Beta-hydroxyl dithiophosphate compound as well as preparation method and application thereof

Abstract

The invention provides a beta-hydroxyl dithiophosphate compound as well as a preparation method and application thereof, and belongs to the technical field of medicinal chemistry. The invention provides a specific chemical structure of the beta-hydroxyl dithiophosphate compound. The compound provided by the invention can be combined with a sugar transporter by utilizing the structure and groups of the compound, so that the activity of the sugar transporter is inhibited, the antibacterial performance of the compound is effectively improved, and the compound can act on various germs; the compound disclosed by the invention has good antibacterial performance on magnaporthe oryzae, rhizoctonia solani, corn ear rot pathogen, exserohilum turcicum, tobacco wildfire pathogen, tobacco angular leaf spot pathogen, xanthomonas oryzae pv. Oryzae and Chinese cabbage soft rot pathogen, has broad-spectrum antibacterial activity and also has a growth promoting effect on rice plants.

Description

Technical Field

[0001] The present invention relates to the technical field of pharmaceutical chemistry, and in particular to a beta-hydroxy dithiophosphate compound and a preparation method and application thereof. Background Art

[0002] Organophosphorus pesticides have the advantages of high efficacy, fast decomposition and low cost. They are one of the three mainstays of current pesticides and are widely used as fungicides, agricultural insecticides, etc. Phosphorodithioates are the most commonly used type of organophosphorus pesticides, which can effectively inhibit plant pathogens. For example, the prior art uses asymmetric S-alkyl (allyl) O-substituted phenyl phosphorodithioates, a phosphorodithioate derivative, to prepare plant pathogen inhibitors. However, when the compound is used to inhibit eight pathogens such as rice blast, it only shows excellent inhibitory performance against rice blast, and has only low inhibitory activity against the remaining seven plant pathogens. The broad spectrum of its antibacterial performance cannot meet the needs of practical applications. Summary of the invention

[0003] The object of the present invention is to provide a β-hydroxy dithiophosphate compound and a preparation method and application thereof. The β-hydroxy dithiophosphate compound provided by the present invention has a good inhibitory effect on a variety of plant pathogens and has excellent broad-spectrum antibacterial properties.

[0004] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0005] The present invention provides a β-hydroxy dithiophosphate compound having a chemical structure as shown in Formula I or Formula II:

[0006]

[0007] In the formula I, R 1 p-CH 3 , p-Cl, pF, p-Br, pt-Bu, p-Ph, p-NO 2 One of them.

[0008] Preferably, in the formula I, R 1 It is p-Cl or p-Br.

[0009] The present invention also provides a method for preparing the β-hydroxy dithiophosphate compound described in the above technical solution, comprising:

[0010] Aromatic hydrocarbons, dialkyl dithiophosphate ethyl ester and ethanol solution are subjected to addition reaction to obtain β-hydroxy dithiophosphate compounds; the aromatic hydrocarbons are 4-methylstyrene, 4-chlorostyrene, 4-fluorostyrene, 4-bromostyrene, 4-tert-butylstyrene, 4-vinylbiphenyl, 4-nitrostyrene or indene.

[0011] Preferably, the volume ratio of the amount of the aromatic hydrocarbon, the amount of the disulfide dialkyl phosphate ethyl ester and the ethanol solution is (1-2) mmol: (1.5-2) mmol: (2-3) mL; the molar concentration of the ethanol solution is 0.5-1 mol / L.

[0012] Preferably, the temperature of the addition reaction is 0 to 50° C., and the time of the addition reaction is 4 to 12 hours.

[0013] Preferably, the addition reaction is carried out under stirring conditions, and the stirring rate is 500-1200 rpm / min.

[0014] Preferably, after the addition reaction is completed, post-treatment is performed; the post-treatment includes extraction, drying, concentration and column chromatography purification performed in sequence.

[0015] Preferably, the stationary phase of the column chromatography purification is column chromatography silica gel; the particle size of the column chromatography silica gel is 200-300 mesh; the eluent of the column chromatography purification is ethyl acetate-petroleum ether; the volume ratio of ethyl acetate to petroleum ether in the eluent is 1:(8-100).

[0016] The present invention also provides the use of the β-hydroxy dithiophosphate compounds described in the above technical solution in plant disease resistance and antibacterial and rice plant growth promotion.

[0017] The present invention also provides a pesticide preparation, comprising the β-hydroxy dithiophosphate compound described in the above technical solution.

[0018] The present invention provides a β-hydroxy dithiophosphate compound, and provides a structural formula of the β-hydroxy dithiophosphate compound. The dithiophosphate group in the β-hydroxy dithiophosphate compound provided by the present invention has antibacterial properties, which can effectively improve the antibacterial properties of the β-hydroxy dithiophosphate compound; at the same time, the hydroxyl group in the compound can form a hydrogen bond with the sugar transport protein of the pathogen, inhibit the activity of the sugar transport protein, reduce the absorption of the pathogen to the necessary nutrient sugar, and improve the antibacterial properties of the compound; there is an electrostatic interaction between the dithiophosphate group and the sugar transport protein, which further promotes the combination of the compound with the sugar transport protein, improves the inhibitory effect on the activity of the sugar transport protein, and further improves the antibacterial properties of the compound; and the compound effectively inhibits a variety of pathogens by cutting off the path of pathogens robbing the host plant nutrient sugar, thereby improving the broad-spectrum antibacterial properties of the compound. The results of the examples show that the β-hydroxy dithiophosphate compounds provided by the present invention have good antibacterial properties against rice blast, rice sheath blight, corn ear rot, corn leaf blight, tobacco wildfire, tobacco angular spot, rice bacterial leaf blight and Chinese cabbage soft rot, and have broad-spectrum antibacterial properties; at the same time, they have a growth-promoting effect on rice plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 is the H NMR spectrum of (4-chlorophenyl)-β-hydroxyethyl dithiophosphate in Example 1;

[0020] Figure 2 is the H NMR spectrum of ethyl (4-bromophenyl)-β-hydroxy dithiophosphate in Example 2;

[0021] Figure 3 is the H NMR spectrum of ethyl S-(1-hydroxy-2,3-dihydro-1H-inden-2-yl) dithiophosphate in Example 3;

[0022] Figure 4 is the H NMR spectrum of ethyl (4-methylphenyl)-β-hydroxy dithiophosphate in Example 4;

[0023] Figure 5 is the H NMR spectrum of ethyl (4-fluorophenyl)-β-hydroxy dithiophosphate in Example 5;

[0024] Figure 6 is the H NMR spectrum of (4-tert-butylphenyl)-β-hydroxyethyl dithiophosphate in Example 6;

[0025] Figure 7 is the H NMR spectrum of ((4-phenyl)phenyl)-β-hydroxyethyl dithiophosphate in Example 7;

[0026] Figure 8is the H NMR spectrum of ethyl (4-nitrophenyl)-β-hydroxy dithiophosphate in Example 8;

[0027] Fig. 9 The growth status of yeast transformation products in culture medium containing 350 μL and 700 μL of the compounds of Examples 1 to 3, respectively;

[0028] Fig.10 The growth status of yeast transformation products in culture medium containing 50 μL and 70 μL of the compounds of Examples 1 to 3, respectively;

[0029] Fig.11 The growth status graphs and colony diameter bar graphs of rice sheath blight, rice blast and corn ear rot pathogens in culture media containing the compounds of Examples 1 to 3, respectively, as well as the growth status graphs and colony diameter bar graphs of corn leaf blight pathogens in culture media containing the compounds of Examples 1 to 2, respectively, and the growth status graphs and colony diameter bar graphs of peanut white rot pathogens in culture media containing the compound of Example 3;

[0030] Fig.12 It is a bar graph of the growth rate of tobacco wildfire pathogen, tobacco angular leaf spot pathogen, rice bacterial leaf blight pathogen and Chinese cabbage soft rot pathogen in culture media containing the compounds of Examples 1 to 3 respectively;

[0031] Fig.13 The graphs show the growth promotion of rice plants by the compounds of Examples 1 to 3 and the bar graphs show the root length and plant height. DETAILED DESCRIPTION

[0032] The present invention provides a β-hydroxy dithiophosphate compound having a chemical structure as shown in Formula I or Formula II:

[0033]

[0034] In the formula I, R 1 p-CH 3 , p-Cl, pF, p-Br, pt-Bu, p-Ph, p-NO 2 One of them.

[0035] In the present invention, the R 1 p-CH 3 , p-Cl, pF, p-Br, pt-Bu, p-Ph or p-NO 2 ; preferably p-Cl or p-Br, more preferably p-Cl. In the present invention, by limiting the types of groups in the structural formula, the antibacterial properties of the compound are further improved.

[0036] The β-hydroxy dithiophosphate compounds provided by the present invention can effectively inhibit the activity of sugar transport proteins, reduce the absorption of sugar by pathogens, and improve the antibacterial performance of the compounds; at the same time, the compounds can inhibit multiple pathogens at the same time by acting on sugar transport proteins to avoid direct effects on pathogens, thereby improving the broad-spectrum antibacterial performance of the compounds.

[0037] The present invention also provides a method for preparing the β-hydroxy dithiophosphate compound described in the above technical scheme, comprising the following steps:

[0038] Aromatic hydrocarbon, dialkyl dithiophosphate ethyl ester and ethanol solution are subjected to addition reaction to obtain β-hydroxy dithiophosphate compounds.

[0039] In the present invention, the aromatic hydrocarbon is 4-methylstyrene, 4-chlorostyrene, 4-fluorostyrene, 4-bromostyrene, 4-tert-butylstyrene, 4-vinylbiphenyl, 4-nitrostyrene or indene. In the present invention, the antibacterial properties of the compound are ensured by limiting the specific types of aromatic hydrocarbons.

[0040] As an embodiment of the present invention, the molar concentration of the ethanol solution can be 0.5-1 mol / L, or 0.5 mol / L. In the present invention, by limiting the concentration of the ethanol solution, the addition reaction is ensured to proceed smoothly, and the antibacterial performance of the chemical is further improved.

[0041] As an embodiment of the present invention, the volume ratio of the amount of the aromatic hydrocarbon, the amount of the disulfide dialkyl phosphate ethyl ester and the ethanol solution can be (1-2) mmol: (1.5-2) mmol: (2-3) mL, or (1-1.5) mmol: (1.5-1.8) mmol: (2-2.5) mL. In an embodiment of the present invention, the volume ratio of the amount of the aromatic hydrocarbon, the amount of the disulfide dialkyl phosphate ethyl ester and the ethanol solution can be specifically 1 mmol: 1.5 mmol: 2 mL. In the present invention, by limiting the amount ratio of the reaction raw materials, the sufficient reaction between the raw materials can be guaranteed, and the antibacterial performance of the compound can be further improved.

[0042] As an embodiment of the present invention, the temperature of the addition reaction can be 0 to 50°C, or 20 to 30°C. In an embodiment of the present invention, the temperature of the addition reaction can be specifically 0, 10, 15, 20, 25, 30, 40, 45 or 50°C. The time of the addition reaction can be 4 to 12 hours, or 8 to 10 hours. In an embodiment of the present invention, the time of the addition reaction can be specifically 4, 6, 7, 8, 9, 10, 11 or 12 hours. In the present invention, by limiting the process parameters of the addition reaction, the forward reaction is further promoted, the compound generation is promoted, and the antibacterial performance of the compound is further improved.

[0043] As an embodiment of the present invention, the addition reaction can be carried out under stirring; the stirring rate can be 500-1200 rpm / min, or 700-900 rpm / min. In the present invention, by limiting the stirring rate, sufficient contact reaction between the raw materials is ensured, the occurrence of side reactions is reduced, and the antibacterial performance of the compound is further improved.

[0044] As an embodiment of the present invention, the addition reaction can be terminated by saturated saline; the volume ratio of the amount of the aromatic hydrocarbon to the saturated saline can be 1mmol:(10-20)mL, or 1mmol:(15-18)mL. In the present invention, by limiting the amount of saturated saline, the addition reaction can be completely terminated, avoiding overreaction, and further ensuring the performance of the compound.

[0045] As an embodiment of the present invention, after the addition reaction is completed, post-treatment may be performed; the post-treatment may include extraction, drying, concentration and column chromatography purification performed in sequence.

[0046] As an embodiment of the present invention, the extraction solvent may be ethyl acetate; the volume ratio of the extraction solvent to the amount of aromatic hydrocarbon may be (5-10) mL:1 mmol, or (6-8) mL:1 mmol; the number of extractions may be 3-4 times, or 3 times. In the present invention, by limiting the process parameters of the extraction process, the separation of the product can be ensured, the purification of the product can be achieved, the influence of impurities on the performance of the compound can be avoided, and its antibacterial performance can be further improved.

[0047] The present invention has no special limitation on the drying operation, as long as the organic phase obtained by the extraction can be dried. In an embodiment of the present invention, the drying can be carried out using anhydrous sodium sulfate.

[0048] The present invention has no particular limitation on the concentration operation, as long as the solvent can be completely removed. In an embodiment of the present invention, the concentration may be reduced pressure concentration.

[0049] As an embodiment of the present invention, the stationary phase of the column chromatography purification can be column chromatography silica gel; the particle size of the column chromatography silica gel can be 200-300 mesh, or 250-280 mesh; the eluent of the column chromatography purification can be ethyl acetate-petroleum ether; the volume ratio of ethyl acetate to petroleum ether in the eluent can be 1:(8-100), or 1:(20-50). In the present invention, by limiting the process parameters of column chromatography, the impurity removal of the compound is further achieved, the influence of impurities on the performance of the compound is avoided, and the antibacterial performance is further improved.

[0050] The present invention controls the process parameters of raw material preparation and post-treatment processes to ensure sufficient contact reaction between raw materials, promote the forward progress of raw materials, reduce the occurrence of side reactions, and simultaneously cooperate with post-treatment to remove by-products and impurities, avoid the influence of by-products and impurities on the performance of compounds, and effectively improve the antibacterial performance and broad-spectrum antibacterial property of β-hydroxy dithiophosphate compounds.

[0051] The present invention also provides the use of the β-hydroxy dithiophosphate compounds described in the above technical solution in plant disease resistance and antibacterial and rice plant growth promotion.

[0052] As an embodiment of the present invention, the β-hydroxy dithiophosphate compound can be used to inhibit rice blast, rice sheath blight, corn ear rot, corn leaf blight, tobacco fire blast, tobacco angular leaf spot, rice bacterial leaf blight and Chinese cabbage soft rot.

[0053] As an embodiment of the present invention, the β-hydroxy dithiophosphate compound can promote the growth of rice plants.

[0054] The present invention has no particular limitation on the specific application of the β-hydroxy dithiophosphate compound, and any application method of antibacterial compounds well known to those skilled in the art may be used.

[0055] The present invention also provides a pesticide preparation, comprising the β-hydroxy dithiophosphate compound described in the above technical solution.

[0056] As an embodiment of the present invention, the pesticide preparation can be an injection, tablet, capsule, aerosol, suppository, film, pill, ointment, controlled release agent, sustained release agent or nano preparation.

[0057] The present invention has no particular limitation on the types of auxiliary materials in the pesticide preparation and the preparation method of the pesticide preparation. The preparation method of the pesticide preparation containing antibacterial compounds well known to those skilled in the art can be used.

[0058] The technical solutions in the present invention will be described clearly and completely below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0059] Example 1

[0060] A (4-chlorophenyl)-β-hydroxy dithiophosphate ethyl ester-ZQ230712B3, having the chemical structure shown below:

[0061]

[0062] The preparation method of the (4-chlorophenyl)-β-hydroxy dithiophosphate ethyl ester is:

[0063] In a 10mL round-bottom flask equipped with a magnetic stirrer, 1.0mmol 4-chlorostyrene, 1.5mmol ethyl disulfide dialkyl phosphate and 2mL, 0.5mol / L ethanol solution were added in sequence, wherein the amount of 4-chlorostyrene, the amount of ethyl disulfide dialkyl phosphate and the volume ratio of the ethanol solution were 1.0mmol:1.5mmol:2mL; the addition reaction was carried out at a stirring rate of 750rpm / min and 5°C for 8h, and then 15mL saturated brine was added to terminate the reaction, and 8mL ethyl acetate was used for extraction three times. The organic phases were combined and then washed with anhydrous Na 2 SO 4 The product was dried, filtered to remove the desiccant, concentrated under reduced pressure to remove the organic solvent, and then purified by column chromatography to separate (4-chlorophenyl)-β-hydroxydithiophosphate ethyl ester; wherein the phase for column chromatography purification was column chromatography silica gel with a particle size of 250-280 mesh, and the eluent was ethyl acetate-petroleum ether with a volume ratio of 1:30.

[0064] The nuclear magnetic resonance spectra of (4-chlorophenyl)-β-hydroxy dithiophosphate ethyl ester were characterized. Figure 1 As shown. Figure 1 It can be seen that the hydrogen element absorption signal corresponding to the compound proves that Example 1 indeed obtains the compound with the shown chemical structure.

[0065] Example 2

[0066] A (4-bromophenyl)-β-hydroxy dithiophosphate ethyl ester-ZQ230626CD4, having the chemical structure shown below:

[0067]

[0068] The preparation method of the (4-bromophenyl)-β-hydroxy dithiophosphate ethyl ester is:

[0069] In a 10mL round-bottom flask equipped with a magnetic stirrer, 1.0mmol 4-bromostyrene, 1.5mmol ethyl disulfide dialkyl phosphate and 2mL, 0.5mol / L ethanol solution were added in sequence, wherein the amount of 4-bromostyrene, the amount of ethyl disulfide dialkyl phosphate and the volume ratio of the ethanol solution were 1.0mmol:1.5mmol:2mL; the addition reaction was carried out at a stirring rate of 750rpm / min and 0°C for 8h, and then 10mL saturated brine was added to terminate the reaction, and 8mL ethyl acetate was used for extraction three times. The organic phases were combined and then washed with anhydrous Na 2 SO 4The product was dried, filtered to remove the desiccant, concentrated under reduced pressure to remove the organic solvent, and then purified by column chromatography to separate (4-bromophenyl)-β-hydroxydithiophosphate ethyl ester; wherein the phase for column chromatography purification was column chromatography silica gel with a particle size of 250-280 mesh, and the eluent was ethyl acetate-petroleum ether with a volume ratio of 1:50.

[0070] The nuclear magnetic resonance (NMR) spectra of (4-bromophenyl)-β-hydroxy dithiophosphate ethyl ester were characterized. Figure 2 As shown. Figure 2 It can be seen that the hydrogen element absorption signal corresponding to the compound proves that Example 2 indeed obtains the compound with the shown chemical structure.

[0071] Example 3

[0072] An S-(1-hydroxy-2,3-dihydro-1H-inden-2-yl) dithiophosphate ethyl ester-ZQ230626F3 has the chemical structure shown below:

[0073]

[0074] The preparation method of the S-(1-hydroxy-2,3-dihydro-1H-inden-2-yl) dithiophosphate ethyl ester is as follows:

[0075] In a 10 mL round-bottom flask equipped with a magnetic stirrer, 1.0 mmol indene, 1.5 mmol ethyl dithiodialkyl phosphate and 2 mL, 0.5 mol / L ethanol solution were added in sequence, wherein the amount of indene, the amount of ethyl dithiodialkyl phosphate and the volume ratio of the ethanol solution were 1.0 mmol:1.5 mmol:2 mL; the addition reaction was carried out at a stirring rate of 750 rpm / min and 5 ° C for 10 h, and then 15 mL of saturated brine was added to terminate the reaction, and 10 mL of ethyl acetate was used for extraction three times. The organic phases were combined and then washed with anhydrous Na 2 SO 4 The product was dried, filtered to remove the desiccant, concentrated under reduced pressure to remove the organic solvent, and then purified by column chromatography to separate S-(1-hydroxy-2,3-dihydro-1H-inden-2-yl) dithiophosphate ethyl ester; wherein the phase for column chromatography purification was column chromatography silica gel with a particle size of 250 to 280 mesh, and the eluent was ethyl acetate-petroleum ether with a volume ratio of 1:35.

[0076] The nuclear magnetic resonance spectra of S-(1-hydroxy-2,3-dihydro-1H-inden-2-yl) dithiophosphate ethyl ester were characterized. Figure 3 As shown. Figure 3 It can be seen that the hydrogen element absorption signal corresponding to the compound proves that Example 3 indeed obtains the compound with the shown chemical structure.

[0077] Example 4

[0078] A (4-methylphenyl)-β-hydroxy dithiophosphate ethyl ester having the chemical structure shown below:

[0079]

[0080] The preparation method of the (4-methylphenyl)-β-hydroxy dithiophosphate ethyl ester is:

[0081] In a 10mL round-bottom flask equipped with a magnetic stirrer, 1.0mmol 4-methylstyrene, 1.5mmol ethyl disulfide dialkyl phosphate and 2mL, 0.5mol / L ethanol solution were added in sequence, wherein the amount of 4-methylstyrene, the amount of ethyl disulfide dialkyl phosphate and the volume ratio of the ethanol solution were 1.0mmol:1.5mmol:2mL; the addition reaction was carried out at a stirring rate of 750rpm / min and 4°C for 10h, and then 12mL saturated brine was added to terminate the reaction, and 8mL ethyl acetate was used for extraction three times. The organic phases were combined and then washed with anhydrous Na 2 SO 4 The product was dried, filtered to remove the desiccant, concentrated under reduced pressure to remove the organic solvent, and then purified by column chromatography to separate (4-methylphenyl)-β-hydroxydithiophosphate ethyl ester; wherein the phase for column chromatography purification was column chromatography silica gel with a particle size of 250 to 280 mesh, and the eluent was ethyl acetate-petroleum ether with a volume ratio of 1:80.

[0082] The nuclear magnetic resonance (NMR) spectra of (4-methylphenyl)-β-hydroxy dithiophosphate ethyl ester were characterized. Figure 4 As shown. Figure 4 It can be seen that the hydrogen element absorption signal corresponding to the compound proves that Example 4 indeed obtains the compound with the shown chemical structure.

[0083] Example 5

[0084] A (4-fluorophenyl)-β-hydroxy dithiophosphate ethyl ester having the chemical structure shown below:

[0085]

[0086] The preparation method of the (4-fluorophenyl)-β-hydroxy dithiophosphate ethyl ester is:

[0087] In a 10mL round-bottom flask equipped with a magnetic stirrer, 1.0mmol 4-fluorostyrene, 1.5mmol ethyl disulfide dialkyl phosphate and 2mL, 0.5mol / L ethanol solution were added in sequence, wherein the amount of 4-fluorostyrene, the amount of ethyl disulfide dialkyl phosphate and the volume ratio of the ethanol solution were 1.0mmol:1.5mmol:2mL; the addition reaction was carried out at a stirring rate of 750rpm / min and 0°C for 8h, and then 10mL saturated brine was added to terminate the reaction, and 8mL ethyl acetate was used for extraction three times. The organic phases were combined and then washed with anhydrous Na 2 SO 4 The product was dried, filtered to remove the desiccant, concentrated under reduced pressure to remove the organic solvent, and then purified by column chromatography to separate (4-fluorophenyl)-β-hydroxydithiophosphate ethyl ester; wherein the phase for column chromatography purification was column chromatography silica gel with a particle size of 250-280 mesh, and the eluent was ethyl acetate-petroleum ether with a volume ratio of 1:60.

[0088] The nuclear magnetic resonance spectra of (4-fluorophenyl)-β-hydroxy dithiophosphate ethyl ester were characterized. Figure 5 As shown. Figure 5 It can be seen that the hydrogen element absorption signal corresponding to the compound proves that Example 5 indeed obtains the compound with the shown chemical structure.

[0089] Example 6

[0090] A (4-tert-butylphenyl)-β-hydroxy dithiophosphate ethyl ester having the chemical structure shown below:

[0091]

[0092] The preparation method of the (4-tert-butylphenyl)-β-hydroxy dithiophosphate ethyl ester is:

[0093] In a 10mL round-bottom flask equipped with a magnetic stirrer, 1.0mmol 4-tert-butylstyrene, 1.5mmol ethyl disulfide dialkyl phosphate and 2mL, 0.5mol / L ethanol solution were added in sequence, wherein the amount of 4-tert-butylstyrene, the amount of ethyl disulfide dialkyl phosphate and the volume ratio of the ethanol solution were 1.0mmol:1.5mmol:2mL; the addition reaction was carried out at a stirring rate of 750rpm / min and 4°C for 6h, and then 12mL saturated brine was added to terminate the reaction, and 8mL ethyl acetate was used for extraction three times. The organic phases were combined and then washed with anhydrous Na 2 SO 4The product was dried, filtered to remove the desiccant, concentrated under reduced pressure to remove the organic solvent, and then purified by column chromatography to separate (4-tert-butylphenyl)-β-hydroxydithiophosphate ethyl ester; wherein the phase for column chromatography purification was column chromatography silica gel with a particle size of 250 to 280 mesh, and the eluent was ethyl acetate-petroleum ether with a volume ratio of 1:30.

[0094] The nuclear magnetic resonance spectra of (4-tert-butylphenyl)-β-hydroxy dithiophosphate ethyl ester were characterized. Figure 6 As shown. Figure 6 It can be seen that the hydrogen element absorption signal corresponding to the compound proves that Example 6 indeed obtains the compound with the shown chemical structure.

[0095] Example 7

[0096] A ((4-phenyl)phenyl)-β-hydroxy dithiophosphate ethyl ester having the chemical structure shown below:

[0097]

[0098] The preparation method of the (4-tert-butylphenyl)-β-hydroxy dithiophosphate ethyl ester is:

[0099] In a 10mL round-bottom flask equipped with a magnetic stirrer, 1.0mmol 4-phenylstyrene, 1.5mmol ethyl disulfide dialkyl phosphate and 2mL, 0.5mol / L ethanol solution were added in sequence, wherein the amount of 4-phenylstyrene, the amount of ethyl disulfide dialkyl phosphate and the volume ratio of the ethanol solution were 1.0mmol:1.5mmol:2mL; the addition reaction was carried out at a stirring rate of 750rpm / min and 0°C for 8h, and then 10mL saturated brine was added to terminate the reaction, and 8mL ethyl acetate was used for extraction three times. The organic phases were combined and then washed with anhydrous Na 2 SO 4 The product was dried, filtered to remove the desiccant, concentrated under reduced pressure to remove the organic solvent, and then purified by column chromatography to separate ((4-phenyl)phenyl)-β-hydroxydithiophosphate ethyl ester; wherein the phase for column chromatography purification was column chromatography silica gel with a particle size of 250 to 280 mesh, and the eluent was ethyl acetate-petroleum ether with a volume ratio of 1:50.

[0100] The nuclear magnetic resonance (NMR) spectrum of ((4-phenyl)phenyl)-β-hydroxydithiophosphate ethyl ester was obtained. Figure 7 As shown. Figure 7 It can be seen that the hydrogen element absorption signal corresponding to the compound proves that Example 7 indeed obtains the compound with the shown chemical structure.

[0101] Example 8

[0102] A (4-nitrophenyl)-β-hydroxy dithiophosphate ethyl ester having the chemical structure shown below:

[0103]

[0104] The preparation method of the (4-nitrophenyl)-β-hydroxy dithiophosphate ethyl ester is:

[0105] In a 10mL round-bottom flask equipped with a magnetic stirrer, 1.0mmol 4-nitrostyrene, 1.5mmol ethyl disulfide dialkyl phosphate and 2mL, 0.5mol / L ethanol solution were added in sequence, wherein the amount of 4-nitrostyrene, the amount of ethyl disulfide dialkyl phosphate and the volume ratio of the ethanol solution were 1.0mmol:1.5mmol:2mL; the addition reaction was carried out at a stirring rate of 750rpm / min and 0℃ for 8h, and then 10mL saturated brine was added to terminate the reaction, and 8mL ethyl acetate was used for extraction three times. The organic phases were combined and then washed with anhydrous Na 2 SO 4 The product was dried, filtered to remove the desiccant, concentrated under reduced pressure to remove the organic solvent, and then purified by column chromatography to separate (4-nitrophenyl)-β-hydroxydithiophosphate ethyl ester; wherein the phase for column chromatography purification was column chromatography silica gel with a particle size of 250-280 mesh, and the eluent was ethyl acetate-petroleum ether with a volume ratio of 1:50.

[0106] The nuclear magnetic resonance (NMR) spectra of (4-nitrophenyl)-β-hydroxy dithiophosphate ethyl ester were characterized. Figure 8 As shown. Figure 8 It can be seen that the hydrogen element absorption signal corresponding to the compound proves that Example 8 indeed obtains the compound with the shown chemical structure.

[0107] Test Example 1

[0108] The compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 were tested for biological activity, and the specific steps were as follows:

[0109] (1) Construction of a carrier for sugar transporter

[0110] The cDNA of wild-type rice ZH11 inoculated with rice blast fungus race Guy11 for 48 h was used as a template to amplify the nucleotide sequence of rice OsSWEET4 (LOC_Os02g19820, https: / / phytozome.jgi.doe.gov / pz / portal.html) by conventional polymerase chain reaction (PCR);

[0111] The PCR reaction system is:

[0112] cDNA of rice ZH11 inoculated with rice blast fungus race Guy11 for 48h 1μL

[0113] Forward primer: GGGGACAAGTTTGTACAAAAAAGCAGGCTTCCTCGAGATG GTCTCGCCGGACACC (SEQ ID NO. 1) 1 μL

[0114] Reverse primer: GGGGACCACTTTGTACAAGAAAGCTGGGGTGGGGCCCGTAG CGGCCGTTGGCGGC (SEQID NO.2) 1μL

[0115] 2×PCR mix 25μL

[0116] Double distilled water 22 μL;

[0117] The PCR amplification procedure is: pre-denaturation at 95°C for 3 minutes, denaturation at 95°C for 15 seconds, annealing at 59°C for 15 seconds, and extension at 72°C for 1.5 minutes. The denaturation, annealing, and extension process are cycled 33 times, and the final extension is at 72°C for 10 minutes. After the PCR amplification is completed, the fragment is cut and recovered by agarose gel electrophoresis. The size of the PCR amplified fragment is 777 bp.

[0118] The recovered fragments were homologously recombined with the pDONR221 vector (Kanamycin) by the Gateway method to obtain the pDONR221-OsSWEET4 connection product, and the positive clones were selected and sequenced for verification. The positive clones that passed the verification were homologously recombined with the pDRf-eGFP-GW vector by the Gateway method again to obtain the connection product pDRf-OsSWEET4, and the positive clones were selected and sequenced for verification to obtain the correct yeast expression vector;

[0119] The same method was used to amplify the wheat TaSWEET2a (TRITD_6Bv1G065430, https: / / www.ensembl.org / index.html?redirect=no) nucleotide sequence, the maize ZmSWEET4a (Zm00001d015905, https: / / db.cngb.org / zeamap / ) nucleotide sequence and the Arabidopsis AtSWEET1 (At1g21460, https: / / www.arabidopsis.org / ) nucleotide sequence, and the amplified wheat TaSWEET2a nucleotide sequence and the amplified maize ZmSWEET4a nucleotide sequence were constructed into the pDRf vector by the same method to obtain pDRf-TaSWEET2a and pDRf-ZmSWEET4a; the amplified Arabidopsis AtSWEET1 nucleotide sequence was constructed into the pDR196 vector by the same method to obtain pDR196-AtSWEET1;

[0120] (2) Transform the recombinant vector into the EBY4000 yeast strain

[0121] A. Preparation of reagents

[0122] Polyethylene glycol 4000 (PEG4000) reagent: add 10g PEG4000 to an appropriate amount of ddHO 2 O and make up to 20 mL, sterilize;

[0123] Lithium acetate (LiAc) reagent: Add 3.2995 g LiAc powder to an appropriate amount of ddHO 2 O and make up to 50 mL, sterilize;

[0124] 10×TE buffer: Add 100 mL 1 mol / L Tris-HCl and 20 mL 500 mmol / L ethylenediaminetetraacetic acid (EDTA) to 800 mL ddHO. 2 O and make up to 1 L, pH 6.5-7.5, and sterilize.

[0125] B. Yeast strain activation

[0126] Streak the frozen strain EBY4000 at -80°C on a YPM plate, and culture at a temperature range of 28-30°C until colonies are produced; pick a single colony and culture it in 2mL of YPM liquid containing 2g / 100mL of maltose for 24h to obtain a bacterial liquid; wherein the strain EBY4000 is the strain EBY4000 in the prior art "Concurrent knock-out of at least 20 transporter genesis required to block uptake of hexoses in Saccharomyces cerevisiae; Wieczorke R, et al.";

[0127] C. Yeast transformation

[0128] Add the bacterial solution obtained in step B to a 2 mL centrifuge tube in a clean bench, centrifuge at 10,000 rpm for 1 min, and discard the upper culture solution;

[0129] The precipitated bacteria were centrifuged and placed in 1 mL of ddHO 2 O, and then centrifuge at 10000rpm for 1min; after centrifugation, repeat the resuspension and centrifugation process once, and then use 300μL ddHO. 2 O resuspended bacteria as yeast;

[0130] The yeast transformation system consists of:

[0131] PEG4000 reagent 70 μL, LiAc reagent 8 μL, 10×TE buffer 8 μL, yeast obtained in step C 10 μL, salmon sperm DNA 2 μL, and plasmid DNA 5 μL;

[0132] The plasmid DNAs are pDRf-OsSWEET4, pDRf-TaSWEET2a, pDRf-ZmSWEET4a, pDR196-AtSWEET1 and pDRf-eGFP-GW to form yeast transformation systems a to e;

[0133] The reaction procedure for yeast transformation is:

[0134] The yeast transformation system was kept at 28°C for 30 min, then heated to 42°C for 13 min, then cooled to 28°C for 2 min, and then centrifuged for 1 min in a handheld centrifuge. The supernatant was discarded and the precipitated cells were placed in 50 μL ddH 2 O to obtain a bacterial solution, which was spread on a defective SD / -Ura medium containing maltose and cultured at 28°C until positive yeast colonies A to E grew on the medium plate;

[0135] The effects of the compounds obtained in Examples 1 to 3 on the activity of sugar transporters were detected, and the specific detection method is as follows:

[0136] Preparation of culture medium:

[0137] Mix 1g yeast extract powder, 2g agar powder and 2g peptone powder and add to an appropriate amount of ddHO. 2 O and dilute to 90 mL, sterilize to obtain YP medium;

[0138] Add 2g glucose and 2g maltose to appropriate amount of ddHO. 2 O and dilute to 10 mL, sterilize to obtain Glucose medium and Maltose medium;

[0139] By volume percentage, 1% Maltose medium was mixed with 99% YP medium to obtain YP+1% Maltose medium;

[0140] Calculated by volume percentage, 1% Glucose medium was mixed with 99% YP medium to obtain YP+1% Glucose medium;

[0141] The compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 were respectively dissolved in dimethyl sulfoxide (DMSO) to prepare a stock solution with a concentration of 50 mmol / L, and sterilized;

[0142] After sterilization, YP+1% Maltose medium ZQ230712B3-350 μL containing 350 μL ZQ230712B3, YP+1% Maltose medium ZQ230712B3-700 μL containing 700 μL ZQ230712B3, and YP+1% Maltose medium Mock containing an equal volume of DMSO to the test compound, and YP+1% Glucose medium ZQB3-350 μL containing 350 μL ZQ230712B3, YP+1% Glucose medium ZQB3-700 μL containing 700 μL ZQ230712B3, and YP+1% Glucose medium Mock containing an equal volume of DMSO to the test compound were prepared using the stock solution of the compound ZQ230712B3 in Example 1 and the above culture medium.

[0143] The corresponding culture media of compounds ZQ230626CD4 and ZQ230626F3 of Examples 2 to 3 were prepared respectively by the same preparation method;

[0144] Yeast drop plate:

[0145] A single colony of the yeast transformation product-positive yeast colony A was added to 2 mL of YPM (YP+1% Maltose) medium and cultured for 24 h to obtain a turbid culture solution. The culture solution was centrifuged at 10,000 rpm for 1 min, the supernatant was discarded, and the cells were collected. 1 mL of ddH 2 The cells were washed twice with ddHO and the OD value was measured. 2 O prepare bacterial suspension, the optical density (OD) value of the bacterial suspension is 0.05, the obtained bacterial suspension is heated to 10 -1 , 10 -2 , 10 -3 , 10 -4 Dilute four concentration gradients; use the same method to obtain 10 -1 , 10 -2 , 10 -3 , 10 -4 Four concentration gradients of bacterial suspension;

[0146] 4 μL of the obtained bacterial suspension was dropped onto the Mock medium of YP+1% Maltose and YP+1% Glucose, and the YP+1% Maltose and YP+1% Glucose medium containing different contents of the compounds of Examples 1 to 3, respectively. After the droplets dropped onto the medium were completely dried, the medium was sealed and cultured at 28 to 30° C. until colonies grew out. The trend was observed and photographed for record. The results are shown in FIG. Fig. 9 As shown. Fig. 9 It can be seen that compared with the YP+1% Maltose medium Mock, adding 350 μL or 700 μL of the compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 to the YPM medium, i.e., YP+1% Maltose medium, respectively, did not affect the growth of yeast; while compared with the YP+1% Glucose medium Mock, adding 350 μL or 700 μL of the compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 to the YPD medium, i.e., YP+1% Glucose medium, respectively, did not affect the growth of yeast. Or 700 μL of the compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 will significantly inhibit the growth of yeast, indicating that the compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 have a significant inhibitory effect on the activity of transport glycoproteins, and the inhibitory effect when the addition amount is 700 μL is stronger than the inhibitory effect when 350 μL is added, that is, as the amount of the compound increases, the inhibitory effect also increases.

[0147] The effects of the parent nuclei of the compounds obtained in Examples 1 to 3 on the activity of sugar transporters were detected. The parent nuclei of the compounds obtained in Examples 1 to 3 were 4-chlorostyrene, 4-bromostyrene and indene, respectively. The specific detection method is as follows:

[0148] The contents of the compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 in the above culture medium were reduced to 50 μL and 70 μL, respectively, and the same sugar transporter activity experiment was carried out. Then, the compounds of Examples 1 to 3 in the culture medium with a compound content of 50 μL and 70 μL were replaced with the compound core of Examples 1 to 3 and the same sugar transporter activity experiment was carried out. The results obtained are as follows: Fig.10 As shown. Fig.10 It can be seen that compared with the YP+1% Maltose medium Mock, adding 50 μL or 70 μL of the compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 or the mother nuclei of the compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 to the YPM medium, i.e., YP+1% Maltose medium, respectively, does not affect the growth of yeast; while compared with the YP+1% Glucose medium Mock, adding 50 μL or 70 μL of the compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 to the YPM medium, i.e., YP+1% Maltose medium, respectively, does not affect the growth of yeast; Adding 50 μL or 70 μL of compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 to the +1% Glucose culture medium respectively will significantly inhibit the growth of yeast, while adding the mother nucleus of compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 has no effect on yeast growth, indicating that it is compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3, rather than their mother nucleus, that have an inhibitory effect on the activity of sugar transporters.

[0149] Test Example 2

[0150] The antibacterial activity of the compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 was tested by mycelium growth test. The specific detection method is as follows:

[0151] Composition of CM medium:

[0152] Ammonium tartrate powder: 0.5g

[0153] Ammonium sulfate powder (NH 4 ) 2 SO 4 ): 0.1g

[0154] Potassium dihydrogen phosphate powder (KH2 PO 4 ): 0.1g

[0155] Magnesium sulfate heptahydrate powder (MgSO 4 7H 2 O): 0.05g

[0156] Sodium chloride powder (NaCl): 0.01g

[0157] Calcium chloride powder (CaCl2): 0.01g

[0158] Sucrose powder: 1.5g

[0159] Biotin: 5x10 -6 g

[0160] Sodium tetraborate decahydrate (Na 2 B 4 O 7 10H 2 O): 0.001mg

[0161] Sodium ferric ethylenediaminetetraacetate (FeNaEDTA): 0.01 mg

[0162] Copper sulfate (CuSO 4 ):0.01mg

[0163] Manganese sulfate (MnSO 4 ): 0.02mg

[0164] Sodium molybdate (Na 2 MoSO 4 ): 0.002mg

[0165] Zinc sulfate (ZnSO 4 ): 0.2mg;

[0166] After mixing the above components, add ddH 2 O to 100 mL, sterilize;

[0167] The compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 were respectively dissolved in DMSO to prepare a stock solution with a concentration of 50 mmol / L, and the stock solution was diluted with CM culture medium to prepare a culture medium plate containing the compounds of Examples 1 to 3, and the final concentration of the compounds of Examples 1 to 3 in the culture medium plate was 50 μmol / L; a culture medium plate containing the mother core of the compound of Examples 1 to 3 was prepared in the same manner; a CM culture medium containing an equal volume of DMSO to the test compound was used as a mock control, a CM culture medium containing a fungicide pyraclostrobin was used as a positive control, and a CM culture medium without any compound was used as a control group;

[0168] After activation on potato culture medium (PDA), the frozen cakes of rice sheath blight, rice blast, corn ear rot, corn leaf blight and peanut southern rot were selected and inoculated into the prepared culture medium containing Mock, 50 μmol / L pyraclostrobin, 50 μmol / L ZQ230712B3, 50 μmol / L ZQ230626CD4, 50 μmol / L ZQ230626F3, 50 μmol / L ZQ230712B3-mother core, 50 μmol / L ZQ230626CD4-mother core, 50 μmol / L ZQ230626F3-mother core compound and no compound, and cultured at 28°C; the results are shown in Tables 1 and Fig.11 As shown. Fig.11 It can be seen that compared with the respective mother nuclei of Mock, pyraclostrobin and the compounds of Examples 1 to 3, the compounds of Examples 1 to 2 have significant inhibitory effects on rice sheath blight, rice blast, corn ear rot and corn leaf blight; the compound of Example 3 has significant inhibitory effects on rice sheath blight, rice blast, corn ear rot and peanut white spot fungus.

[0169] The antibacterial activities of compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 were detected by mycelium growth test as shown in Table 1:

[0170] Table 1 Antibacterial activity of compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3

[0171]

[0172] As can be seen from Table 1, for different plant pathogens, the colony diameters of the culture medium containing the compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 are significantly smaller than those of the control group, the CM culture medium containing DMSO and the CM culture medium containing pyraclostrobin, indicating that the compounds of Examples 1 to 3 have a significant inhibitory effect on plant pathogens.

[0173] Test Example 3

[0174] The antibacterial activity of the compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 was tested by a bacterial growth rate test. The specific detection method is as follows:

[0175] The compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 were dissolved in DMSO to prepare a stock solution with a concentration of 50 mmol / L, and the stock solution was diluted with LB or Xiebenzhe liquid culture medium to prepare a culture solution with a final concentration of 50 μmol / L of the compounds of Examples 1 to 3; at the same time, the culture solutions of the corresponding compound cores (ZQ230712B3-core, ZQ230626CD4-core, ZQ230626F3-core) of the same concentration were prepared, and the DMSO containing the same volume as the test compound and the LB or Xiebenzhe culture solution without any compound were used as the mock and control group culture solutions respectively;

[0176] Composition of Xiebenzhe culture medium:

[0177] Sucrose powder: 4g

[0178] Peptone powder: 1g

[0179] Magnesium sulfate heptahydrate powder (MgSO 4 7H 2 O):0.05g

[0180] Potassium phosphate powder (K 2 PO 4 ):0.1g

[0181] Agar powder (Agar): 2.4g;

[0182] After mixing the above components, add ddH 2 O to 200 mL, sterilize;

[0183] The activated tobacco wildfire pathogen, tobacco angular spot pathogen, tobacco bacterial wilt pathogen and Chinese cabbage soft rot pathogen were dissolved in 2 mL of LB culture medium, shaken and cultured at 30°C and 220 rpm for 16 h to obtain a bacterial suspension, and 10 μL of the bacterial suspension was mixed with 2 mL of the above-mentioned LB culture medium containing the compounds of Examples 1 to 3, the compound nuclei of Examples 1 to 3, kanamycin sulfate, DMSO and no compounds; the activated rice bacterial leaf blight pathogen was dissolved in 2 mL of Xiebenzhe culture medium, shaken and cultured in the same way as above, and then 10 μL of the bacterial suspension was mixed with 2 mL of the above-mentioned liquid culture medium containing the compounds of Examples 1 to 3, the compound nuclei of Examples 1 to 3, DMSO and no compounds;

[0184] Aspirate 300 μL of the mixed liquid to measure the OD600 before culture and record it, marked as OD 1 The remaining liquid was placed in a shaking culture at 30°C and 220 rpm for 16 h. The OD600 after culture was measured and recorded, marked as OD 2 ; The inhibitory effect of the test compound on pathogenic bacteria was determined by calculating the growth rate of the OD of pathogenic bacteria in different treatment groups before and after cultivation; the calculation formula is as follows:

[0185] Growth rate calculation formula: (OD 2 -OD 1 ) / OD 1 *100%

[0186] The test results are shown in Table 2 and Fig.12 As shown, from Fig.12 It can be seen that the compound ZQ230712B3 of Example 1 and the compound ZQ230626CD4 of Example 2 can effectively inhibit three pathogens, namely, pyrocatecholoma spp., angular leaf spot pathogen of tobacco and bacterial blight pathogen of rice. The compound ZQ230626F3 of Example 3 can effectively inhibit pyrocatecholoma spp. and Chinese cabbage soft rot pathogen. This indicates that the compounds provided by the present invention can act on a variety of pathogens and have broad-spectrum antibacterial properties.

[0187] The antibacterial activities of compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 were detected by bacterial growth rate test as shown in Table 2:

[0188] Table 2 Antibacterial activity of compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3

[0189]

[0190] As can be seen from Table 2, for different plant pathogens, the colony diameters of the culture medium containing the compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 are significantly smaller than the colony diameters in the control culture medium, indicating that the compounds of Examples 1 to 3 have a significant inhibitory effect on plant pathogens.

[0191] Test Example 4

[0192] The growth-promoting effects of the compounds of Examples 1 to 3 on plants were tested by growth-promoting tests. The specific testing method is as follows:

[0193] The compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 were respectively dissolved in DMSO to prepare stock solutions with a concentration of 50 mmol / L, and the above stock solutions were diluted with MS culture medium to prepare culture solutions with a final concentration of 50 μmol / L for the compounds of Examples 1 to 3; DMSO containing an equal volume of the test compound and MS culture medium without any compound were used as mock and control culture solutions, respectively.

[0194] Wild-type rice (Nipponbare) seeds that had been germinated with clean water in advance were placed in a culture solution containing the above five combinations and hydroponically cultured in a constant temperature climate chamber at 28°C and 12h light / 12h dark for 7 days. After 7 days, the growth of the rice was recorded and counted.

[0195] Test results such as Fig.13 As shown in Table 3:

[0196] Table 3 Growth-promoting effects of compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 on rice

[0197]

[0198] from Fig.13 It can be seen from Table 3 that, compared with the control group (CK) and the Mock group, the compounds of Examples 1 to 3 can effectively promote the growth of rice seedling roots and the plant height of rice seedlings. The above shows that the compounds provided by the present invention have a certain growth-promoting effect on rice plants.

[0199] In summary, the β-hydroxydithiophosphate compounds provided by the present invention can not only inhibit plant pathogens by inhibiting the activity of sugar transporters, but also have excellent antibacterial effects and broad-spectrum antibacterial properties, and also have a significant growth-promoting effect on plant growth.

[0200] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A β-hydroxy dithiophosphate compound having a chemical structure as shown in Formula I or Formula II: In the formula I, R 1 It is one of p-CH3, p-Cl, p-F, p-Br, pt-Bu, p-Ph, and p-NO2.

2. The β-hydroxy dithiophosphate compound according to claim 1, characterized in that: In the formula I, R 1 It is p-Cl or p-Br.

3. The method for preparing the β-hydroxy dithiophosphate compound according to claim 1 or 2, comprising: Aromatic hydrocarbons, dialkyl dithiophosphate ethyl ester and ethanol solution are subjected to addition reaction to obtain β-hydroxy dithiophosphate compounds; the aromatic hydrocarbons are 4-methylstyrene, 4-chlorostyrene, 4-fluorostyrene, 4-bromostyrene, 4-tert-butylstyrene, 4-vinylbiphenyl, 4-nitrostyrene or indene.

4. The preparation method according to claim 3, characterized in that: The volume ratio of the amount of the aromatic hydrocarbon, the amount of the dithiodialkyl phosphate ethyl ester and the ethanol solution is (1-2) mmol: (1.5-2) mmol: (2-3) mL; the molar concentration of the ethanol solution is 0.5-1 mol / L.

5. The preparation method according to claim 3 or 4, characterized in that: The temperature of the addition reaction is 0 to 50° C., and the time of the addition reaction is 4 to 12 hours.

6. The preparation method according to claim 3, characterized in that: The addition reaction is carried out under stirring conditions, and the stirring rate is 500-1200 rpm / min.

7. The preparation method according to claim 3, characterized in that: After the addition reaction is completed, post-treatment is performed; the post-treatment includes extraction, drying, concentration and column chromatography purification performed in sequence.

8. The preparation method according to claim 7, characterized in that: The stationary phase of the column chromatography purification is column chromatography silica gel; the particle size of the column chromatography silica gel is 200-300 meshes; the eluent of the column chromatography purification is ethyl acetate-petroleum ether; the volume ratio of ethyl acetate to petroleum ether in the eluent is 1:(8-100).

9. Use of the β-hydroxy dithiophosphate compound according to claim 1 or 2 in plant disease resistance and antibacterial activity and rice plant growth promotion.

10. A pesticide formulation, characterized in that: Including the β-hydroxy dithiophosphate compound according to claim 1 or 2.

Images