Anti-tumor molecular preparation of targeted ceramide kinase and application of anti-tumor molecular preparation

Abstract

The invention discloses an anti-tumor molecular preparation of targeted ceramide kinase and application of the anti-tumor molecular preparation, and relates to the technical field of biology, the molecular preparation is a microRNA micromolecule EBV-miR-BART17-5p derived from EB virus coding, and the molecular preparation is applied to targeted down-regulation of expression of ceramide kinase genes and inhibition of activation of PI3K / AKT / NF-kappa B signal channels. The nucleotide sequence of the EBV-miR-BART17-5p simulant is UAAGAGGACGCAGGCAUACAAG, the nucleotide sequence of the EBV-miR-BART17-5p simulant The nucleotide sequence of the inhibitor is CUUGUAUGCCUGCGUCCUUUA, and the nucleotide sequence of the inhibitor is CUUGUAUGCCUGCGUCCUUUA. The compound is used for inhibiting proliferation, migration and invasion of gastric cancer cells and is further applied to preparation of drugs for treating gastric cancer.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to an anti-tumor molecular preparation targeting ceramide kinase and application thereof. Background Art

[0002] Epstein-Barr Virus (EBV) is a linear double-stranded DNA virus belonging to the genus Lymphotropic virus of the family Herpesviridae. More than 90% of adults worldwide have been infected with EBV, and approximately 200,000 cancers are caused by EBV infection each year, resulting in approximately 140,000 deaths. After infection, EBV can establish a long-term latent infection in host cells without producing any symptoms. However, under certain circumstances, EBV reactivation may cause serious diseases and is closely related to a variety of malignancies, such as Burkitt's Lymphoma (BL), Hodgkin Lymphoma (HL), AIDS-related Non-Hodgkin lymphoma (AIDs-related Non-Hodgkin lymphoma), Post-transplant Lymphoproliferative Disorders (PTLD), Diffuse Large B Cell Lymphoma (DLBCL), NK / T Cell Lymphoma (NK / T Cell Lymphoma), Nasopharyngeal Carcinoma (NPC) and EBV-associated Gastric Cancer (EBVaGC). Although studies have shown that certain antiviral drugs and proton pump inhibitors can effectively inhibit the replication of EBV, there is currently no officially approved treatment, and these drugs have limited therapeutic effects on latent infection.

[0003] EBV is the first virus found to encode viral microRNA (miRNA). MiRNAs are a group of small non-coding RNAs that play an important role in gene expression by inhibiting target mRNA through transcriptional regulation. Discovering effective diagnostic and therapeutic targets is the key to precision treatment and better outcomes. MiRNAs can serve as measurable epigenomic biomarkers that indicate biological or pathogenic processes or reflect the body's response to exposure or intervention (such as therapeutic treatment). EBV can encode 44 mature miRNAs, which can inhibit viral lysis, regulate inflammatory responses, regulate immune escape, regulate cell apoptosis, promote tumor metastasis, and regulate tumor cell metabolism. Therefore, studying the meaning and potential significance of the different expressions of EBV-encoded miRNAs in EBV-related diseases can not only serve as sensitive indicators for biological detection, but also as therapeutic targets.

[0004] EBV-encoded EBV-miR-BART17-5p is the most common viral miRNA in BL and can be used as a useful factor or prognostic factor for BL diagnosis; it is also a promising therapeutic target for regulating oncogenes. In addition, the concentration of EBV-miR-BART17-5p in plasma samples of NPC patients is consistently high, and EBV-miR-BART17-5p has been detected in 55% of NPC patients who relapse after treatment, suggesting that it can be used as a candidate biomarker indicating NPC and a potential biomarker for poor prognosis. During viral infection, EBV-miR-BART17-5p downregulates the expression of the latent protein LMP1 encoded by EBV by targeting it, thereby interfering with the immune recognition function of cytotoxic T cells, reducing cytotoxicity and inhibiting cell apoptosis. In NPC, EBV-miR-BART17-5p sensitizes NPC to chemotherapeutic drugs by targeting the host gene BRCA1, which may help develop effective NPC therapies. Therefore, EBV-BART17-5p plays various key roles in EBV-related diseases by targeting different genes.

[0005] Therefore, technicians in this field are committed to developing a molecular preparation of Epstein-Barr virus microRNA EBV-miR-BART17-5p targeting ceramide kinase, and applying it to the treatment of gastric cancer. Summary of the invention

[0006] In view of the above-mentioned defects of the prior art, the technical problem to be solved by the present invention is to develop a molecular preparation of Epstein-Barr virus microRNA EBV-miR-BART17-5p targeting ceramide kinase (CERK), and apply it to the treatment of gastric cancer.

[0007] To achieve the above purpose, the present invention provides an anti-tumor molecular preparation targeting ceramide kinase (CERK), which is derived from the microRNA small molecule EBV-miR-BART17-5p encoded by Epstein-Barr virus, and its nucleotide sequence is: UAAGAGGACGCAGGCAUACAAG. The nucleotide sequence of the EBV-miR-BART17-5p mimetic is: UAAGAGGACGCAGGCAUACAAG.

[0008] The present invention also provides an anti-tumor molecular preparation targeting ceramide kinase, namely the above-mentioned mimic of EB virus microRNA, which is used for targeted down-regulation of CERK gene expression.

[0009] The present invention also provides an anti-tumor molecular preparation targeting ceramide kinase for use in inhibiting the activation of PI3K / AKT / NF-κB signaling pathway.

[0010] The present invention also provides an anti-tumor molecular preparation targeting ceramide kinase for use in preparing a drug for treating gastric cancer.

[0011] Furthermore, the drug for treating gastric cancer is a drug that inhibits the proliferation, migration and invasion of gastric cancer cells.

[0012] The present invention also provides an inhibitor for inhibiting the expression of EBV-miR-BART17-5p, and the nucleotide sequence is: CUUGUAUGCCUGCGUCCUCUUA.

[0013] Furthermore, EBV-miR-BART17-5p mimics and inhibitors were designed and synthesized using the EBV-miR-BART17-5p sequence. CCK-8 experiments, NSG mouse subcutaneous tumor formation and intratumor injection experiments confirmed that EBV-miR-BART17-5p could slow the growth of gastric cancer cells and reduce the rate of subcutaneous tumor formation in NSG mice.

[0014] Furthermore, it was confirmed that EBV-miR-BART17-5p could inhibit the proliferation of gastric cancer cells, and that EBV-miR-BART17-5p mimics could inhibit the rate of subcutaneous tumor growth in NSG mice.

[0015] Furthermore, it was confirmed that EBV-miR-BART17-5p can inhibit the migration and invasion of gastric cancer cells. This suggests that EBV-miR-BART17-5p encoded by EBV may be one of the reasons why EBV-positive gastric cancer has a better prognosis than EBV-negative gastric cancer in clinical practice.

[0016] Furthermore, EBV-miR-BART17-5p mimics and inhibitors were designed and synthesized using the EBV-miR-BART17-5p sequence, and scratch experiments and Transwell migration and invasion chambers confirmed that EBV-miR-BART17-5p could weaken the migration and invasion ability of gastric cancer cells.

[0017] Furthermore, bioinformatics analysis predicted the potential host target gene CERK of EBV-miR-BART17-5p, and dual luciferase reporter assay and Western blot assay confirmed that EBV-miR-BART17-5p targeted the CERK gene.

[0018] Furthermore, it was confirmed that EBV-miR-BART17-5p can target the host gene CERK and downregulate its expression in gastric cancer cells. This finding provides new strategies and directions for the precision treatment of gastric cancer.

[0019] Furthermore, it was found that EBV-miR-BART17-5p targeted down-regulated CERK gene expression, thereby inhibiting the activation of the PI3K / AKT / NF-κB signaling pathway, leading to weakened proliferation, migration and invasion ability of gastric cancer cells.

[0020] Furthermore, using CERK inhibitors and PI3K inhibitors, Western blot experiments confirmed that EBV-miR-BART17-5p inhibited the activation of the PI3K / AKT / NF-κB signaling pathway by targeting and downregulating CERK gene expression, thereby inhibiting the proliferation, migration and invasion of gastric cancer cells.

[0021] In preferred embodiment 1 of the present invention, the process of screening and analyzing to obtain EBV-miR-BART17-5p and its target gene CERK, as well as preparing CERK plasmid and EBV-miR-BART17-5p mimics and inhibitors is described in detail;

[0022] In another preferred embodiment 2 of the present invention, the experimental process is described in detail that EBV-miR-BART17-5p can inhibit the activation of the PI3K / AKT / NF-κB signaling pathway by targeted downregulation of CERK gene expression, thereby inhibiting the proliferation, migration and invasion of gastric cancer cells.

[0023] The beneficial technical effects of the present invention are as follows:

[0024] By using the sequence of EBV-miR-BART17-5p to design and synthesize EBV-miR-BART17-5p mimics and inhibitors, it was found that EBV-miR-BART17-5p can target the host gene ceramide kinase (Ceramide Kinase, CERK) and downregulate its expression, thereby inhibiting the proliferation, migration and invasion of gastric cancer cells. At the same time, using the sequence of EBV-miR-BART17-5p to design and synthesize chemically modified EBV-miR-BART17-5p mimics and inhibitors, after subcutaneous injection of AGS cells or AGS-EBV cells into NSG mice to form tumors, and then injecting mimics or inhibitors into the tumors, it was found that EBV-miR-BART17-5p can inhibit the speed of subcutaneous tumor formation in NSG mice.

[0025] The present invention provides a new gastric cancer treatment method. By developing a molecular preparation based on EBV-miR-BART17-5 and then injecting the EBV-miR-BART17-5p molecular preparation into the tumor of EBV-negative gastric cancer patients, it is expected to inhibit tumor growth, thereby improving the treatment effect and reducing damage to normal cells. In addition, compared with traditional chemotherapy and radiotherapy, the miRNA-based treatment strategy may have lower toxicity and higher safety.

[0026] Therapeutic strategies targeting EBV-miR-BART17-5p may effectively inhibit the metastasis of gastric cancer cells, thereby improving the prognosis of patients; and may serve as a new therapeutic and prognostic biomarker for EBV-related cancers.

[0027] The discovery of the CERK gene provides a new molecular target for targeted therapy of gastric cancer, which will help develop more effective therapeutic drugs. The present invention reveals an unreported mechanism by which EBV infection leads to EBV-related gastric cancer, and provides a potential target or strategy for gastric cancer and other EBV-related cancers, as well as a new perspective for understanding the carcinogenic process associated with EBV infection.

[0028] The concept, specific structure and technical effects of the present invention will be further described below in conjunction with the accompanying drawings to fully understand the purpose, characteristics and effects of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 It is a schematic diagram of a preferred embodiment 1 of the present invention predicting the potential targeting relationship between EBV-miR-BART17-5p encoded by EBV and the host gene CERK;

[0030] Figure 2It is a schematic diagram of the binding site of EBV-miR-BART17-5p and 3'UTR of CERK gene and the mutation of the binding site according to a preferred embodiment 1 of the present invention;

[0031] Figure 3 It is a preferred embodiment 2 of the present invention that EBV-miR-BART17-5p mimics or inhibitors can be used to detect EBV-miR-BART17-5p in AGS or AGS-EBV cells to inhibit cell proliferation, migration and invasion.

[0032] Figure 4 A preferred embodiment 2 of the present invention is a result diagram showing that EBV-miR-BART17-5p inhibits tumor growth rate in tumors formed by AGS or AGS-EBV cells using a chemically modified mimetic or inhibitor of EBV-miR-BART17-5p;

[0033] Figure 5 This is a result diagram of a preferred embodiment 2 of the present invention, in which EBV-miR-BART17-5p mimics or inhibitors and pmirGLO-CERK-WT or pmirGLO-CERK-MUT can be used to observe EBV-miR-BART17-5p targeted downregulation of CERK gene expression in AGS or AGS-EBV cells;

[0034] Figure 6 This is a result diagram of a preferred embodiment 2 of the present invention, in which EBV-miR-BART17-5p was observed to target and down-regulate CERK gene expression in AGS or AGS-EBV cells using phouge-CERK recombinant vector, CERK inhibitor NVP231 and PI3K inhibitor LY294002, thereby inhibiting the activation of the PI3K / AKT / NF-κB signaling pathway. DETAILED DESCRIPTION

[0035] The following describes several preferred embodiments of the present invention with reference to the drawings in the specification, so that the technical content is clearer and easier to understand. The present invention can be embodied in many different forms of embodiments, and the protection scope of the present invention is not limited to the embodiments mentioned in the text.

[0036] Example 1 EBV-miR-BART17-5p and its target gene CERK, plasmid, mimics and inhibitors

[0037] The GSE51575 dataset and TCGA dataset containing EBV-positive and EBV-negative gastric cancer samples were used. Through bioinformatics analysis, differentially expressed genes that were downregulated in both datasets were screened. The relationship between these downregulated differentially expressed genes and EBV-encoded miRNAs was analyzed using the ViRBase data website, such as Figure 1 As shown in the figure, it was predicted that EBV-miR-BART17-5p encoded by EBV may have a potential targeting relationship with the host gene CERK. Then the sequence of EBV-miR-BART17-5p was obtained from the miRBase data website, and the mRNA sequence of the CERK gene was obtained from the NCBI data website, as shown in the sequence SEQ ID NO: 1. The RNAhybrid data website was used to predict the potential targeting binding sequence between EBV-miR-BART17-5p and CERK. Subsequently, the sequence fragment containing the potential binding site in the CERK gene was constructed on the pmirGLO Dual-Luciferase miRNA Target Expression Vector (hereinafter referred to as pmirGLO) vector to form the pmirGLO-CERK-WT recombinant vector; at the same time, the potential binding site was mutated, and the mutated sequence fragment was also constructed on the pmirGLO vector to form the pmirGLO-CERK-MUT recombinant vector, and a schematic diagram was drawn. The schematic diagram of the binding site of EBV-miR-BART17-5p and the 3'UTR of the CERK gene and the mutation of the binding site is shown in the figure. Figure 2 As shown. The sequence of CERK 3'UTR in the pmirGLO-CERK-WT recombinant vector is: GGAAAGTCTGAGTGAAAGGATGGCCTCATTCTCTTTCTAATCTTGCTGGTTTCAA GATTA; the sequence of CERK 3'UTR mutation in the pmirGLO-CERK-MUT recombinant vector is: GGAAAGTCTGAGTGAAAGGATGCGGAGAAAGAGAAACTAATCTTGCTGGTTTCA AGATTA. In addition, we designed mimics that can overexpress EBV-miR-BART17-5p and inhibitors that can inhibit the expression of EBV-miR-BART17-5p for the EBV-miR-BART17-5p sequence, and commissioned Suzhou Jima Gene Co., Ltd. to synthesize them. At the same time, we also designed chemically modified mimics and inhibitors of EBV-miR-BART17-5p for the EBV-miR-BART17-5p sequence, and commissioned Guangzhou Ruibo Biotechnology Co., Ltd. to synthesize them.

[0038] Example 2 EBV-miR-BART17-5p can inhibit the proliferation, migration and invasion of gastric cancer cells

[0039] EBV-miR-BART17-5p was expressed in EBV-negative AGS gastric cancer cells using mimics, or the expression of EBV-miR-BART17-5p was inhibited in EBV-positive AGS-EBV gastric cancer cells using inhibitors. Cell proliferation, migration and invasion were detected by CCK-8, cell scratch, Transwell migration chamber and Transwell invasion chamber experiments. The results are shown in Figure 3 As shown, group A indicates that after overexpression of EBV-miR-BART17-5p in AGS gastric cancer cells, the cell growth rate slowed down compared with the control group, the scratch healing rate weakened compared with the control group, and the cell migration and invasion rate slowed down compared with the control group; group B indicates that after inhibiting EBV-miR-BART17-5p expression in AGS-EBV gastric cancer cells, the cell growth rate accelerated compared with the control group, the scratch healing rate enhanced compared with the control group, and the cell migration and invasion rate increased compared with the control group. These results collectively indicate that EBV-miR-BART17-5p slows down the growth, migration and invasion rates of gastric cancer cells.

[0040] AGS cells or AGS-EBV cells were injected subcutaneously 1 cm below the left armpit of NSG mice. After the tumor was formed and reached a size of 5mmх5mm, chemically modified mimics were injected into the tumor formed by AGS cells, and chemically modified inhibitors were injected into the tumor formed by AGS-EBV cells, and the tumor growth rate was observed. Figure 4 As shown, in group A, it can be observed that the tumor volume and weight of the tumor formed by AGS cells after injection of the mimics were smaller than those of the control group; in group B, it can be observed that the tumor volume and weight of the tumor formed by AGS-EBV cells after injection of the inhibitor to inhibit EBV-miR-BART17-5p were larger than those of the control group. These results together indicate that EBV-miR-BART17-5p mimics can inhibit tumor growth rate.

[0041] EBV-miR-BART17-5p mimics and pmirGLO-CERK-WT or pmirGLO-CERK-MUT were simultaneously expressed in AGS cells, or EBV-miR-BART17-5p inhibitors and pmirGLO-CERK-WT or pmirGLO-CERK-MUT were used in AGS-EBV cells, and the targeted regulation between EBV-miR-BART17-5p and CERK was detected by dual-luciferase reporter gene assay, real-time fluorescence quantitative PCR, and Western blot. The results are shown in Figure 5As shown in the figure, group A shows that after overexpression of EBV-miR-BART17-5p in AGS gastric cancer cells, the activity and expression of CERK gene were inhibited; group B shows that after inhibition of EBV-miR-BART17-5p expression in AGS-EBV gastric cancer cells, the activity and expression of CERK gene were upregulated. These results together indicate that EBV-miR-BART17-5p targets and regulates CERK gene and downregulates its expression.

[0042] The CERK inhibitor NVP 231 and PI3K inhibitor LY294002 purchased from MCE and the pCDH-EF1-MCS-T2A-Puro-CERK (hereinafter referred to as phouge-CERK) recombinant vector synthesized by Anhui General Biotechnology Co., Ltd., whose nucleotide sequence is shown in the sequence table SEQ ID NO: 1, were used to detect the expression of various protein indicators by Western blot. The results are shown in Figure 6 As shown in the figure, it can be observed that EBV-miR-BART17-5p down-regulates CERK, PI3K, pAKT and NF-κBp65 expression in AGS cells; and after EBV-miR-BART17-5p down-regulates CERK expression, it complements CERK gene expression, and PI3K, pAKT and NF-κBp65 expression are also up-regulated. In AGS-EBV cells, it can be observed that after inhibiting EBV-miR-BART17-5p expression, CERK, PI3K, pAKT and NF-κB p65 expression are all up-regulated; and after inhibiting CERK or PI3K expression, the expression of downstream indicators is inhibited. This indicates that EBV-miR-BART17-5p inhibits the activation of PI3K / AKT / NF-κB signaling pathway by targeting down-regulating CERK expression, thereby inhibiting the proliferation, migration and invasion of gastric cancer cells.

[0043] The preferred specific embodiments of the present invention are described in detail above. It should be understood that ordinary technicians in the field can make many modifications and changes based on the concept of the present invention without creative work. Therefore, all technical solutions that can be obtained by technicians in the technical field based on the concept of the present invention through logical analysis, reasoning or limited experiments on the basis of the prior art should be within the scope of protection determined by the claims.

Claims

1. An anti-tumor molecular preparation targeting ceramide kinase, characterized in that: The molecular preparation is derived from the microRNA small molecule EBV-miR-BART17-5p encoded by Epstein-Barr virus, and its nucleotide sequence is: UAAGAGGACGCAGGCAUACAAG.

2. An anti-tumor molecular preparation targeting ceramide kinase as claimed in claim 1 is used for targeted downregulation of CERK gene expression.

3. An anti-tumor molecular preparation targeting ceramide kinase as claimed in claim 1 is used to inhibit the activation of PI3K / AKT / NF-κB signaling pathway.

4. An anti-tumor molecular preparation targeting ceramide kinase as claimed in claim 1 is used in the preparation of a drug for treating gastric cancer.

5. The use according to claim 4, characterized in that The drug for treating gastric cancer is a drug for inhibiting the proliferation, migration and invasion of gastric cancer cells.

6. An inhibitor for inhibiting the expression of EBV-miR-BART17-5p, characterized in that The nucleotide sequence of the inhibitor is: CUUGUAUGCCUGCGUCCUCUUA.

Images