Echinacea polysaccharide-containing medicine for resisting hemorrhagic syndrome virus of Chinese softshell turtles and application

Abstract

The invention discloses an echinacea purpurea polysaccharide-containing medicine for resisting TSHSV (Trionyx sinensis hemorrhagic syndrome virus) and application of the echinacea purpurea polysaccharide-containing medicine, and the echinacea purpurea polysaccharide can improve the survival rate of the TSHSV infected Chinese softshell turtles, can remarkably reduce the virus load in the spleen and the lung, and can relieve the damage of tissues and organs such as the spleen, the liver, the kidney and the lung. In addition, the mRNA expression level of the anti-virus related genes rsad2 and usp18 of the echinacea purpurea polysaccharide treatment group is relatively low. The echinacea purpurea polysaccharide has a certain protection effect on TSHSV infected soft-shelled turtles, can effectively inhibit TSHSV proliferation and regulate the immune function of the Chinese soft-shelled turtles, and is expected to become a means for preventing TSHSV.

Description

Technical Field

[0001] The invention relates to the technical field of disease prevention and treatment of Chinese soft-shelled turtle, and in particular to an anti-Chinese soft-shelled turtle hemorrhagic syndrome virus drug containing Echinacea polysaccharide and application thereof. Background Art

[0002] Chinese soft-shell turtle ( Pelodiscus sinensis ), commonly known as soft-shelled turtle, is widely farmed for its rich nutritional value and medicinal value. In 2022, the total national aquaculture output reached 373,709 tons (Ministry of Agriculture and Rural Affairs Fisheries Administration, 2023). However, intensive farming has led to frequent outbreaks of bacterial and viral diseases, causing huge economic losses to the turtle farming industry. Viral mumps is a type of viral disease that has caused great harm to turtles in recent years. Its pathogen is the Chinese soft-shelled turtle hemorrhagic syndrome virus ( Trionyx sinensis TSHSV is an enveloped single-stranded RNA virus with a diameter of 60-80 nm. It is homologous to arteritis virus and is the earliest discovered arteritis virus family that infects amphibians and reptiles. Since the discovery of TSHSV, some scholars have conducted preliminary explorations on the virus's infection mechanism and host antiviral mechanism through lung tissue transcriptomics and liver proteomics. It is worth noting that after viral infection, antiviral genes are expressed in rsad2 and mx2 mRNA expression was significantly upregulated, indicating rsad2 and mx2 Participated in the antiviral immune response of turtles. Studies have found that vaccines have achieved outstanding results in preventing viral diseases in aquatic animals. Unfortunately, TSHSV has antibody-dependent enhancement (ADE). Under the stimulation of polyclonal antibodies, the antiviral gene rsad2 and mx2 and viral copy number were significantly upregulated (LYU SJ, YUAN XM, LIU L, et al . Application of a recombinant replicaseto localize the Trionyx sinensis hemorrhagic syndrome virus and evaluate its effects on antiviral genes of T. sinensis. Journal of Zhejiang University.Science. B, 2021, 22: 295-304.). Therefore, it is urgent to find other technical approaches that can effectively prevent TSHSV.

[0003] Chinese herbal medicine is safe, effective, has few toxic side effects, is not prone to drug resistance and drug residues, meets the requirements of pollution-free aquaculture, and is beneficial to the health of consumers. Therefore, it is widely used in the prevention and control of aquatic animal diseases. Echinacea is one of the most popular herbs in the international herbal medicine market. It has multiple functions such as antioxidant, antibacterial, antiviral, anti-inflammatory and immunomodulatory. Among them, polysaccharides are considered to be one of the main components of Echinacea that exert medicinal activity. Luetlig et al. (LUETTIG B, STEINMüLLER C, GIFFORD GE, et al . Macrophage activation by the polysaccharide arabinogalactan isolated from plant cell cultures of Echinacea purpurea. Journal of the National Cancer Institute, 1989, 81: 669-675.) found that different concentrations of Echinacea purpurea polysaccharide (EPP) can stimulate macrophages to release tumor necrosis factor-α ( TNF-α ) Interferon beta ( Ifn-β ), thereby enhancing immune activity. Stelnmuller et al. (STEINMüLLER C, ROESLER J, GRöTTRUP E, et al. Polysaccharides isolated from plant cell cultures of Echinacea purpurea enhance the resistance of immunosuppressed mice against systemic infections with Candida albicans and Listeria monocytogenes. International Immunopharmacology, 1993, 15: 605-614.) reported that EPP can inhibit the proliferation of Candida albicans and prolong the life span of infected mice. Zhai Hongrui et al. (Zhai Hongrui, Zhang Dongli, Guo Qing. In vitro antibacterial test of 7 traditional Chinese medicines on pathogens of bovine mastitis. China Dairy, 2022, 34-37) also found that EPP has an antibacterial effect on bovine mastitis pathogens Staphylococcus aureus and Escherichia coli.

[0004] However, there is no report on the effect of Echinacea polysaccharides on the aquatic virus, Chinese soft-shelled turtle hemorrhagic syndrome virus. At present, it is still unclear whether EPP has a preventive effect on TSHSV, and relevant research is needed. Summary of the invention

[0005] The purpose of the present invention is to provide an anti-Chinese soft-shell turtle hemorrhagic syndrome virus drug containing Echinacea polysaccharide and its application. EPP has a certain protective effect on soft-shell turtles infected with TSHSV, and EPP can effectively inhibit the proliferation of TSHSV.

[0006] The technical solution adopted by the present invention to solve the technical problem is: Application of Echinacea polysaccharide in the preparation of drugs against Chinese soft-shell turtle hemorrhagic syndrome virus.

[0007] The present invention found that EPP at a dosage of 500 mg / kg can improve the survival rate of Chinese soft-shelled turtles infected with TSHSV and significantly reduce the viral load in the spleen and lungs, and alleviate the damage to tissues and organs such as the spleen, liver, kidneys and lungs. In addition, the antiviral related genes in the EPP treatment group rsad2 , usp18 The mRNA expression level was low.

[0008] The effective dose of Echinacea polysaccharide is: 500 mg of Echinacea polysaccharide is fed to 1 kg of Chinese soft-shelled turtle per day.

[0009] Echinacea polysaccharide was mixed into the feed of Chinese soft-shelled turtle and fed to it.

[0010] Echinacea polysaccharide was directly fed to Chinese soft-shelled turtle.

[0011] An anti-Chinese soft-shell turtle hemorrhagic syndrome virus drug containing Echinacea polysaccharide, including Echinacea polysaccharide as an effective ingredient.

[0012] Also included are pharmaceutically acceptable carriers.

[0013] The beneficial effects of the present invention are: EPP has a certain protective effect on turtles infected with TSHSV, EPP can effectively inhibit the proliferation of TSHSV, and provides a new means for preventing TSHSV. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 It is the anatomical diagram and mortality statistics of infected turtles after EPP treatment; Figure 1 (a), (b), (c) Anatomical diagram of infected turtles after EPP treatment. (d) Mortality statistics of turtles in the EPP group and the control group during virus infection. After the fourth day, the mortality rate of the EPP treatment group was lower than that of the control group.

[0015] Figure 2 The following are pathological sections of EPP-treated infected turtles. (a) Liver of EPP-treated group. (b) Red arrows represent blood cell infiltration; black arrows represent inflammatory cell infiltration; black circles represent nuclear condensation (c) Spleen of EPP-treated group. (d) Black circles represent lymph node atrophy and necrosis. (e) Kidney of EPP-treated group. (f) Black arrows represent nuclear condensation, nuclear fragmentation, and nuclear dissolution; red arrows represent renal tubules filled with blood cells, renal tubule atrophy, and changes in the size of the renal capsule. (g) Lung of EPP-treated group. (h) Red arrows represent blood cell infiltration; black arrows represent inflammatory cell infiltration.

[0016] Figure 3 The inhibitory effect of EPP on TSHSV. (a) Immunofluorescence detection of changes in viral proteins in various tissues of the EPP treatment group. EPP can inhibit the levels of viral proteins in the liver, spleen, lungs and heart. Red fluorescence represents viral proteins, and blue fluorescence represents cell nuclei. (b) Calculation of immune intensity in various tissues of turtles. (c) EPP significantly reduced the viral load in the spleen and lungs (* P <0.05,*** P <0.001).

[0017] Figure 4 It is the expression of immune-related genes under the action of EPP. (* P <0.05,** P <0.01). DETAILED DESCRIPTION

[0018] The technical solution of the present invention is further described in detail below through specific embodiments.

[0019] In the present invention, unless otherwise specified, the raw materials and equipment used can be purchased from the market or are commonly used in the art. The methods in the following embodiments, unless otherwise specified, are all conventional methods in the art.

[0020] Embodiment 1: Materials and Methods 1.1 Animal and virus sample preparation All healthy turtles used in the experiment came from a Chinese soft-shelled turtle breeding base in Hangzhou, Zhejiang Province, China, with an average size of 100 g-200 g, and were confirmed to be free of TSHSV. They were temporarily kept in a water tank at 28 °C before the experiment. The sick turtles used to prepare crude viruses came from a breeding farm in Zhejiang and were identified as TSHSV positive by RT-PCR. When preparing the virus, the lungs, spleen, kidneys and other tissues of TSHSV-positive turtles were collected and homogenized in phosphate-buffered solution (PBS) (tissue mass (g) / PBS volume (mL) was 1:5), centrifuged at 12,000 rpm for 30 min, and the supernatant was taken and filtered with a 0.22 μm filter. According to the previous method (LIU L, CAO Z, LIN F, et al .Partial sequence of a novel virus isolated from Pelodiscus sinensis hemorrhagic disease. Intervirology, 2015, 58: 197-204), the obtained crude virus was tested for viral load by qRT-PCR, and the RNA copy number was determined to be 1×10 7 After 400 copies / μL, they were stored at -80°C for further experiments.

[0021] 1.2 Experimental Grouping The turtles were randomly divided into a healthy control group (CK, neither infected with the virus nor treated with EPP), a TSHSV challenge group (only infected with the virus without EPP treatment), and an Echinacea polysaccharide group (treated with EPP before virus infection). There were 20 turtles in each group, 10 of which were used for subsequent related experimental tests, and 10 were used to observe the mortality rate and evaluate the drug safety of EPP based on the mortality rate.

[0022] 1.3EPP feeding method The drug (Echinacea polysaccharide, commercially available, Sichuan Shengren Biotechnology Co., Ltd.) was injected by gavage at a dose of 500 mg / kg. The drug was diluted to 20 mg / mL (25 mL) with 0.9% saline during gavage. Each rat was gavaged with 2.5 mL, and 10 rats were gavaged per group, for a total of 25 mL. The drug was injected once a day for 7 consecutive days. The CK group and the TSHSV group were given an equal amount of saline.

[0023] 1.4TSHSV infection After seven days of oral administration of EPP, 200 μL of crude virus solution was injected per 100 g of turtle. The CK group was injected with an equal volume of PBS.

[0024] 1.5 Collection of tissues When signs and symptoms of dyspnea and neck weakness appeared 3 days after infection, the turtles were dissected and tissues such as liver, spleen, lung, kidney and heart were collected. Each tissue was divided into 3 parts, of which the tissue used for quantitative detection was stored at -80 ℃, and the tissue used for histopathological analysis and immunofluorescence was immediately fixed with 4% paraformaldehyde.

[0025] 1.6 Protective effect of EPP on TSHSV-infected tissues The tissues fixed with 4% paraformaldehyde were embedded in paraffin and sliced ​​at 6 μm for HE staining. The histopathological characteristics of turtles gavaged with EPP and those not gavaged with EPP, especially the inflammatory response, were observed and compared.

[0026] 1.7 Inhibitory effect of EPP on TSHSV To understand the effect of EPP on viral replication, the relative expression of TSHSV in different tissues of different groups was detected by qRT-PCR. And the accumulation of TSHSV in tissues was analyzed by immunofluorescence. The fixed tissues were sliced ​​and embedded, and then the viral protein A661 polyclonal antibody was used as the primary antibody, and the FITC-labeled goat anti-rabbit antibody was used as the secondary antibody to detect the enrichment of the captured virus by immunofluorescence. The TSHSV-specific antibody A661 used in the experiment was preserved in this laboratory, and the secondary antibody was purchased from Jiangsu Affinity Biosciences Research Center Co., Ltd. (Affinity Biosciences, China). Images were collected using a Leica DMi8 fluorescence microscope (Leica, Germany), and the fluorescence intensity was measured using ImageJ software (version 1.8.0).

[0027] 1.8 qRT-PCR analysis of immune genes and TSHSV Total RNA from tissues was extracted using RNAisoPlus reagent (Takara, Japan) according to the kit instructions, and the concentration and purity of RNA were then determined by spectrophotometry. Approximately 1 μg of RNA was reverse transcribed into cDNA using PrimeScript™ RT MasterMix reagent (Perfect Real Time) (Takara, Japan) according to the kit instructions, and the synthesized cDNA was diluted 1:5 and used as a PCR template. qRT-PCR reactions were performed using TBGreen® PremixEx Taq™ (TliRNaseH Plus) reagent (Takara, Japan). Each 20 μL reaction system included 10 μL TBgreen, 0.5 μL specific primers, 4 μL water, and 5 μL cDNA. The reaction conditions were 95 °C for 30 s, followed by 40 cycles of 95 °C for 30 s, 60 °C for 30 s, and 70 °C for 15 s. The CT value was normalized to β-actin and 2 -ΔΔct The expression level of immune-related gene messenger RNA (mRNA) was determined by the method. All primers used in the experiment are listed in Table 1.

[0028] Table 1 Specific primers used in the experiment Primer name Primer sequence (5'-3') Q--F GAGACCTGACAGACTACCT (SEQ ID No.1) Q--R AGGATGATGAAGCAGCAGT (SEQ ID No. 2) Q--F GGAAGGAGGAAGATGGAGA (SEQ ID No.3) Q--R ACTGTGAAGTGGCGTGTTC (SEQ ID No. 4) Q--F CAGGAGGAGAGCCATTTTCTG (SEQ ID No.5) Q--R CGATGTGGCTTTTGTTTCCT (SEQ ID No. 6) Q--F GGCATGGTAACCACCGGATTTCAAG (SEQ ID No. 7) Q--R AGAACAAGAGCCGAGACCAGCGAAG (SEQ ID No. 8)

[0029] 1.9 Statistical analysis Data are presented as mean ± standard error (SE). One-way analysis of variance (ANOVA) was performed on all experimental data to determine the differences between groups. Data analysis was performed using IBM Statistics SPSS 20.0 and Excel. Asterisks indicate statistical significance as follows: *, P <0.05; **, P <0.01;***, P <0.001. Graphs were drawn using GraphPad Prism 8.0.

[0030] result Protective effect of EPP on infected soft-shelled turtles To understand the protective effect of EPP on turtles infected with TSHSV, we counted the mortality of turtles during the virus infection process and found that after the fourth day of infection, the mortality of infected turtles in the EPP treatment group was lower than that in the control group ( Figure 1 d). This indicates that EPP has a potential protective effect in reducing the mortality of infected turtles. When the turtles began to show signs and symptoms of dyspnea and neck weakness three days after infection with TSHSV, autopsy revealed enlarged and severely congested lung tissue, obvious intestinal bleeding and swelling, and no perforation. The intestinal congestion of the infected turtles that were gavaged with EPP was significantly improved compared to those that were not gavaged ( Figure 1 ac).

[0031] 2.2 Protective effect of EPP on infected soft-shelled turtle tissues Histological analysis revealed that tissue damage in the EPP-treated group was reduced compared with the TSHSV-infected group. TSHSV-infected livers were characterized by swollen cells and condensed nuclei. There was obvious blood congestion in the hepatic sinusoids. There was extensive inflammatory cell infiltration around the bile ducts ( Figure 2 b). In the spleen infected with TSHSV, the lymph nodes show severe atrophy, necrosis, and disintegration ( Figure 2 d). The atrophy of spleen lymph nodes in EPP-treated infected turtles was improved ( Figure 2 c). In the TSHSV-infected kidney tissue, compared with the EPP-treated infected turtles, the renal cells showed nuclear condensation and nuclear dissolution. The renal tubules atrophied, and the renal capsules were enlarged and expanded, resulting in enlarged interstitial spaces. Necrosis occurred in the areas of renal tissue bleeding ( Figure 2 e, f). Compared with the EPP-treated infected turtles, the lung tissues of TSHSV-infected turtles showed obvious structural disorder. The alveolar cells were characterized by nuclear lysis. Acute necrotizing bronchiolitis was accompanied by inflammatory cell infiltration and a large amount of fibrin in the alveolar cavity. The lung tissues showed obvious acute bleeding and red blood cell infiltration ( Figure 2 g, h).

[0032] 2.3 Inhibitory effect of EPP on TSHSV Immunofluorescence was used to detect the expression of viral proteins in various tissues, and it was found that EPP could inhibit the levels of viral proteins in the liver, spleen, lungs and heart on the third day of infection ( Figure 3 a, b). Viral load test results showed that EPP significantly reduced the viral load in the spleen and lungs ( Figure 3 c), which is statistically significant.

[0033] 2.4 Effect of EPP on the expression of antiviral-related genes The expression of antiviral related genes was detected. The results showed that on the third day of infection, EPP reduced the expression of RSAD2 The expression of mRNA, especially in the liver, was significantly different from that in the infected group ( P <0.05) ( Figure 4 a). At the same time, EPP also decreases USP18 The expression of mRNA in each infected tissue, among which the mRNA in liver tissue was significantly lower than that in the infected group ( P <0.05) ( Figure 4 b).

[0034] Discussion and Conclusion The results of the present invention show that EPP has a potential inhibitory effect on TSHSV. After being treated with 500 mg / kg of EPP, the survival rate of infected turtles reached 100%, indicating that it has high safety at a dosage of 500 mg / kg. This study found that EPP has a certain protective effect on multiple tissues and organs, especially the best protective effect on the lungs and heart.

[0035] The expression level of immune-related genes can reflect the health status and immune response of the body to a certain extent. Quantitative detection found that after the turtle was infected with TSHSV, the expression level of immune-related genes rsad2 , usp18 After three days of EPP treatment, TSHSV and rsad2 The overall level showed a downward trend, suggesting that Echinacea polysaccharides play a key role in the antiviral activity. Ubiquitin-specific protease 18 (USP18) is ifn It is an important negative regulator in the antiviral process and plays an important role in the interferon antiviral signal transduction pathway. In this study, after three days of EPP treatment, TSHSV and usp18 The mRNA expression level showed a downward trend, which may be related to usp18 Negative regulation ifn - 1 Participation in antiviral immune response is related to. At the same time, the survival rate of infected turtles treated with EPP reached 100% after seven days, suggesting that EPP has the effect of enhancing resistance and antiviral activity.

[0036] In conclusion, EPP has a strong anti-TSHSSV effect on Chinese soft-shelled turtle. EPP can also regulate the mRNA levels of two antiviral genes.

[0037] The above-described embodiment is only a preferred solution of the present invention and does not limit the present invention in any form. There are other variations and modifications without exceeding the technical solution described in the claims.

Claims

1. Application of Echinacea polysaccharide in the preparation of drugs against Chinese soft-shelled turtle hemorrhagic syndrome virus.

2. The use according to claim 1, characterized in that: The effective dose of Echinacea polysaccharide is: 500 mg of Echinacea polysaccharide is fed to 1 kg of Chinese soft-shelled turtle per day.

3. The use according to claim 2, characterized in that: Echinacea polysaccharide was mixed into the feed of Chinese soft-shelled turtle and fed to it.

4. The use according to claim 2, characterized in that: Echinacea polysaccharide was directly fed to Chinese soft-shelled turtle.

5. An anti-Chinese soft-shell turtle hemorrhagic syndrome virus drug containing Echinacea polysaccharide, characterized in that: Includes the active ingredient Echinacea polysaccharide.

6. The anti-Chinese soft-shell turtle hemorrhagic syndrome virus drug containing Echinacea polysaccharide according to claim 5, characterized in that: Also included are pharmaceutically acceptable carriers.

Images