data were obtained for His-neutral (blue) or His-protonated (red) PagC in an STm membrane. Data from the last 2 µs of each independent 3 µs MD simulation were analyzed. (A, C) Probability density of PagC-LPS contacts per atomic distance. Probabilities are normalized to the total number of contacts formed by His-neutral and His-protonated PagC with LPS Pi, thus the area under each histogram reflects the number of LPS contacts made by each state of PagC. (B, D) Time evolution traces of the contact during the 3 µs MD simulation. (E) LPS molecular structure. Four Pi groups are marked, two from the KDO moiety and two from the inner core Hep moiety. (F) Representative structures taken at 3 µs of MD simulation for His-neutral (blue) or His-protonated (red) PagC. Associated LPS molecules are shown as sticks. Dashed lines between PagC and LPS denote polar contacts.
[0019] FIGS.11A-11C show time-averaged PagC residue contribution to RMSF. (A, B) Time-averaged RMSF of PagC residues calculated for carbon atoms. Protein secondaryDocket No.650053.01207 structure is shown above the data. In (A), each trace is the time average over the last 2 µs for one independent 3 µs MD simulations of His-neutral (blue) or His-protonated (red) PagC. In (B), each trace is the time average over the last 1 µs for one independent 1.5 µs MD simulation of His-neutral PagC in a symmetric lipid bilayer. (C) Probability distribution and time evolution of His-Glu55 atomic distances (between atoms His-CG – Glu-CD). Data represent His-neutral (blue) and His-protonated (red) PagC in an STm OM, analyzed over the last 2 µs of three independent 3 µs MD simulations. Each time evolution trace is one independent MD simulation.
[0020] FIGS. 12A-12C show time-averaged contacts of PagC residues with the Stm OM. (A, B) Contact frequency for His-neutral (A) and His-protonated PagC (B). Each bar represents the frequency of 4 Å proximity to water, phospholipid moieties, LPS moieties, and Ca2+ions. Interactions are averaged over the last 2 µs of 3 µs MD trajectories and three independent MD simulations. The protein secondary structure is depicted above the data. (C) Difference in residue contacts of PagC residues induced by His protonation. Positive change reflects His protonation and negative changes reflect His deprotonation.
[0021] FIGS.13A-13D show a principal component (PC) analysis of MD simulations. PC analysis was performed by concatenating three independent 3 µs MD simulations for either His-neutral (blue) or His-protonated (red) PagC. The data reflect variance of backbone heavy atom cartesian coordinates relative to the average of the concatenated structure. (A, B) Conformer plots (A) and corresponding histograms (B) of PagC structures defined by the three principal components of the motion: PC1, PC2, and PC3. Each point represents a structure, and the point color indicates each of the three MD trajectories of His-neutral PagC (blue shades) or His-protonated PagC (red shades). (C) Plots of the % variance show that motion along PC1 is dominant. (D) Representative structures taken from MD simulations of His-neutral (blue) or His-protonated (red) PagC at the specific values of the PC1 principal component of conformational exchange corresponding to populations in panel (B). DETAILED DESCRIPTION
[0022] This disclosure provides engineered outer membrane proteins (OMPs) that comprise one or more extracellular loop (EL) from the Salmonella enterica serovar Typhimurium protein PagC (PagC) or a functional portion thereof, polynucleotides encoding the engineered OMPs, and cells that express the engineered OMPs. Methods of expressing the engineered OMPs in a cell, such as Gram-negative bacteria, to increase the production of outer membrane vesicles (OMVs) are also provided.Docket No.650053.01207
[0023] Gram-negative bacteria are surrounded by a cell envelope that consists of both an outer membrane and an inner membrane. The outer membrane comprises phospholipids, lipopolysaccharides, lipoproteins, and integral membrane proteins called outer membrane proteins (OMPs). To interact with their environment, Gram-negative bacteria produce small (100–300 nm) bilayered vesicles derived from the outer membrane, which are referred to outer membrane vesicles (OMVs).
[0024] The Gram-negative bacterium Salmonella enterica serovar Typhimurium (STm) is a facultative intracellular pathogen that can survive and replicate in both phagocytic and nonphagocytic cells. It survives inside the acidic vacuoles of host cells by changing expression of outer membrane proteins and modifying the composition of lipid A in its outer membrane to increase outer membrane vesicle (OMV) production.
[0025] In this disclosure with the Examples, the inventors demonstrate that an outer membrane protein produced by STm, referred to as PagC, promotes OMV production through pH-dependent interactions between its extracellular loops and the surrounding lipopolysaccharides. Molecular dynamics simulations indicate that protonation of three histidine residues in the extracellular loops leads to marked changes in the structure and flexibility of the loops that result in an altered membrane curvature. Further, mimicking an acidic pH by mutating these histidine residues to lysine increases OMV production. Collectively, these findings reveal a novel mechanism by which OMPs can sense environmental pH and respond by controlling membrane dynamics.
[0026] OMVs can be used to carry diverse cargos and can be engineered to incorporate heterologous proteins, such as antigens. Thus, OMVs have been employed for applications such as vaccine development, drug delivery, bioimaging, and biosensing. The ability to increase OMV production could be useful for any such application.
[0027] Engineered outer membrane proteins
[0028] In a first aspect, engineered outer membrane proteins (OMPs) modified to comprise one or more extracellular loops from PagC or a functional portion thereof are provided.
[0029] The OMP of the present disclosure is “engineered,” meaning that they have been altered by the hand of man. Specifically, the OMPs of the present disclosure have been engineered to comprise a portion of the protein PagC, i.e., one or more extracellular loops or a functional portion thereof. This engineering may be accomplished by making either a substitution modification or an insertion modification in a wild-type OMP. For example, in some embodiments, the OMP is modified via substitution of one or more endogenousDocket No.650053.01207 extracellular loops or a portion thereof with the portion of PagC. The term “substitution” describes a replacement of one or more amino acid in a wild-type protein with a different amino acid. In other embodiments, the OMP is modified via addition of the portion of PagC (i.e., without removing any portion of the wild-type OMP). The term “insertion” describes an addition of one or more amino acid relative to a wild-type protein. An insertion may add one or more amino acid residue, for example 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, or more, to a protein.
[0030] The engineered OMPs are generated by modifying a wild-type OMP. The term “wild-type” is used herein to describe the non-modified version of a protein or an enzyme that is most typically found in nature. In the Examples, the inventors compared the sequence and structure of PagC to that of two related proteins, Rck from Salmonella enterica serovar Typhimurium (SEQ ID NO: 5) and Ail from Yersinia pestis (SEQ ID NO: 10). Thus, in some embodiments, the engineered OMP is derived from a wild-type OMP selected from Rck and Ail.
[0031] PagC comprises four extracellular loops (loops 1-4; or EL1, EL2, EL3, EL4). In the Examples, the inventors demonstrate that loop 2 (EL2) and loop 3 (EL3) are required for PagC’s OMV production promoting activity. Further, they demonstrate that substituting loop 2 and / or loop 3 of the PagC homolog Rck with loop 2 and / or loop 3 of PagC is sufficient to confer this OMV production promoting activity to Rck. In disclosed embodiments, the one or more extracellular loops of PagC included in the engineered OMP comprise loop 2 and / or loop 3 of PagC.
[0032] In some embodiments, loop 2 comprises the wild-type loop 2 sequence (i.e., the loop 2 sequence found in wild-type PagC; SEQ ID NO: 2). In some embodiments, loop 3 comprises the wild-type loop 3 sequence (i.e., the loop 3 sequence found in wild-type PagC; SEQ ID NO: 3). In the Examples, the inventors identify three histidine residues in the extracellular loops of PagC that become protonated in mildly acidic pH, namely H60 and H62 in loop 2 and H102 in loop 3. As demonstrated, mutating one or more of these histidine residues to lysine (i.e., to mimic acidic conditions) enhances OMV production relative to wild-type PagC (FIG.4B). In some embodiments, loop 2 comprises one or more substitution mutations selected from H60K and H62K. In some embodiments, loop 3 comprises the substitution mutation H102K. (Note: The positions of these histidine residues are numbered with respect to the mature PagC protein sequence, which is disclosed as SEQ ID NO: 11).
[0033] As described in the Examples, the inventors generated a series of Rck-PagC chimeric proteins wherein one or more extracellular loops of the PagC homolog Rck wereDocket No.650053.01207 replaced with their counterparts from PagC. Specifically a chimeric Rck protein was generated in which extracellular loop 2 is replaced with extracellular loop 2 of PagC (Rck-PagC2; SEQ ID NO: 6 and SEQ ID NO: 68), a chimeric Rck protein in which extracellular loop 3 is replaced with extracellular loop 3 of PagC (Rck-PagC3; SEQ ID NO: 7 and SEQ ID NO: 67), and a chimeric Rck protein in which a region or portion encompassing extracellular loops 2 and 3 is replaced with a region encompassing extracellular loops 2 and 3 of PagC (Rck-PagC2-3; SEQ ID NO: 8 and SEQ ID NO: 66). The chimeras Rck-PagC2-3of SEQ ID NO: 66, Rck-PagC3of SEQ ID NO: 67, and Rck-PagC2of SEQ ID NO: 68 were expressed in a STm mutant lacking pagC and their effect on OMV production was measured (FIG. 2A). The results demonstrate that substituting either one or both of the extracellular loops 2 and 3 results in increased OMV production in STm. In disclosed embodiments, the engineered OMP is selected from Rck- PagC2(SEQ ID NO: 6 or SEQ ID NO: 68), Rck-PagC3(SEQ ID NO: 7 or SEQ ID NO: 67), and Rck-PagC2-3(SEQ ID NO: 8 or SEQ ID NO: 66).
[0034] Extracellular loops 2 and 3 of Rck were substituted with SEQ ID NO: 4, which is a portion of wild-type PagC that encompasses extracellular loops 2 and 3 and includes several additional amino acid residues, i.e., the 13 residues N-terminal to loop 2, and the 21 residues between loop 2 and loop 3 in the PagC protein sequence (SEQ ID NO: 1 or SEQ ID NO: 11). Thus, in some embodiments in which the one or more extracellular loops comprise both loop 2 and loop 3 of PagC, the engineered OMP comprises SEQ ID NO: 4.
[0035] In some embodiments, the engineered OMP comprises a functional portion of extracellular loop 2 and / or extracellular loop 3 of PagC. As used herein, the term “functional portion” refers to a portion of a PagC extracellular loop that promotes OMV production and confers this activity to other OMPs into which it is inserted. Several features of PagC that form a pH response motif are identified in this disclosure. These features include two amino acid segments with inverse homology that allow for complementary ring stacking interactions across the loop 2-loop 3 interface, namely residues 60-69 in the descending segment of loop 2 and residues 102-95 in the ascending segment of loop 3 (FIG.3B, numbered relative to mature PagC of SEQ ID NO:11 as described below). Thus, in some embodiments, the functional portion comprises residues 60-69 and / or residues 95-102 of PagC. Additionally, these features include three histidine residues in the extracellular loops of PagC that become protonated in mildly acidic pH, namely H60 and H62 in loop 2 and H102 in loop 3. Thus, in some embodiments, the functional portion comprises one or more of H60, H62, and H102. It is noted that the numbering of residues discussed above is based on their positions within the mature PagC protein (SEQ ID NO: 11), from which a 23-amino-acid N-terminal signal sequence hasDocket No.650053.01207 been removed. Throughout this disclosure, these residues in PagC (HIS as well as other segments (e.g. FIG.3B) are numbered relative to mature PagC of SEQ ID NO:11. The positions of these residues can be converted to their positions within the full-length wild-type PagC protein (SEQ ID NO: 1) by adding 23. For example, H60 is found at position 83 (60 + 23) in SEQ ID NO: 1. Additional proteins and segments, such as RcK and Ail, are numbered relative to their mature protein, mature RcK of SEQ ID NO:57 and mature Ail of SEQ ID NO:58 (see, FIG.3B).
[0036] Polynucleotides
[0037] In a second aspect, polynucleotides that encode the disclosed engineered OMPs are provided. The terms “polynucleotide,” “oligonucleotide,” and “nucleic acid” are used interchangeably to refer a polymer of DNA or RNA. A polynucleotide may be single-stranded or double-stranded and may represent the sense or the antisense strand. A polynucleotide may be synthesized or obtained from a natural source. A polynucleotide may contain natural, non- natural, or altered nucleotides, as well as natural, non-natural, or altered internucleotide linkages.
[0038] In embodiments, the polynucleotides are constructs that comprise a promoter operably linked to a polynucleotide that encodes an engineered OMP described herein. The term “construct” refers to a recombinant polynucleotide, i.e., a polynucleotide that was formed by combining at least two polynucleotide components from different sources. For example, a construct may comprise the coding region of one gene operably linked to a promoter that is (1) associated with another gene found within the same genome, (2) from the genome of a different organism, or (3) synthetic. Constructs can be generated using conventional recombinant DNA methods.
[0039] As used in this disclosure, the term “promoter” refers to a DNA sequence that defines where transcription of a polynucleotide begins. RNA polymerase and the necessary transcription factors bind to the promoter to initiate transcription. Promoters are typically located directly upstream (i.e., at the 5' end) of the transcription start site. However, a promoter may also be located at the 3’ end, within a coding region, or within an intron of a gene that it regulates. Promoters may be derived in their entirety from a native or heterologous gene, may be composed of elements derived from multiple regulatory sequences found in nature, or may comprise synthetic DNA. A promoter is “operably linked” to a polynucleotide if the promoter is positioned such that it can affect transcription of the polynucleotide. The promoter used in the constructs described herein may be a heterologous promoter (i.e., a promoter that is not naturally associated with the wild-type OMP), an endogenous promoter (i.e., a promoter thatDocket No.650053.01207 is naturally associated with the wild-type OMP), or a synthetic promoter. Suitable promoters include, but are not limited to, constitutive, inducible, temporally regulated, developmentally regulated, chemically regulated, tissue-preferred, and tissue-specific promoters.
[0040] In some embodiments, the polynucleotides are vectors. The term “vector” refers to a DNA molecule that is used to carry a particular DNA segment (i.e., a DNA segment included in the vector) into a host cell. Some vectors are capable of autonomous replication in a host cell (e.g., bacterial vectors and episomal mammalian vectors). Other vectors can be integrated into the genome of a host cell such that they are replicated along with the host genome (e.g., viral vectors and transposons). Vectors may include heterologous genetic elements that are necessary for propagation of the vector or for expression of an encoded gene product. Vectors may also include a reporter gene (e.g., a gene encoding a fluorescent protein) or a selectable marker gene (e.g., a gene that confers antibiotic resistance).
[0041] Those of skill in the art understand that, due to the degeneracy of the genetic code, a variety of polynucleotides can encode the same polypeptide. Any polynucleotide sequence that encodes the desired engineered OMP may be utilized. In some embodiments, the polynucleotide (or the portion of the polynucleotide encoding the OMP) is codon-optimized for expression in a particular cell (e.g., a plant cell, bacterial cell, or fungal cell). “Codon optimization” is a process used to increase the expression of a polynucleotide in a particular host cell by altering the sequence of the polynucleotide to accommodate the codon bias of the host cell. For example, for expression in a bacterial cell, the polynucleotide can include the codons most frequently found in the genome of that bacterial cell for efficient expression of the OMP in that cell. Computer programs for generating codon-optimized sequences for use in a particular host cell are known in the art.
[0042] Cells
[0043] In a third aspect, cells that express the disclosed engineered OMPs are provided. The cells may comprise a polynucleotide described herein (i.e., a polynucleotide that encodes a disclosed engineered OMP). The cells may be eukaryotic or prokaryotic. The cell may be a bacterial cell, a plant cell, a fungal cell, or a protist cell. OMVs are produced by Gram-negative bacteria. Thus, in some embodiments, the cell is a Gram-negative bacterial cell. In specific embodiments, the Gram-negative bacterial cell is a Salmonella enterica serovar Typhimurium (STm) cell.
[0044] The inventors demonstrate that expressing engineered OMPs comprising loop(s) 2 and / or 3 of PagC in STm results in increased OMV production in STm. Thus, in some embodiments, the cell exhibits increased OMV production as compared to a control cell. AsDocket No.650053.01207 used herein, the term “control cell” refers to a comparable cell (e.g., of the same bacterial strain and genotype) that developed or was grown under the same or comparable conditions but that does not express the engineered OMP. In some embodiments, OMV production is increased by at least about 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, or more in the cell expressing engineered OMPs as compared to the control cell. OMV production can be quantified using any standard method known in the art. Examples of suitable methods for quantifying OMV production include, but are not limited to, nanoparticle tracking analysis, resistive pulse sensing, surface plasmon resonance, vesicle flow cytometry, transmission electron microscopy (TEM) analysis, and protein / lipid quantification. See, e.g., Koritzinsky et al. (Quantification of Exosomes. J Cell Physiol 232(7):1587-1590, 2017).
[0045] In some embodiments, the engineered OMP is derived from a wild-type OMP that is not natively expressed by the cell. In these embodiments, the engineered OMP may be expressed in the cell from exogenous DNA that has been introduced into the cell. Suitable methods for introducing exogenous DNA into a recipient cell include, without limitation, bacteriophage or viral infection, electroporation, heat shock, lipofection, microinjection, vacuum-infiltration, and particle bombardment. In some embodiments, the exogenous DNA is integrated into the genome of the cell. In other embodiments, the exogenous DNA is extrachromosomal.
[0046] In other embodiments, the engineered OMP is derived from a wild-type OMP that is natively expressed by the cell. In these embodiments, the engineered OMP may be expressed from exogenous DNA as described above or the endogenous gene that encodes the wild-type OMP may edited to encode the engineered OMP (i.e., via insertion of DNA encoding the one or more extracellular loops of PagC or functional portion thereof into the endogenous gene or via substitution of portions of the endogenous gene with DNA encoding the one or more extracellular loops of PagC or functional portion thereof). Gene editing can be performed using engineered nucleases such as meganucleases, zinc finger nucleases (ZFN), transcription activator-like effector nucleases (TALENs), and CRIPR-Cas nucleases.
[0047] Methods
[0048] In a fourth aspect, methods comprising expressing a disclosed engineered OMP in a cell are provided. The inventors demonstrate that engineering an OMV-inactive OMP to contain extracellular loop 2 and / or 3 of PagC results in increased OMV production in Salmonella enterica serovar Typhimurium. Thus, in some embodiments, the methods result in increased OMV production in the cell as compared to OMV production in a control cell that does not contain or express the engineered OMP.Docket No.650053.01207
[0049] In embodiments, the cell is a Gram-negative bacterial cell. In some embodiments, the Gram-negative bacterial cell is a Salmonella enterica serovar Typhimurium (STm) cell. In some embodiments, the engineered OMP is derived from a wild-type OMP that is natively expressed by the cell. In some embodiments, the engineered OMP is derived from a wild-type OMP that is not natively expressed by the cell.
[0050] The present disclosure is not limited to the specific details of construction, arrangement of components, or method steps set forth herein. The compositions and methods disclosed herein are capable of being made, practiced, used, carried out and / or formed in various ways that will be apparent to one of skill in the art in light of the disclosure that follows. The phraseology and terminology used herein is for the purpose of description only and should not be regarded as limiting to the scope of the claims. Ordinal indicators, such as first, second, and third, as used in the description and the claims to refer to various structures or method steps, are not meant to be construed to indicate any specific structures or steps, or any particular order or configuration to such structures or steps. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples or exemplary language (e.g., “such as”) provided herein, is intended merely to facilitate the disclosure and does not imply any limitation on the scope of the disclosure unless otherwise claimed. No language in the specification, and no structures shown in the drawings, should be construed as indicating that any non-claimed element is essential to the practice of the disclosed subject matter. Use of the terms “including,” “comprising,” or “having,” and variations thereof, is meant to encompass the elements listed thereafter and equivalents thereof, as well as additional elements. Embodiments recited as “including,” “comprising,” or “having” certain elements are also contemplated as “consisting essentially of” and “consisting of” those certain elements.
[0051] Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. For example, if a concentration range is stated as 1% to 50%, it is intended that values such as 2% to 40%, 10% to 30%, or 1% to 3%, etc., are expressly enumerated in this specification. These are only examples of what is specifically intended, and all possible combinations of numerical values between and including the lowest value and the highest value enumerated are to be considered to be expressly stated in this disclosure. Use of the word “about” to describe a particular recited amount or range of amounts is meant to indicate that values very near to the recited amount are included in that amount, such as valuesDocket No.650053.01207 that could or naturally would be accounted for due to manufacturing tolerances, instrument and human error in forming measurements, and the like. All percentages referring to amounts are by weight unless indicated otherwise.
[0052] No admission is made that any reference, including any non-patent or patent document cited in this specification, constitutes prior art. In particular, it will be understood that, unless otherwise stated, reference to any disclosed document does not constitute an admission that any of these documents forms part of the common general knowledge in the art in the United States or in any other country. Any discussion of the references states what their authors assert, and the applicant reserves the right to challenge the accuracy and pertinence of any of the documents cited herein. All references cited herein are fully incorporated by reference unless explicitly indicated otherwise. The present disclosure shall control in the event there are any disparities between any definitions and / or descriptions found in the cited references.
[0053] The following examples are meant only to be illustrative and are not meant as limitations on the scope of the invention or of the appended claims. EXAMPLES
[0054] Outer membrane vesicles (OMV) produced by Gram-negative bacteria have key roles in cell envelope homeostasis, secretion, interbacterial communication, and pathogenesis. Despite their importance, a comprehensive mechanistic understanding of OMV biogenesis remains elusive. OMV formation is generally thought to be induced by changes in the composition and physical properties of the outer membrane (OM) and cell envelope. For example, models of OMV biogenesis posit that OM vesiculation can be driven by various factors such as localized accumulation of peptidoglycan fragments and misfolded proteins in the periplasmic space that exert outward turgor pressure (7), accumulation of phospholipids in outer leaflet of the OM (8), weakening of the links between the OM and peptidoglycan layer (9), and liposaccharide (LPS) modifications that affect OM physical properties (10-14). These models are not mutually exclusive and may each be active in specific microbes or environmental conditions.
[0055] Salmonella enterica subsp. enterica serovar Typhimurium (STm) is a facultative intracellular pathogen that causes enterocolitis in humans and typhoid-like disease in susceptible mice (15). To enhance its intracellular survival, STm activates the two- component system PhoP-PhoQ (PhoPQ), an environmental sensor triggered by changes in Ca2+and Mg2+concentration, pH, and cationic antimicrobial peptides (16, 17). PhoPQ stimulation upregulates pag (PhoP-activated genes) critical for survival within macrophages andDocket No.650053.01207 pathogenesis (18-20). Pag proteins promote both LPS modifications and OMV biogenesis, with the latter providing a mechanism for shedding unmodified LPS to accommodate newly modified LPS in the bacterial OM (21). These activities are largely attributed to three outer membrane proteins: PagL, PagP, and PagC. PagL and PagP are enzymes that modify the lipid A moiety of LPS (22, 23), a process that has been proposed to promote OMV formation (11- 13). PagC is a 162-residue protein that increases OMV formation (24, 25), but the mechanism by which PagC activates OM vesiculation is unknown.
[0056] Here, the inventors show that PagC alone is sufficient for enhancing STm OMV production, and they identify a pH-responsive amino acid motif in PagC extracellular loops that is responsible for vesiculation. Using lipidomics, structure-guided mutational analyses, cell-based assays of OMV production, and molecular dynamics (MD) simulations, they show that PagC does not chemically modify LPS, but instead responds to mild acidification by altering the three-dimensional structure and flexibility of its extracellular loops and their interactions with the surrounding LPS. These changes alter membrane curvature leading to OM-vesiculation. Together, these findings provide a new perspective on how outer membrane proteins can modulate OMV formation.
[0057] Results and Discussion^
[0058] PagC expression does not modify the lipid A moiety of LPS. The outer membrane proteins PagL and PagP modify the lipid A moiety of LPS. Specifically, PagL removes an acyl chain from and PagP adds an acyl chain to the lipid A moiety of LPS (FIG. 1A) (22, 23). The resulting change in the ratio of the size of the polar headgroup to acyl chains is thought to induce a conical LPS structure that promotes OM curvature and facilitates OMV budding (11-13). PagC, on the other hand, has been shown to promote OM vesiculation independently of PhoPQ-regulated LPS remodeling, since its expression in a phoPQ deletion mutant is sufficient to increase OMV production (24, 25).^
[0059] To examine whether PagC chemically modifies STm LPS, lipid A isolated from wild-type STm was compared to lipid A isolated from a pagC deletion mutant (^pagC), grown under PhoPQ-inducing conditions (5.8L media: pH 5.8, 10 µM Mg2+) or non PhoPQ-inducing conditions (7.6H media: pH 7.6, 10 mM Mg2+), using mass spectrometry or gas chromatography. LPS isolated from either wild-type or ΔpagC STm were similar (FIG. 1B), indicating that PagC does not affect the acylation profile of lipid A. Similarly, no differences in lipid A acyl chain modifications were detected in LPS purified from OMVs produced by wild-type or ^pagC bacteria grown in 5.8L, 7.6H, or LB media (FIG. 1C). In addition, theDocket No.650053.01207 LPS O-antigen isolated from wild-type and ^pagC strain showed very similar migration patterns on SDS-PAGE (FIG.1D). Taken together, these results demonstrate that unlike PagP and PagL, PagC does not chemically modify LPS. ^
[0060] The extracellular loops of PagC are responsible for OMV production. PagC belongs to the Ail / Lom protein family (pfam 06316) and shares high sequence similarity (FIG. 5A) with other family members, including Rck from STm (53% identity) and Ail from Yersinia pestis (36% identity). Notably however, neither Ail nor Rck are reported to increase OMV production (25). Indeed, we observed that OMV production, which was highly impaired in ^pagC, was restored by expressing plasmid-encoded PagC (pPagC) but not by expressing plasmid-encoded RcK (pRcK), which resulted in similarly low numbers of OMVs as ^pagC harboring the empty plasmid vector (pRS1; FIG.2A). To understand the differential capacity of these proteins to promote vesiculation, their sequences were examined in the context of the Ail / Lom canonical structure, represented by Ail (27-29), which forms an eight-stranded transmembrane ^-barrel with three short intracellular periplasmic turns (T1-3) and four extracellular loops (EL1-4) (FIG. 5B). Structure-based sequence alignment highlighted the pronounced sequence conservation of the three proteins in the transmembrane β-barrel, and sequence divergence in EL1-4 (FIG.2B, FIG.2C).^
[0061] To test whether extracellular loop sequences specific to PagC account for the OMV production activity, a series of plasmid-encoded PagC-Rck chimeric proteins were engineered (Table 1 and Table 3; FIG. 6) wherein the EL sequences from one protein were replaced with their counterparts from other homologous proteins (e.g., PagC EL2-EL3 and RcK EL2-EL3). A STm mutant strain (ΔpagC, Δrck, ΔompX, ΔpgtE) lacking pagC and its structural and functional homologs were tested for growth fitness under both PhoPQ-inducing and PhoPQ-non-inducing conditions (FIG. 7). This strain was used for the expression of the chimeras to analyze their effect on OMV production (FIG. 2A).^The strain expressing the PagC-Rck2-3chimera (PagC EL2-EL3 replaced by RcK EL2-EL3, pPagC-Rck2-3) produced significantly fewer OMVs compared to the isogenic strain expressing PagC (pPagC). In contrast, the strain expressing Rck-PagC2-3(Rck EL2-EL3 replaced with PagC EL2-EL3, pRck-PagC2-3) produced at least as many OMVs as observed with plasmids encoding PagC (pPagC) and significantly greater than those detected with plasmids encoding RcK (pRcK). Additional chimeras where EL2 or EL3 of Rck were replaced individually by EL2 or EL3 of PagC showed that both pRck-PagC2and pRck-PagC3increase OMV production compared to pRcK, with pRck-PagC2yielding OMV levels similar to pPagC (FIG. 2A). Together theseDocket No.650053.01207 results indicate that the EL2 and EL3 sequences of PagC have a potent influence on OMV production, with EL2 having the greatest effect. ^
[0062] Structure-based sequence alignment also revealed the presence of outward- facing basic residues predicted to protrude from the PagC transmembrane barrel near the base of the loops and from the mid-sections of EL2 and EL3 (FIG. 2B, FIG. 2C). Similar basic residues are found at parallel positions in RcK and Ail. In Ail, these residues were shown to be critical for establishing polar contacts with the neighboring LPS, affecting the physical state of the OM and promoting Y. pestis survival and cell envelope integrity (30). To examine their roles in PagC-activated OMV production, a set of pagC allelic variants were engineered, where they were substituted with alanine (Ala) (Table 1). A PagC mutant with extensive substitutions in EL2 (R48A, H60A, H62A, K64A, K68A) or EL3 (K96A, K100A, H102A, K113A, R117A, K118A) failed to export to the OM, and produced similar, low levels of OMVs as the ^pagC strain, suggesting that these substitutions abolish recognition by the OM biogenesis apparatus and proper folding (31). The less extensively substituted PagC mutants, however, were detectable in the OM and produced similarly low numbers of OMVs as ^pagC bacteria (FIG. 8A). Overall, the data suggest that outward-facing basic residues in EL2 and EL3 of PagC play an important role in OMV production.^
[0063] Basic residues in the extracellular loops of PagC establish polar contacts with LPS. To gain molecular insights into the role of PagC in OMV production, molecular dynamics (MD) simulations of the protein embedded in a native-like STm OM (inner leaflet: phospholipid, outer leaflet: LPS) were performed. The initial structural model of PagC was obtained from the AlphaFold database (32) and then used to initiate three independent MD simulations. During 3 µs of MD simulation, PagC maintains a stable membrane-inserted conformation that optimizes hydrophobic match with the membrane (FIG. 3A), with an average β-barrel transmembrane tilt of 15° (FIG.9A, FIG.9B). ^
[0064] The simulations revealed multiple interactions between PagC and LPS. Basic residues extending from the base (K13, R21, K68, K96, R117 and K150) and midsections (K64, K100 and K113) of the extracellular loops form polar contacts (including hydrogen bond and electrostatic interactions) with the lipid A, KDO, inner core, and outer core groups of LPS (FIG.10A) and many of these contacts are long-lived on the time scale of the MD simulation (FIG. 10B). Moreover, acidic residues in the extracellular loops of PagC form metal ion- mediated polar contacts to LPS phosphate groups. Such stable association of the protein with LPS results in the effective formation of a PagC-LPS assembly where on average one proteinDocket No.650053.01207 associates with four seven LPS molecules (FIG.10F). Such interactions are expected to result in greater order and lower flexibility of both PagC and LPS, as reported previously for Ail (30). The MD data, therefore, point to a role for outward facing basic and acidic residues of PagC in stabilizing PagC-LPS complexation, a process that could lead to lateral phase separation of PagC-LPS rafts and membrane remodeling, with ultimate consequences for OMV production. ^
[0065] The second and third extracellular loops of PagC contain a pH response motif. The experimental data and MD simulations each show that basic residues in the extracellular loops of PagC are important for PagC-mediated OMV formation and for establishing PagC-LPS contacts. However, basic residues alone do not explain why RcK and Ail, which carry similarly placed basic residues (FIG. 8B), do not activate OMV production. Analysis of the three protein sequences revealed a distinguishing feature of PagC: the presence of two amino acid segments with inverse homology and three His residues (H60, H62, H102) in EL2 and EL3. Residues 62-69 in the descending segment of EL2 are homologous to residues 102-95 in the inverse ascending segment of EL3 (FIG.3B) and their topological arrangement juxtaposes His and Phe sidechains, priming them for complementary ring stacking interactions across the EL2-EL3 interface. Indeed, MD simulations performed for PagC with neutral His sidechains, mimicking neutral pH, show that these complementary segments participate in a series of EL2-EL3 cross contacts (FIG.3C, FIG.3D), including H60-H62-H102 and F65-F99 ring stacking Together, these interactions restrain and couple the conformation and dynamics of EL2 and EL3, resulting in similar levels of conformational flexibility of the two loops (FIG. 3F, FIG.11A, blue trace). ^
[0066] The three His are unique to PagC and particularly interesting because their characteristic pKa (~6) makes them susceptible to protonation and acquisition of a positive charge in the mildly acidic intravacuolar environment encountered by STm upon host cell invasion (18-20). As acidification is a known activator of PhoPQ and PagC expression (18, 19), we examined the OMV-promoting activity of the His residues by mutating H60 and H62 in both the background of the pRcK-PagC2chimera and pPagC. Since the MD simulations indicate that H60 and H62 in EL2 each participate in stacking interactions with H102 in EL3, it was reasoned that substituting either one would break the His-mediated EL2-EL3 connectivity. Mutation of either His to Ala resulted in substantially lower OMV levels relative to either pPagC or pRck-PagC2in 5.8L (pH 5.8) media (FIG.4A), indicating that H60 and H62 play a critical role in OM vesiculation, and that their deactivation reduces OMV production by STm. To mimic acidic conditions where His becomes protonated and positively charged, HisDocket No.650053.01207 was mutated to Lys. In this case, the H60K, H62K, and double H60K, H62K mutations in pPagC enhanced OMV production relative to the wild-type PagC (FIG.4B). ^
[0067] To further examine the effect of pH, OMV production was analyzed by a triple His mutant pPagC (H60K, H62K, and H102K), in both 5.8L (pH 5.8) and 7.6H (pH 7.6) media. Mutation of all three His to positively charged Lys resulted in significantly greater OMV production relative to pPagC in both media (FIG.4C) indicating that the triple His-Lys mutant is constitutively activated for OMV production. Furthermore, the elevated OMV production of the triple His-Lys mutant relative the pPagC in 5.8L may reflect the protonation capacity of His residues in PagC. The pKa values of His in some proteins have been shown to vary between 5.4 and 7.6, thus it is possible that a pH of 5.8 is not sufficiently low to fully protonate all three His residues of PagC and fully replicate the activation observed for the triple Lys substitution mutant. In macrophage vacuoles, where pH estimates are in the range of 4.4 to 5.3 (18-20), PagC may be expected to resemble the triple His-Lys mutant more closely. Together, these data support the hypothesis that PagC-mediated vesiculation becomes activated at mildly acidic pH where His becomes protonated. ^
[0068] The molecular basis for this effect was explored by performing MD simulations with His-protonated PagC to mimic the mildly acidic environment. The results of three independent 3 µs MD simulations show that His-protonated PagC remains stably embedded in the OM, with a smaller and narrower distribution of transmembrane tilt angle (average 12°) compared to the His-neutral state (FIGS. 9A-9B). The molecular interaction and conformational flexibility profiles, however, change significantly. His protonation alters the profile of PagC interaction with the OM (FIG. 12), resulting in reduced contacts of the barrel with the lipid and LPS acyl chains, reduced contacts with water especially for EL2, EL3 and EL4, enhanced contacts of H60 and H62 with the LPS inner core and altered contacts with outer core LPS groups. Moreover, His protonation alters the flexibility profile of EL2 and EL3, leading to both significantly reduced flexibility in the ascending segment of EL2 and greater flexibility in the ascending segment of EL3 (FIG. 3F, FIG. 11A, red trace). A reduction in dynamics at residue E55 appears to be a common feature of both His-neutral and His- protonated PagC. It is also observed in MD simulations performed in a symmetric phospholipid bilayer without LPS (FIG. 11B), and likely related to long-lived interactions of E55 with the His cluster in both states (FIG.11C). ^
[0069] Principal component (PC) analysis revealed that the three MD simulations for His-neutral PagC populate distinct regions of the conformational landscape, with little overlap indicative of limited conformational exchange (FIG. 13A, FIG. 13B, blue). Overall, the dataDocket No.650053.01207 indicate that deep low energy wells, and thus high energy barriers, in the conformational landscape of His-neutral PagC restrain large-scale dynamics and the ability to converge to a single conformation in the timescale of this 3 µs simulation. The situation for His-protonated PagC is distinctly different (FIG. 13A, FIG. 13B, red). Here, significant overlap between the three independent MD simulations indicates the protein's capacity to explore the range of its conformational landscape and converge to one overall conformation. These differences are reflected in the conformations of EL2 and EL3. In His-neutral PagC, EL2 and EL3 both adopt more extended conformations that snorkel out of the OM, with similar flexibilities that are mutually restrained by complementation of the inverse-homology pH response motif (FIGS. 3C-3D, FIG. 13D) and stabilized by contacts of polar residues with the surrounding LPS. In His-protonated PagC, on the other hand, mutual electrostatic repulsions of the electropositive His cause a large increase in His-His distances across EL2-EL3 (FIG. 4D, FIG. 9), net unraveling of EL2-EL3 complementation, and decoupling of their motions and conformations (FIG.3E, FIG.13E). The charged His also form greater numbers of long-lived polar contacts with LPS outer core phosphates (FIGS. 10C-10D) and appear to promote conformations of EL2 and EL3 that are more deeply embedded in the OM. It appears, therefore, that the complementary sequences of EL2 and EL3 can switch conformation and dynamics upon transfer between neutral and acidic environments. Their high sensitivity to small pH alterations is highly suggestive of a pH response motif that enables STm to adapt to the environmental conditions encountered upon host cell invasion.
[0070] Conclusions^
[0071] OMV formation is generally thought to be driven by the insertion of curvature- inducing molecules such as modified LPS into the OM, loosening of OM interactions with the underlying peptidoglycan, and outward turgor pressure resulting from the accumulation of peptidoglycan fragments and misfolded proteins in the periplasmic space (7, 9-14). The disclosed findings suggest a new mechanism for control of OM vesiculation mediated by the conformational changes of an outer membrane protein that are stimulated by environmental pH. ^
[0072] Here, it is shown that the PhoPQ-induced OM protein PagC enhances OMV production independently of LPS-modifying activities, such as those of PagL and PagP. The second and third extracellular loops of PagC were found to be critical for OMV biogenesis and sufficient for conferring OMV production activity in the OMV-inactive homolog RcK. MD simulations unequivocally revealed that basic residues in EL2 and EL3 establish multiple interactions with the surrounding LPS that are expected to stabilize the OM against a varietyDocket No.650053.01207 of stressors as observed for the PagC homolog Ail (30). Nevertheless, the most striking locus of OM vesiculation activity is situated in a pH responsive amino acid motif in PagC that harbors three histidine residues. Mutagenesis experiments revealed that replacing these His residues with Ala suppressed OMV production in STm, while replacing them with positively charged Lys had the opposite effect, generating a constitutively super-activated PagC capable of producing OMV levels greater than wild-type PagC. ^
[0073] These results suggest a model for the way in which PagC senses the pH of its environment and promotes OM vesiculation. At neutral pH (FIG. 4E), His stacking interactions promote aromatic-aromatic and polar contacts that result in dynamically coupled extended conformations of EL2 and EL3 and an overall cylindrical shape of PagC. At acidic pH (FIG. 4F), electropositive His-His repulsions decouple EL2 and EL3, and the protein becomes more deeply embedded in the outer membrane. Acidification thus may alter the shape and dynamics of PagC from a cylinder at neutral pH, exerting equal lateral pressure on the inner phospholipid and outer LPS leaflets of the OM, to a wedge at acidic pH, exerting more lateral pressure on the OM outer leaflet. While the present MD simulations were not designed to capture membrane curvature and are limited by the lack of an experimental structure of PagC, they indicate that His protonation alters the association of PagC with the inner and outer regions of the OM. Additional long simulations with an extended OM and enhanced sampling will be important for examining the effects of His protonation and His mutations on membrane structure. ^
[0074] His residue protonation plays a central role in pH sensing by proteins in various physiological settings. Viruses that infect via endosomal uptake are known to rely on His-based sensors of local pH to activate protein conformational changes that allow them to fuse with the host membrane and penetrate into the cytosol (34). His titration in response to local pH can affect the interactions of antimicrobial peptides with membranes (35), and His protonation states are important for hemoglobin structure and function (36). In STm, OMV formation appears to be activated by an additive mechanism of pH sensing since PhoPQ is activated by low pH to express the OM protein PagC, which is itself activated by low pH via its His- containing pH response motif to produce more OMVs.^
[0075] While the His residues provide the pH-responsive switch that appears to activate a cylinder-to-wedge transformation of PagC, their flanking complementary sequences are also likely important. Notably, the native sequence of RcK has Arg residues (R61, R101) at positions analogous to H60 and H102, but it is not active with respect to OMV production. Unlike PagC, however, RcK also contains complementary charge pairs (D87-K122, K89-E121,Docket No.650053.01207 F42-K71) that may be expected to restrain the loops and constitutively promote the cylindrical protein conformation. ^
[0076] Biophysical studies have shown that the interactions of wedge-shaped proteins with asymmetric membranes can drive membrane curvature and vesicle budding (37, 38). For example, wedge-shaped membrane-spanning helical hairpins and their flanking amphipathic helices can both sense membrane curvature and act as mechanical drivers of asymmetric membrane vesiculation (38). We propose that similar forces may be active for β-barrel membrane proteins that can alter their shape in the highly asymmetric OM of Gram-negative bacteria. This work, therefore, provides a new perspective on how specific OM proteins can direct OMV production, a result with important consequences for the development of vaccines and designer OMVs.^
[0077] Materials and Methods^
[0078] Bacterial strains and culture conditions. All bacterial strains including mutants and plasmids used in this study are listed in Table 1. Unless stated otherwise, all reagents used were procured from MilliporeSigma (St. Louis, MO, USA). The STm strains were grown at 37°C in Lysogeny broth (LB), PhoPQ-inducing pH 5.8, 10 ^M Mg2+(5.8L) or non-PhoPQ inducing pH 7.6, 10 mM Mg2+(7.6H) N-minimal media as described previously (25). To grow STm under PhoPQ inducing conditions, bacteria were grown in LB and then sequentially transitioned into 7.6H and 5.8L conditions. An STm SL1344 defective in the production of flagellins (fliC and fljB), designated herein as wild-type, was used to engineer STm deletion mutants as described previously (25). The fitness of deletion mutants was confirmed by growth curve analysis and transmission electron microscopy to assay for changes in cell shape / viability. The primers used in this study are listed in Table 1. When appropriate, antibiotics were used at the following concentrations: kanamycin, 25 ^g / ml, chloramphenicol, 30 ^g / ml, tetracycline, 10 ^g / ml, and streptomycin, 90 ^g / ml. ^ ^Docket No.650053.01207 Table 1. Strains, plasmids, and primers ^ Strain Plasmid Description Antibiotics Reference WT - SL1344 fliC::Cmr , fljB::MudJ Strr, Kmr, Cmr(25) ^pagC- pagC deletion in WT Strr, Kmr, Cmr (25)PagC(R48A) - PagC R48 replaced by alanine Strr, Kmr, CmrThis work PagC(H60A, H62A, - PagC H60, H62, K64 and K68 Strr, Kmr, CmrThis work K64A, K68A) replaced by alanine PagC(K96A, K100A, - PagC K96, K100 and H102 Strr, Kmr, CmrThis work H102A) replaced by alanine PagC(K113A, - PagC K113, R117 and K118 Strr, Kmr, CmrThis work R117A, K118A) replaced by alanine PagC(R48A, K113A, - PagC R48, K113, R117 and Strr, Kmr, CmrThis work R117A, K118A) K118 replaced by alanine PagC(R48A, K96A, - PagC R48, K96, K100 and Strr, Kmr, CmrThis work K100A, H102A) H102 replaced by alanine PagC(K96A, K100A, - PagC K96, K100, H102, K113, Strr, Kmr, CmrThis work H102A, K113A, R117, and K118 replaced by R117A, K118A) alanine ^pagC^rck^ompX^ppRS1^pagC^rck^ompX^pgtEStrr, Kmr, Tetr, (25) gtE mutant bacteria with empty Amprvector ^pagC^rck^ompX^p ppagC ^pagC^rck^ompX^pgtE Strr, Kmr, Tetr, (25) gtE mutant expressing wildtype AmprPagC protein ^pagC^rck^ompX^p prck ^pagC^rck^ompX^pgtE Strr, Kmr, Tetr, (25) gtE mutant expressing wildtype AmprworkPagC protein with EL2’-3’ of Rck ^pagC^rck^ompX^p prck-pagC2-3^pagC^rck^ompX^pgtE Strr, Kmr, Tetr, This work gtE mutant expressing chimeric AmprRck protein with EL2-3 of PagC ^pagC^rck^ompX^p prck-pagC3^pagC^rck^ompX^pgtE Strr, Kmr, Tetr, This work gtE mutant expressing chimeric AmprRck protein with EL3 of PagC ^pagC^rck^ompX^p prck-pagC2^pagC^rck^ompX^pgtE Strr, Kmr, Tetr, This work gtE mutant expressing chimeric AmprRck protein with EL2 of PagC ^pagC^rck^ompX^p prck- ^pagC^rck^ompX^pgtE Strr, Kmr, Tetr, This work gtE pagC2_H60A mutant expressing chimeric AmprDocket No.650053.01207 Rck protein with EL2 of PagC and His60 substituted by Ala ^pagC^rck^ompX^p prck- ^pagC^rck^ompX^pgtE Strr, Kmr, Tetr, This work gtE pagC2_H62A mutant expressing chimeric AmprRck protein with EL2 of PagC and His62 substituted by Ala ^pagC^rck^ompX^p prck- ^pagC^rck^ompX^pgtE Strr, Kmr, Tetr, This work gtE pagC2_H60A + mutant expressing chimeric AmprH62A Rck protein with EL2 of PagCLys ^pagC^rck^ompX^pppagC_H62K^pagC^rck^ompX^pgtEStrr, Kmr, Tetr, This work gtE mutant expressing PagC protein Amprwith and His62 substitutedgtE H62K mutant expressing PagC protein Amprwith and His60 and 62 substituted by Lys ^pagC^rck^ompX^p ppagC_H60K+ ^pagC^rck^ompX^pgtE Strr, Kmr, Tetr, This work gtE H62K +H102K mutant expressing PagC protein Amprwith and His60, 62 and 102 substituted by Lys Primers Sequence (5’ to 3’) Description PagC.R48.R GCCTGTGCGTCTCCATATA (SEQ ID NO: For cloning pagC R48A 12) PagC.R48.F TATATGGAGACGCACAGGC (SEQ ID NO: “ 13) PagC.H60,H62,K64, GCCACCTCAAACGCGTCAGCGTAAGC For cloning pagC H60A H62A K64A K68.R (SEQ ID NO: 14) K68A PagC.H60,H62,K64, GCTTACGCTGACGCGTTTGAGGTGGC “ K68.F (SEQ ID NO: 15) PagC.K96,K100,H10 GGAAGCTTCTGCAAATGTCGCCGCTAC For cloning pagC K96A K100A H102A 2.R (SEQ ID NO: 16) PagC.K96,K100,H10 GTAGCGGCGACATTTGCAGAAGCTTCC “ 2.F (SEQ ID NO: 17) PagC.K113,R117,K1 TAACGCAATTTCCTCAGCGGCAACGG For cloning pagC K113A R117A K118A 18.R (SEQ ID NO: 18) PagC.K113,R117,K1 GCAATTTCCTCAGCGGCA (SEQ ID NO: 19) “ 18.F mutantPagC.F CCGTAAATAATAAGTAGTATTAAGGAGTT For amplifying pagC, with overhangs for GTTATGAAAAATATTATTTTATCCACTTT pagC upstream region AG (SEQ ID NO: 20) mutantPagC.R GCTTTTCAGAAACGGTATCCAACCCCGAC For amplifying pagC, with overhangs for G (SEQ ID NO: 21) pagC downstream regionDocket No.650053.01207 pOPC3-900.F ACGGTATCGATAAGCTTGATATCGAATTC For amplifying 900bp region upstream of TGTTGTAAACCAGAACAATGGC (SEQ ID pagC, with plasmid overhangs NO: 22) pOPC3-900.R CTAAAGTGGATAAAATAATATTTTTCATA For amplifying 900bp region upstream of ACAACTCCTTAATACTACTTATTATTTAC pagC, with overhangs for pagC GG (SEQ ID NO: 23) pOPC3+900.F CAACGTCGGGGTTGGATACCGTTTCTGAA For amplifying 900bp region downstream AAGCATAAGCTATG (SEQ ID NO: 24) of pagC, with overhangs for pagC pOPC3+900.R GGCCGCTCTAGAACTAGTGGATCCTCTGC For amplifying 900bp region downstream TATTGATCGTATC (SEQ ID NO: 25) of pagC, with plasmid overhangs PagC EL2.F GCGTCGTTCAGTTGGTTATATGGAGACAG For amplifying pagC EL2 ACAGGCT (SEQ ID NO: 26) PagC EL2.R CCGCCATCAGCGAACCGTACTTCACCTCA “ AAC (SEQ ID NO: 27) PagC EL3.F CGGTGCCGGTACCGTAAAGGCGACATTT For amplifying pagC EL3 AAAGAA (SEQ ID NO: 28) PagC EL3.R TTCTTTAAATGTCGCCTTTACGGTACCGG “ CACCG (SEQ ID NO: 29) PagC EL2-3.F ATTCTCCAGCGGATTC (SEQ ID NO: 30) For amplifying EL2 to EL3 of pagC PagC EL2-3.R CTCATAGCCCAGATCGATGACCACATTCT “ CCAGCGGATTCATCTG (SEQ ID NO: 31) PagC_5’.F AGCGGTGAATTATTCGTGGTATGAAAAAT for amplifying pagC from the start codon, ATTATTTTATCCACTTTAG (SEQ ID NO:32) with pRS1 plasmid overhangs PagC_5’.R GCCATCAGTCCCAGCGGCGTCTGAGCCTC for amplifying pagC until EL2 start region ATAACGGTATTTCACATTTA (SEQ ID NO: 33) PagC_3’.F GGCGTACAGTTTAATCCGGTGGAAAATAT for amplifying pagC from EL3 end region CGTCGTCGATGTTGGGTATGAAGG (SEQ ID NO: 34) PagC_3’.R ATCCGCCAAAACAGCCATCAGAAACGGT For amplifying pagC 3’ end, with pRS1 ATCCAACCCCGACG (SEQ ID NO: 35) plasmid overhangs Rck EL2-3.F TAAATGTGAAATACCGTTATGAGGCTCAG For amplifying EL2 to EL3 of rck ACGCCGCTGGGACTGATGGC (SEQ ID NO: 36) Rck EL2-3.R CCTTCATACCCAACATCGACGACGATATT “ TTCCACCGGATTAAACTGTACGCC (SEQ ID NO: 37) Rck_5’.F CACTCCCTATCAGTGATAGAGAAAAGTG For amplifying 5’ region of rck, with pRS1 CATGAAAAAAATCGTTCTGTCCTCA (SEQ plasmid overhangs ID NO: 38) Rck_5’.R AATAAAACTTACCGGAGAGTCATCCTCAT For amplifying rck until EL2 start region AGCGGTATTTCAGGTTC (SEQ ID NO: 39) Rck_3’.F TGTACAGATGAATCCGCTGGAGAATGTG For amplifying rck from the EL33’ end GTCATCGATCTGG (SEQ ID NO: 40) Rck_3’.R ATCCGCCAAAACAGCCATCAGAACCGGT For amplifying 3’ region of rck, with pRS1 AACCG (SEQ ID NO: 41) plasmid overhangs Rck_3’long.R GTTTGAGGTGAAGTACGGTTCGCTGATGG For amplifying rck from the EL2 end CGG (SEQ ID NO: 42) regionDocket No.650053.01207 Rck_5’long.R GGCACCGGCCAGTGCATACAGAGATA For amplifying rck until EL3 start region (SEQ ID NO: 43) Rck_5’.R AGCCTGTCTGTCTCCATATAACCAACTGA For amplifying 5’ region of rck until EL2 ACGACGC (SEQ ID NO: 44) start region H60A.F GTCTGTTGAGCCTGAAGGTATTGCTTACC For substituting PagC EL2 His-60 by Ala ATGACAAGTTTGAGGTGAAGTAC (SEQ ID NO: 45) H60A.R GTACTTCACCTCAAACTTGTCATGGTAAG “ CAATACCTTCAGGCTCAACAGAC (SEQ ID NO: 46) H62A.F GTCTGTTGAGCCTGAAGGTATTCATTACG For substituting PagC EL2 His-62 by Ala CTGACAAGTTTGAGGTGAAGTAC (SEQ ID NO: 47) H62A.R GTACTTCACCTCAAACTTGTCAGCGTAAT “ GAATACCTTCAGGCTCAACAGAC (SEQ ID NO: 48) H60A,H62A.F GTCTGTTGAGCCTGAAGGTATTGCTTACG For substituting PagC EL2 His-60 and 62 CTGACAAGTTTGAGGTGAAGTAC (SEQ ID by Ala NO: 49) H60A,H62A.R GTACTTCACCTCAAACTTGTCAGCGTAAG “ CAATACCTTCAGGCTCAACAGAC (SEQ ID NO: 50) H60K.F GGTCTGTTGAGCCTGAAGGTATTAAATAC For substituting PagC EL2 His-60 by Lys CATGACAAGTTTGAGGTGAAGTACGG (SEQ ID NO: 51) H60K.R CCGTACTTCACCTCAAACTTGTCATGGTA “ TTTAATACCTTCAGGCTCAACAGACC (SEQ ID NO: 52) H62K.F GGTCTGTTGAGCCTGAAGGTATTCATTAC For substituting PagC EL2 His-62 by Lys AAAGACAAGTTTGAGGTGAAGTACGG (SEQ ID NO: 53) H62K.R CCGTACTTCACCTCAAACTTGTCTTTGTA “ ATGAATACCTTCAGGCTCAACAGACC (SEQ ID NO: 54) H60,H62K.F GGTCTGTTGAGCCTGAAGGTATTAAATAC For substituting PagC EL2 His-60 and 62 AAAGACAAGTTTGAGGTGAAGTACGG by Lys (SEQ ID NO: 55) H60,H62K.R CCGTACTTCACCTCAAACTTGTCTTTGTAT “ TTAATACCTTCAGGCTCAACAGACC (SEQ ID NO: 56) ^
[0079] PagC chimera and allelic mutant construction. A ^pagC ^rck ^ompX ^pgtE STm quadruple deletion mutant (25) was used to generate PagC-Rck chimeras. Briefly, specific regions of the pagC and rck genes of STm SL1344 were amplified using primers listed in Table 1. The primers for amplification were designed in such a way that each amplicon carried 13- 25 bp of upstream and downstream overlaps corresponding to its adjacent chimera region. These amplicons were then fused together to create pagC-rck chimeric genes, which were thenDocket No.650053.01207 cloned into the pRS1 plasmid (25) using NEBuilder HiFi DNA assembly master mix. The PagC-H60K+H62K+H102K mutant was created by cloning a PagC-H60K+H62K+H102K gblock DNA fragment (synthesized by IDT DNA) into the pRS1 plasmid. The resulting plasmid DNAs were then transformed into ^pagC ^rck ^ompX ^pgtE mutant and protein expression was induced with anhydrotetracycline hydrochloride (AHT, 0.4 µg / ml) for 2 hrs at 37°C. The expression of mutant protein in the bacterial outer membrane was checked by western blotting as described below. The growth of strains harboring PagC-Rck chimeras was very similar to wild-type in LB or N-minimal media. ^
[0080] Substitution of amino acid residues with basic side chains in EL2 and EL3 of PagC was done by site-directed mutagenesis, using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs Inc., Ipswich, MA, USA) according to the manufacturer’s protocol. First, the pagC gene from S. Typhimurium SL1344 genomic DNA was amplified using primers listed in Table 1. Custom mutagenic primers were designed for each mutant, with the desired nucleotide changes (Arg / Lys / His to Ala) located in the center of the primer and at least 10 complementary nucleotide bases on the 3’ and 5’ end of the primers. Next, an amplicon including 500 bp region upstream and 500 bp downstream region of pagC was cloned into pFOK (39) using the NEBuilder HiFi DNA assembly master mix (New England Biolabs Inc., Ipswich, MA, USA). The resulting plasmids were used to replace wild-type pagC with pagC-containing site specific mutations in the STm genome by allelic exchange methods (39, 40). The sequence of the pagC allele mutations were confirmed by DNA sequencing.^
[0081] OMV isolation and characterization. OMVs were isolated from broth cultures as described previously (25). Briefly, bacterial cultures grown in 5.8L or 7.6H N-minimal media, to O.D.600 of 0.4-0.6, were centrifuged with a Beckman Avanti J-E centrifuge at 15,000 ^ g (JLA-16.250 rotor) for 10 min at 4°C and the resulting supernatants were filtered through 0.45-^ cellulose membrane filters. Filtered supernatants were then ultracentrifuged at 300,000 ^ g for 90 min at 4°C in a Beckman optima L-90K ultracentrifuge using a Type 50.2 Ti rotor. The OMV pellets were resuspended in PBS, filtered through a 0.2-^ filter, checked for bacterial contamination, and stored at -20°C until use. In previous studies using this protocol, the purified OMV fractions did not have bacterial contamination or cell lysis byproducts (25). The concentration and size of purified OMVs (normalized by cfu / ml) were enumerated by nanoparticle tracking analysis (NTA) using ZetaView (Particle Matrix, Meerbusch, Germany) at the Cell Function and Imaging Core, Boston Children’s Hospital.^Docket No.650053.01207
[0082] Lipid A extraction and Mass spectrometry analysis. Lipid A extraction and MALDI-TOF MS analysis of the LPS isolated from wild-type or ^pagC bacteria and OMVs was done as described previously (41). Briefly, wild-type or ^pagC bacteria grown overnight in either LB or N-minimal media (5.8L or 7.6H respectively) were pelleted at 8000 x g for 10 min and a loopful of the bacterial pellet or OMVs (50 ^L) was resuspended in 250 ^L of 70% isobutyric acid and 150 ^L of 1M ammonium hydroxide. The samples were then heated at 100 °C for 1 h followed by an incubation on ice for 5 min. After centrifugation at 8000 × g for 5 min, the supernatant was collected, diluted with 400uL endotoxin-free water, flash frozen and lyophilized overnight. The dried material was then washed once with 1 ml of methanol and reconstituted with 100 μl of a mixture of chloroform:methanol:water in the ratio of 12:6:1 (v / v / v). One microliter of the sample was then spotted on a stainless-steel MALDI plate, allowed to dry in air, and overlaid with 1 μl of 10 mg / mL norharmane matrix (reconstituted in 2:1 v / v ratio of chloroform:methanol). Each spot was measured in 300 shot steps for a total of 3,000 laser shots using a Bruker Autoflex Speed MALDI-TOF mass spectrometer (Bruker Daltonics, Bremen, Germany) operated in negative-ion reflectron mode. The mass spectra were acquired in the mass range of 1,500 to 2,400 and calibrated with electrospray ionization (ESI) tuning mix (Agilent Technologies, Santa Clara, CA, USA), as described previously (41). The mass spectra were processed for smoothing and baseline subtraction using FlexAnalysis, version 3.4 (Bruker Daltonics, Bremen, Germany).^
[0083] Gas chromatography-based lipid A analysis. LPS fatty acids from wild-type or ^pagC bacteria and OMVs were converted to fatty acid methyl esters and analyzed by gas chromatography as described previously (42). Briefly, bacterial cell pellets or 50 μl of OMVs were incubated at 70°C for 1 hr in 500 µl of 90% phenol and 500 µl of water. Samples were then cooled on ice for 5 min and centrifuged at 10,000 g for 10 min. The aqueous layer was then collected and 500 µl of water was added to the lower (organic) layer and incubated again. This process was repeated twice, and all aqueous layers were pooled. Two ml of diethyl ether was added to the harvested aqueous layers, and the mixture was then vortexed and centrifuged at 5000 g for 20 min. The lower (organic) phase was then collected, and 2 ml of ether was added back to the remaining aqueous phase. This process was carried out twice more. The collected organic layer was then frozen and lyophilized overnight. LPS fatty acids were converted to fatty methyl esters, in the presence of 10 µg pentadecanoic acid as an internal standard, with 2 M methanolic HCl (Alltech, Lexington, KY) at 90°C for 18 hr.^Docket No.650053.01207
[0084] Lipopolysaccharide (LPS) assay. Wild-type or ^pagC bacteria were grown in N-minimal media (5.8L) until the culture reached O.D600 = 0.5, and then 1.5 ml of the culture was harvested at 10,000 x g for 10 min. The bacterial pellet was resuspended in 250 µl of dissociation buffer (1 M Tris-Cl pH 6.8, 10% glycerol, 2% SDS and 4% ^-mercaptoethanol) and was then boiled at 100°C for 10 min and allowed to cool down at room temperature. To remove any insoluble material, the samples were centrifuged at 12,000 x g, for 10 min and the resulting supernatant was then incubated with 30 µg of proteinase K at 55°C for 2 hr. After protein digestion, the samples were separated on 15% SDS-PAGE gels and stained with Pro- Q Emerald 300 Lipopolysaccharide gel stain kit according to the manufacturer’s protocol.^
[0085] Outer membrane preparations and western blotting. OMPs were isolated from 10 ml bacterial culture grown to O.D600= 0.5 by pelleting the bacteria at 8000 x g for 10 min at 4°C. The bacterial pellet was then resuspended in 90 µl Lysis Buffer L1 (20% sucrose, 30 mM Tris Cl, pH = 8), 1 mM PMSF and 10 µl lysozyme from a 1 mg / ml stock made in 0.1 M EDTA and incubated on ice for 30 min. Sterile MgCl2 (final concentration 20mM) was then added to the bacterial suspension to stabilize the spheroplasts and the suspension was then centrifuged at 15000 g for 2 min. Supernatant containing periplasmic proteins was then removed, and the pellet was resuspended in 100 µl Lysis buffer L2 (10 mM Tris-Cl, 100 mM NaCl, 10 mM MgCl2, 1 mM EDTA) containing 1 mM PMSF and 1 µg / ml DNase. The pellet was then sonicated for 10 pulses with 1 min gap at maximum (10) amplitude. 0.5% Sarcosyl was then added to the mixture and incubated at room temperature for 20 min to solubilize the OM. Intact cells or un-solubilized material was removed by pelleting the mixture at 5000 g for 5 min and the supernatant was ultracentrifuged in a 50.2 Ti rotor at 50,000 rpm for 90 min to pellet the OMPs. The isolated OMPs were separated by SDS-PAGE and electro-transferred to a nitrocellulose membrane for western blotting. The presence of PagC, Rck, PagC-Rck chimeras, or PagC alanine or lysine mutants in the OMP fraction was detected using rabbit anti-PagC antibody at a 1:500 dilution. A goat anti-rabbit HRP conjugated antibody at 1:10,000 dilution was used as the secondary antibody (Jackson Immuno Research, PA, USA) followed by probing the blots with ECL substrate (GE Healthcare Life Sciences, MA, USA).^
[0086] Bioinformatics. Protein sequences were obtained from the UniProt database (accession numbers: P23988 for PagC; Q04817 for RcK, and A0A5P8YI02 for Ail) and analyzed in Jalview (43). Initial sequence alignments were generated with ClustalX (44) and then refined by several rounds of manual editing guided by the known eight-stranded ^-barrel structure of Ail (PDB: 2N2L) and the structural models predicted from AlphaFold for PagCDocket No.650053.01207 (code: AF-P23988) and RcK (code: AF-Q04817). Sequence identity, conservation, and consensus were calculated with Jalview. Protein sequences of wild-type and chimera, segments and portions are listed in Table 3.^
[0087] Statistics. One-way ANOVA multiple comparisons or Student’s t test were used for statistical calculations using Prism v. 8 (GraphPad Software, San Diego, CA, USA). Statistical significance was set at p < 0.05 (* p < 0.05, ** p < 0.01, *** p < 0.001 and **** p < 0.0001).^
[0088] MD Simulations. All-atom MD simulations were performed using the CHARMM36 force fields for protein, lipids, carbohydrate, and LPS (45-48) with the TIP3P water model (49). Briefly, all systems were prepared using CHARMM-GUI Membrane Builder (50-53) and equilibrated with the CHARMM-GUI standard protocol. The temperature was maintained at 310.15 K using Langevin dynamics, and pressure was maintained at 1 bar using the semi-isotropic Monte-Carlo barostat method (54, 55) with a 5 ps-1of coupling frequency. ^
[0089] A total of eight independent MD simulations was performed, starting from one structural model of PagC, with either neutral or protonated His (Table 2). The starting structure was obtained from the AlphaFold protein structure database (code: AF-P23988-F1 (32)) and then embedded in the membrane with different initial values of membrane depth and orientation in the different replicas, so that each MD run represents a distinct independent experiment. Each model was embedded in either an asymmetric STm outer membrane or a symmetric phospholipid lipid bilayer containing DMPC (dimyristoyl-phosphatidylcholine) and DMPG (dimyristoyl-phosphatidylglycerol).^ ^ Table 2. Systems for MD simulation. All simulations were initiated from AlphaFold: model P23988, with either neutral or protonated His residues. OM Top OM Bottom System Number of System Number of aflet Leaflet size Io water Le ns moleculesDocket No.650053.01207 OM Top OM Bottom System Number of System Number of Leaflet size I water Leaflet ons molecules [000. ucture of STm LPS (FIG.1A) includes a lipid A moiety with hexa-acylated fatty acid tails (56) The LPS core contained: βD-GlcNAc(1→6)αD-Glc(1→2)αD-Gal(1→3)[αD-Gal(1→6)]αD- Glc(1→3)αLD-Hep(1→3)αLD-Hep(1→5)[αD-Kdo(2→4)]αD-Kdo(2→, where D-GlcNAc is D-glucosamine, D-Glc is D-glucose, D-Gal is D-galactose, LD-Hep is L-glycero-D-manno- Heptose, and D-Kdo is D-3-deoxy-d-manno-oct-2-ulosonic acid. The inner leaflet of the STm OM contained a 3:1 molar ratio of DMPC to DMPG. Ca2+counterions were added to neutralize the LPS charges, and bulk 150 mM KCl was added to mimic the biological ionic strength.^
[0091] MD production simulations were conducted with OpenMM (57) with a time step interval of 2 fs, trajectories were generated every 0.5 ns. The six simulations of PagC in STm OM were conducted for 3 µs and the last 2 µs of trajectories were used for analysis, while the two simulations of PagC in symmetric lipid bilayer were conducted for 1.5 µs and the last 1 µs used for analysis. For each simulation, poses were saved every 0.5 ns of the trajectory duration, and trajectories from all simulations were combined for analysis in each of the three systems. Statistical analyses were performed with home-made Python scripts in MDAnalysis (58), PyLipid (59), and JupyterNotebook.^ TABLE 3 SEQUENCES Protein: wild-type PagC MKNIILSTLVITTSVLVVNVAQADTNAFS SDocket No.650053.01207 that these residues are numbered based on DKFEVKYGSLMVGPAYRLSDNFSLYALA their positions in the mature PagC protein (SEQ ID NO:11) GVGTVKATFKEHSTQDGDSFSNKISSRK N S F I L I D Y G V L D Y LDocket No.650053.01207 Protein: Rck-PagC3(wild-type Rck with EL3 MVMKKIVLSSLLLSAAGLAAVPVAQAD replaced with EL3 from PagC) Source: s nthetic THSVSVGYAQSRIEHFKDIRGVNLKYRY G V N R E S K Y S T Y I F V Y PDocket No.650053.01207 Source: Salmonella enterica subsp. enterica EGIHYHDKFEVKYGSLMVGPAYRLSDN serovar Typhimurium *Three ke histidine residues (H60 H62 and FSLYALAGVGTVKATFKEHSTQDGDSFS R G L EDocket No.650053.01207 Protein: mature PagC-RcK2-3(mature PagC DTNAFSVGYAQSKVQDFKNIRGVNVKY (SEQ ID NO:11) with EL2-EL3 replaced with EL2-EL3 from Rck) RYEAQTPLGLMASFSWQSGKRGESGGIP R G L S R E V
[0092] References: 1. Schwechheimer C, Kuehn MJ. 2015. Outer-membrane vesicles from Gram-negative bacteria: biogenesis and functions. Nat Rev Microbiol 13:605-19. 2. Sartorio MG, Pardue EJ, Feldman MF, Haurat MF. 2021. Bacterial Outer Membrane Vesicles: From Discovery to Applications. Annu Rev Microbiol 75:609-30. 3. Kulp A, Kuehn MJ. 2010. Biological functions and biogenesis of secreted bacterial outer membrane vesicles. Annu Rev Microbiol 64:163-84. 4. Mashburn LM, Whiteley M. 2005. Membrane vesicles traffic signals and facilitate group activities in a prokaryote. Nature 437:422-5.Docket No.650053.01207 Dutta S, Iida K, Takade A, Meno Y, Nair GB, Yoshida S.2004. Release of Shiga toxin by membrane vesicles in Shigella dysenteriae serotype 1 strains and in vitro effects of antimicrobials on toxin production and release. Microbiol Immunol 48:965-9. Toyofuku M, Schild S, Kaparakis-Liaskos M, Eberl L. 2023. Composition and functions of bacterial membrane vesicles. Nat Rev Microbiol 21:415-30. McBroom AJ, Kuehn MJ.2007. Release of outer membrane vesicles by Gram-negative bacteria is a novel envelope stress response. Mol Microbiol 63:545-58. Roier S, Zingl FG, Cakar F, Durakovic S, Kohl P, Eichmann TO, Klug L, Gadermaier B, Weinzerl K, Prassl R, Lass A, Daum G, Reidl J, Feldman MF, Schild S. 2016. A novel mechanism for the biogenesis of outer membrane vesicles in Gram-negative bacteria. Nat Commun 7:10515. Schwechheimer C, Sullivan CJ, Kuehn MJ.2013. Envelope control of outer membrane vesicle production in Gram-negative bacteria. Biochemistry 52:3031-40. Kudryakova IV, Suzina NE, Vinokurova NG, Shishkova NA, Vasilyeva NV. 2017. Studying Factors Involved in Biogenesis of Lysobacter sp. XL1 Outer Membrane Vesicles. Biochemistry (Mosc) 82:501-09. Bonnington KE, Kuehn MJ. 2017. Breaking the bilayer: OMV formation during environmental transitions. Microb Cell 4:64-66. Elhenawy W, Bording-Jorgensen M, Valguarnera E, Haurat MF, Wine E, Feldman MF. 2016. LPS Remodeling Triggers Formation of Outer Membrane Vesicles in Salmonella. mBio 7. Schromm AB, Brandenburg K, Loppnow H, Moran AP, Koch MH, Rietschel ET, Seydel U. 2000. Biological activities of lipopolysaccharides are determined by the shape of their lipid A portion. Eur J Biochem 267:2008-13. McMahon HT, Boucrot E.2015. Membrane curvature at a glance. J Cell Sci 128:1065- 70. Li Q.2022. Mechanisms for the Invasion and Dissemination of Salmonella. Can J Infect Dis Med Microbiol 2022:2655801. Ernst RK, Guina T, Miller SI. 1999. How intracellular bacteria survive: surface modifications that promote resistance to host innate immune responses. J Infect Dis 179 Suppl 2:S326-30. Vescovi EG, Ayala YM, Di Cera E, Groisman EA. 1997. Characterization of the bacterial sensor protein PhoQ. Evidence for distinct binding sites for Mg2+and Ca2+. J Biol Chem 272:1440-3.Docket No.650053.01207 Miller SI, Kukral AM, Mekalanos JJ.1989. A two-component regulatory system (phoP phoQ) controls Salmonella Typhimurium virulence. Proc Natl Acad Sci U S A 86:5054- 8. Groisman EA, Chiao E, Lipps CJ, Heffron F. 1989. Salmonella Typhimurium phoP virulence gene is a transcriptional regulator. Proc Natl Acad Sci U S A 86:7077-81. Alpuche Aranda CM, Swanson JA, Loomis WP, Miller SI. 1992. Salmonella Typhimurium activates virulence gene transcription within acidified macrophage phagosomes. Proc Natl Acad Sci U S A 89:10079-83. Bonnington KE, Kuehn MJ.2016. Outer Membrane Vesicle Production Facilitates LPS Remodeling and Outer Membrane Maintenance in Salmonella during Environmental Transitions. mBio 7. Bishop RE, Gibbons HS, Guina T, Trent MS, Miller SI, Raetz CR. 2000. Transfer of palmitate from phospholipids to lipid A in outer membranes of gram-negative bacteria. EMBO J 19:5071-80. Trent MS, Pabich W, Raetz CR, Miller SI.2001. A PhoP / PhoQ-induced Lipase (PagL) that catalyzes 3-O-deacylation of lipid A precursors in membranes of Salmonella Typhimurium. J Biol Chem 276:9083-92. Kitagawa R, Takaya A, Ohya M, Mizunoe Y, Takade A, Yoshida S, Isogai E, Yamamoto T. 2010. Biogenesis of Salmonella enterica serovar Typhimurium membrane vesicles provoked by induction of PagC. J Bacteriol 192:5645-56. Dehinwal R, Cooley D, Rakov AV, Alugupalli AS, Harmon J, Cunrath O, Vallabhajosyula P, Bumann D, Schifferli DM. 2021. Increased Production of Outer Membrane Vesicles by Salmonella Interferes with Complement-Mediated Innate Immune Attack. mBio 12:e0086921. Kawasaki K, Ernst RK, Miller SI. 2005. Inhibition of Salmonella enterica serovar Typhimurium lipopolysaccharide deacylation by aminoarabinose membrane modification. J Bacteriol 187:2448-57. Yamashita S, Lukacik P, Barnard TJ, Noinaj N, Felek S, Tsang TM, Krukonis ES, Hinnebusch BJ, Buchanan SK.2011. Structural insights into Ail-mediated adhesion in Yersinia pestis. Structure 19:1672-82. Marassi FM, Ding Y, Schwieters CD, Tian Y, Yao Y. 2015. Backbone structure of Yersinia pestis Ail determined in micelles by NMR-restrained simulated annealing with implicit membrane solvation. J Biomol NMR 63:59-65.Docket No.650053.01207 Dutta SK, Yao Y, Marassi FM.2017. Structural Insights into the Yersinia pestis Outer Membrane Protein Ail in Lipid Bilayers. J Phys Chem B 121:7561-70. Singh C, Lee H, Tian Y, Schesser Bartra S, Hower S, Fujimoto LM, Yao Y, Ivanov SA, Shaikhutdinova RZ, Anisimov AP, Plano GV, Im W, Marassi FM. 2020. Mutually constructive roles of Ail and LPS in Yersinia pestis serum survival. Mol Microbiol 114:510-20. Ricci DP, Silhavy TJ. 2019. Outer Membrane Protein Insertion by the beta-barrel Assembly Machine. EcoSal Plus 8. Jumper J, Evans R, Pritzel A, Green T, Figurnov M, Ronneberger O, Tunyasuvunakool K, Bates R, Zidek A, Potapenko A, Bridgland A, Meyer C, Kohl SAA, Ballard AJ, Cowie A, Romera-Paredes B, Nikolov S, Jain R, Adler J, Back T, Petersen S, Reiman D, Clancy E, Zielinski M, Steinegger M, Pacholska M, Berghammer T, Bodenstein S, Silver D, Vinyals O, Senior AW, Kavukcuoglu K, Kohli P, Hassabis D. 2021. Highly accurate protein structure prediction with AlphaFold. Nature 596:583-89. Waterhouse AM, Procter JB, Martin DM, Clamp M, Barton GJ.2009. Jalview Version 2--a multiple sequence alignment editor and analysis workbench. Bioinformatics 25:1189-91. Harrison JS, Higgins CD, O'Meara MJ, Koellhoffer JF, Kuhlman BA, Lai JR. 2013. Role of electrostatic repulsion in controlling pH-dependent conformational changes of viral fusion proteins. Structure 21:1085-96. Mihailescu M, Sorci M, Seckute J, Silin VI, Hammer J, Perrin BS, Jr., Hernandez JI, Smajic N, Shrestha A, Bogardus KA, Greenwood AI, Fu R, Blazyk J, Pastor RW, Nicholson LK, Belfort G, Cotten ML. 2019. Structure and Function in Antimicrobial Piscidins: Histidine Position, Directionality of Membrane Insertion, and pH-Dependent Permeabilization. J Am Chem Soc 141:9837-53. Kovalevsky A, Chatake T, Shibayama N, Park SY, Ishikawa T, Mustyakimov M, Fisher SZ, Langan P, Morimoto Y.2010. Protonation states of histidine and other key residues in deoxy normal human adult hemoglobin by neutron protein crystallography. Acta Crystallogr D Biol Crystallogr 66:1144-52. Baumgart T, Capraro BR, Zhu C, Das SL. 2011. Thermodynamics and mechanics of membrane curvature generation and sensing by proteins and lipids. Annu Rev Phys Chem 62:483-506.Docket No.650053.01207 Siggel M, Bhaskara RM, Moesser MK, I DI, Hummer G. 2021. FAM134B-RHD Protein Clustering Drives Spontaneous Budding of Asymmetric Membranes. J Phys Chem Lett 12:1926-1931. Cianfanelli FR, Cunrath O, Bumann D. 2020. Efficient dual-negative selection for bacterial genome editing. BMC Microbiol 20:129. Cunrath O, Meinel DM, Maturana P, Fanous J, Buyck JM, Saint Auguste P, Seth-Smith HMB, Korner J, Dehio C, Trebosc V, Kemmer C, Neher R, Egli A, Bumann D.2019. Quantitative contribution of efflux to multi-drug resistance of clinical Escherichia coli and Pseudomonas aeruginosa strains. EBioMedicine 41:479-87. Sengyee S, Yoon SH, Paksanont S, Yimthin T, Wuthiekanun V, Limmathurotsakul D, West TE, Ernst RK, Chantratita N. 2018. Comprehensive analysis of clinical Burkholderia pseudomallei isolates demonstrates conservation of unique lipid A structure and TLR4-dependent innate immune activation. PLoS Negl Trop Dis 12:e0006287. Hittle LE, Powell DA, Jones JW, Tofigh M, Goodlett DR, Moskowitz SM, Ernst RK. 2015. Site-specific activity of the acyltransferases HtrB1 and HtrB2 in Pseudomonas aeruginosa lipid A biosynthesis. Pathog Dis 73:ftv053. Clamp M, Cuff J, Searle SM, Barton GJ. 2004. The Jalview Java alignment editor. Bioinformatics 20:426-7. Thompson JD, Higgins DG, Gibson TJ.1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position- specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673-80. Brooks BR, Brooks CL, 3rd, Mackerell AD, Jr., Nilsson L, Petrella RJ, Roux B, Won Y, Archontis G, Bartels C, Boresch S, Caflisch A, Caves L, Cui Q, Dinner AR, Feig M, Fischer S, Gao J, Hodoscek M, Im W, Kuczera K, Lazaridis T, Ma J, Ovchinnikov V, Paci E, Pastor RW, Post CB, Pu JZ, Schaefer M, Tidor B, Venable RM, Woodcock HL, Wu X, Yang W, York DM, Karplus M.2009. CHARMM: the biomolecular simulation program. J Comput Chem 30:1545-614. Hatcher E, Guvench O, Mackerell AD.2009. CHARMM additive all-atom force field for aldopentofuranoses, methyl-aldopentofuranosides, and fructofuranose. J Phys Chem B 113:12466-76. Klauda JB, Venable RM, Freites JA, O'Connor JW, Tobias DJ, Mondragon-Ramirez C, Vorobyov I, MacKerell AD, Jr., Pastor RW. 2010. Update of the CHARMM all-Docket No.650053.01207 atom additive force field for lipids: validation on six lipid types. J Phys Chem B 114:7830-43. Guvench O, Greene SN, Kamath G, Brady JW, Venable RM, Pastor RW, Mackerell AD, Jr. 2008. Additive empirical force field for hexopyranose monosaccharides. J Comput Chem 29:2543-64. Jorgensen WL, Chandrasekhar J, Madura JD, Impey RW, Klein ML.1983. Comparison of simple potential functions for simulating liquid water. The Journal of Chemical Physics 79:926-35. Jo S, Kim T, Iyer VG, Im W. 2008. CHARMM-GUI: a web-based graphical user interface for CHARMM. J Comput Chem 29:1859-65. Jo S, Lim JB, Klauda JB, Im W. 2009. CHARMM-GUI Membrane Builder for mixed bilayers and its application to yeast membranes. Biophys J 97:50-8. Wu EL, Cheng X, Jo S, Rui H, Song KC, Davila-Contreras EM, Qi Y, Lee J, Monje- Galvan V, Venable RM, Klauda JB, Im W.2014. CHARMM-GUI Membrane Builder toward realistic biological membrane simulations. J Comput Chem 35:1997-2004. Lee J, Patel DS, Stahle J, Park SJ, Kern NR, Kim S, Lee J, Cheng X, Valvano MA, Holst O, Knirel YA, Qi Y, Jo S, Klauda JB, Widmalm G, Im W.2019. CHARMM-GUI Membrane Builder for Complex Biological Membrane Simulations with Glycolipids and Lipoglycans. J Chem Theory Comput 15:775-86. Chow K-H, Ferguson DM.1995. Isothermal-isobaric molecular dynamics simulations with Monte Carlo volume sampling. Comput Phys Commun 91:283-289. Åqvist J, Wennerström P, Nervall M, Bjelic S, Brandsdal BO. 2004. Molecular dynamics simulations of water and biomolecules with a Monte Carlo constant pressure algorithm. Chem Phys Lett 384:288-294. Ernst RK, Guina T, Miller SI. 2001. Salmonella typhimurium outer membrane remodeling: role in resistance to host innate immunity. Microbes Infect 3:1327-34. Eastman P, Friedrichs MS, Chodera JD, Radmer RJ, Bruns CM, Ku JP, Beauchamp KA, Lane TJ, Wang LP, Shukla D, Tye T, Houston M, Stich T, Klein C, Shirts MR, Pande VS.2013. OpenMM 4: A Reusable, Extensible, Hardware Independent Library for High Performance Molecular Simulation. J Chem Theory Comput 9:461-69. Michaud-Agrawal N, Denning EJ, Woolf TB, Beckstein O. 2011. MDAnalysis: a toolkit for the analysis of molecular dynamics simulations. J Comput Chem 32:2319- 27.Docket No.650053.01207 Song W, Corey RA, Ansell TB, Cassidy CK, Horrell MR, Duncan AL, Stansfeld PJ, Sansom MSP. 2022. PyLipID: A Python Package for Analysis of Protein–Lipid Interactions from Molecular Dynamics Simulations. Journal of Chemical Theory and Computation 18:1188-1201.
Claims
Docket No.650053.01207 CLAIMS What is claimed:
1. An engineered outer membrane protein (OMP) modified to comprise one or more extracellular loops from Salmonella enterica serovar Typhimurium protein PagC (PagC) or a functional portion thereof.
2. The engineered OMP of claim 1, wherein the one or more extracellular loops comprise loop 2 of PagC.
3. The engineered OMP of claim 2, wherein loop 2 comprises the wild-type loop 2 sequence (SEQ ID NO: 2).
4. The engineered OMP of claim 2, wherein loop 2 comprises one or more substitution mutations selected from H60K and H62K, wherein each position is numbered relative to SEQ ID NO:
11.
5. The engineered OMP of any one of the preceding claims, wherein the one or more extracellular loops comprise loop 3 of PagC.
6. The engineered OMP of claim 5, wherein loop 3 comprises the wild-type loop 3 sequence (SEQ ID NO: 3).
7. The engineered OMP of claim 5, wherein loop 3 comprises the substitution mutation H102K.
8. The engineered OMP of claim 1, wherein the one or more extracellular loops comprise both loop 2 and loop 3 of PagC, and wherein the engineered OMP comprises SEQ ID NO:
4.
9. The engineered OMP of any one of any one of claims 1-8, wherein the OMP is modified via insertion of the one or more extracellular loops from PagC or functional portion thereof.
10. The engineered OMP of any one of any one of claims 1-8, wherein the OMP is modified via substitution of one or more endogenous extracellular loops with the one or more extracellular loops from PagC or functional portion thereof.
11. The engineered OMP of any one of the preceding claims, wherein the engineered OMP is derived from a wild-type OMP selected from Rck and Ail.
12. The engineered OMP of claim 11, wherein the wild-type OMP is Rck.Docket No.650053.01207 13. The engineered OMP of claim 12, wherein the engineered OMP is selected from Rck- PagC2(SEQ ID NO: 6), Rck-PagC3(SEQ ID NO: 7), and Rck-PagC2-3(SEQ ID NO: 8).
14. A polynucleotide encoding the engineered OMP of any one of the preceding claims.
15. A cell that expresses the engineered OMP of any one of claims 1-13.
16. The cell of claim 15, wherein the cell is a Gram-negative bacterial cell.
17. The cell of claim 16, wherein the cell exhibits increased outer membrane vesicle (OMV) production as compared to a control cell that does not express the engineered OMP.
18. The cell of any one of claims 15-17, wherein the engineered OMP is derived from a wild- type OMP that is natively expressed by the cell.
19. The cell of any one of claims 15-17, wherein the engineered OMP is derived from a wild- type OMP that is not natively expressed by the cell.
20. A method comprising expressing the engineered OMP of any one of claims 1-13 in a cell.
21. The method of claim 20, wherein the cell is a Gram-negative bacterial cell.
22. The method of claim 21, wherein the method results in increased OMV production in the cell as compared to OMV production in a control cell that does not express the engineered OMP.
23. The method of any one of claims 20-22, wherein the engineered OMP is derived from a wild-type OMP that is natively expressed by the cell.
24. The method of any one of claims 20-22, wherein the engineered OMP is derived from a wild-type OMP that is not natively expressed by the cell.
Citation Information
Patent Citations
Polypeptide display libraries and methods of making and using thereof
US20220119802A1
Salmonella vaccine proteins
WO2012025831A2