A β-hydroxy dithiophosphate compound and its preparation method and application
By synthesizing β-hydroxyphosphodisoate compounds, the problem of the lack of broad-spectrum antibacterial properties of existing phosphorodithioate derivatives is solved, and effective inhibition of a variety of plant bacteria and rice promotion effects are achieved.
Patent Information
- Application Number
- CN202510003204.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-02
- Publication Date
- 2025-08-08
- Estimated Expiration
- 2045-01-02
AI Technical Summary
The existing phosphorodithioate derivatives have excellent inhibitory effect on rice blast bacteria, but their inhibitory activity on other plant bacteria is insufficient and cannot meet the needs of broad-spectrum antibacteriality.
β-hydroxyphosphorus compounds are designed and synthesized, prepared by addition reaction, combined with aromatic hydrocarbons, dithiodialkylphosphate ethyl phosphate and ethanol solutions, optimized reaction conditions and post-treatment process, and formed compounds with specific structures, using hydroxyl groups to form hydrogen bonds with sugar transporters, electrostatic interactions, and inhibited sugar transporters' activity.
It has achieved good inhibitory effects on rice blast bacteria, rice vein blight bacteria, corn ear rot bacteria, corn large spot bacteria, tobacco wildfire bacteria, tobacco horn spot bacteria, rice white leaf blight bacteria and Chinese cabbage soft rot bacteria, and has broad-spectrum antibacterial properties and has a proliferation effect on rice plants.
Smart Images

Figure QLYQS_1 
Figure QLYQS_2 
Figure QLYQS_3
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of medicinal chemistry, and in particular to a beta-hydroxy dithiophosphate compound, a preparation method and an application thereof. Background Art
[0002] Organophosphorus pesticides, with their advantages of high efficacy, rapid decomposition, and low cost, are one of the three mainstays of current pesticides and are widely used as fungicides and agricultural insecticides. Phosphorodithioates are the most commonly used class of organophosphorus pesticides, effectively inhibiting plant pathogens. For example, prior art utilizes asymmetric S-alkyl (allyl) O-substituted phenyl phosphorodithioates, derivatives of phosphorodithioates, to prepare plant pathogen inhibitors. However, when used to inhibit eight pathogens, including rice blast, these compounds exhibited excellent inhibitory properties only against rice blast, with only low inhibitory activity against the remaining seven plant pathogens. The broad spectrum of their antibacterial properties does not meet the requirements of practical applications. Summary of the Invention
[0003] The present invention aims to provide a β-hydroxy dithiophosphate compound, a preparation method and an application thereof. The β-hydroxy dithiophosphate compound provided by the present invention has a good inhibitory effect on a variety of plant pathogens and has excellent broad-spectrum antibacterial properties.
[0004] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:
[0005] The present invention provides a β-hydroxy dithiophosphate compound having a chemical structure as shown in Formula I or Formula II:
[0006]
[0007] In the formula I, R 1 It is one of p-CH3, p-Cl, p-F, p-Br, pt-Bu, p-Ph, and p-NO2.
[0008] Preferably, in the formula I, R 1 It is p-Cl or p-Br.
[0009] The present invention also provides a method for preparing the β-hydroxy dithiophosphate compound described in the above technical solution, comprising:
[0010] Aromatic hydrocarbons, dialkyl dithiophosphate ethyl ester and ethanol solution are subjected to addition reaction to obtain β-hydroxy dithiophosphate compounds; the aromatic hydrocarbons are 4-methylstyrene, 4-chlorostyrene, 4-fluorostyrene, 4-bromostyrene, 4-tert-butylstyrene, 4-vinylbiphenyl, 4-nitrostyrene or indene.
[0011] Preferably, the volume ratio of the amount of the aromatic hydrocarbon, the amount of the disulfide dialkyl phosphate ethyl ester and the ethanol solution is (1-2) mmol: (1.5-2) mmol: (2-3) mL; the molar concentration of the ethanol solution is 0.5-1 mol / L.
[0012] Preferably, the temperature of the addition reaction is 0 to 50° C., and the time of the addition reaction is 4 to 12 hours.
[0013] Preferably, the addition reaction is carried out under stirring conditions, and the stirring rate is 500-1200 rpm / min.
[0014] Preferably, after the addition reaction is completed, post-treatment is performed; the post-treatment includes extraction, drying, concentration and column chromatography purification performed in sequence.
[0015] Preferably, the stationary phase of the column chromatography purification is column chromatography silica gel; the particle size of the column chromatography silica gel is 200-300 mesh; the eluent of the column chromatography purification is ethyl acetate-petroleum ether; the volume ratio of ethyl acetate and petroleum ether in the eluent is 1:(8-100).
[0016] The present invention also provides the use of the β-hydroxy dithiophosphate compound described in the above technical solution in plant disease resistance and antibacterial and rice plant growth promotion.
[0017] The present invention also provides a pesticide preparation comprising the β-hydroxy dithiophosphate compound described in the above technical solution.
[0018] The present invention provides a β-hydroxy dithiophosphate compound and a structural formula of the β-hydroxy dithiophosphate compound. The dithiophosphate group in the β-hydroxy dithiophosphate compound provided by the present invention has antibacterial properties, which can effectively improve the antibacterial properties of the β-hydroxy dithiophosphate compound. At the same time, the hydroxyl group in the compound can form hydrogen bonds with the sugar transport protein of pathogens, inhibiting the activity of the sugar transport protein, reducing the pathogen's absorption of essential nutrients such as sugar, and improving the antibacterial properties of the compound. The electrostatic interaction between the dithiophosphate group and the sugar transport protein further promotes the binding of the compound to the sugar transport protein, increasing the inhibitory effect on the activity of the sugar transport protein and further improving the antibacterial properties of the compound. Furthermore, the compound effectively inhibits a variety of pathogens by cutting off the pathway by which pathogens plunder the host plant's nutrient sugar, thereby improving the compound's broad-spectrum antibacterial properties. The results of the examples show that the β-hydroxy dithiophosphate compounds provided by the present invention have good antibacterial properties against rice blast, rice sheath blight, corn ear rot, corn leaf blight, tobacco wildfire, tobacco angular leaf spot, rice bacterial leaf blight and Chinese cabbage soft rot, and have broad-spectrum antibacterial properties; at the same time, they have a growth-promoting effect on rice plants. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 is the H NMR spectrum of (4-chlorophenyl)-β-hydroxyethyl dithiophosphate in Example 1;
[0020] Figure 2 is the H NMR spectrum of (4-bromophenyl)-β-hydroxyethyl dithiophosphate in Example 2;
[0021] Figure 3 is the H NMR spectrum of ethyl S-(1-hydroxy-2,3-dihydro-1H-inden-2-yl) dithiophosphate in Example 3;
[0022] Figure 4 is the H NMR spectrum of (4-methylphenyl)-β-hydroxyethyl dithiophosphate in Example 4;
[0023] Figure 5 is the H NMR spectrum of ethyl (4-fluorophenyl)-β-hydroxydithiophosphate in Example 5;
[0024] Figure 6 This is the H NMR spectrum of (4-tert-butylphenyl)-β-hydroxyethyl dithiophosphate in Example 6;
[0025] Figure 7 is the H NMR spectrum of ((4-phenyl)phenyl)-β-hydroxyethyl dithiophosphate in Example 7;
[0026] Figure 8 This is the H NMR spectrum of (4-nitrophenyl)-β-hydroxyethyl dithiophosphate in Example 8;
[0027] Figure 9 Figure 2 is a graph showing the growth of yeast transformation products in culture media containing 350 μL and 700 μL of the compounds of Examples 1 to 3, respectively;
[0028] Figure 10 Figure 2 is a graph showing the growth of yeast transformation products in culture media containing 50 μL and 70 μL of the compounds of Examples 1 to 3, respectively;
[0029] Figure 11 The figures are growth status graphs and colony diameter histograms of rice sheath blight, rice blast, and corn ear rot pathogens in culture media containing the compounds of Examples 1 to 3, respectively; the figures are growth status graphs and colony diameter histograms of corn leaf blight pathogens in culture media containing the compounds of Examples 1 to 2, respectively; and the figures are growth status graphs and colony diameter histograms of peanut white rot pathogens in culture media containing the compound of Example 3;
[0030] Figure 12The figure is a bar graph showing the growth rates of tobacco wildfire pathogens, tobacco angular leaf spot pathogens, rice bacterial blight pathogens and Chinese cabbage soft rot pathogens in culture media containing the compounds of Examples 1 to 3, respectively;
[0031] Figure 13 The figures are graphs showing the growth promotion of rice plants by the compounds of Examples 1 to 3 and bar graphs showing root length and plant height. DETAILED DESCRIPTION
[0032] The present invention provides a β-hydroxy dithiophosphate compound having a chemical structure as shown in Formula I or Formula II:
[0033]
[0034] In the formula I, R 1 It is one of p-CH3, p-Cl, p-F, p-Br, pt-Bu, p-Ph, and p-NO2.
[0035] In the present invention, the R 1 is p-CH3, p-Cl, p-F, p-Br, p-Bu, p-Ph or p-NO2; preferably p-Cl or p-Br, more preferably p-Cl. In the present invention, by limiting the types of groups in the structural formula, the antibacterial properties of the compound are further improved.
[0036] The β-hydroxydithiophosphate compounds provided by the present invention can effectively inhibit the activity of sugar transport proteins, reduce the absorption of sugar by pathogens, and improve the antibacterial properties of the compounds. At the same time, the compounds can inhibit multiple pathogens simultaneously by acting on sugar transport proteins, avoiding direct effects on pathogens, thereby improving the broad-spectrum antibacterial properties of the compounds.
[0037] The present invention also provides a method for preparing the β-hydroxy dithiophosphate compound described in the above technical solution, comprising the following steps:
[0038] Aromatic hydrocarbon, dialkyl dithiophosphate ethyl ester and ethanol solution are subjected to addition reaction to obtain β-hydroxy dithiophosphate compounds.
[0039] In the present invention, the aromatic hydrocarbon is 4-methylstyrene, 4-chlorostyrene, 4-fluorostyrene, 4-bromostyrene, 4-tert-butylstyrene, 4-vinylbiphenyl, 4-nitrostyrene or indene. In the present invention, the antibacterial properties of the compound are ensured by limiting the specific types of aromatic hydrocarbons.
[0040] As an embodiment of the present invention, the molar concentration of the ethanol solution can be 0.5 to 1 mol / L, or 0.5 mol / L. In the present invention, by limiting the concentration of the ethanol solution, the addition reaction is ensured to proceed smoothly, further improving the antibacterial performance of the chemical.
[0041] As an embodiment of the present invention, the volume ratio of the amount of the aromatic hydrocarbon, the amount of the disulfide dialkyl phosphate ethyl ester and the ethanol solution can be (1-2) mmol: (1.5-2) mmol: (2-3) mL, or (1-1.5) mmol: (1.5-1.8) mmol: (2-2.5) mL. In an embodiment of the present invention, the volume ratio of the amount of the aromatic hydrocarbon, the amount of the disulfide dialkyl phosphate ethyl ester and the ethanol solution can be specifically 1 mmol: 1.5 mmol: 2 mL. In the present invention, by limiting the amount ratio of the reaction raw materials, sufficient reaction between the raw materials can be ensured, further improving the antibacterial performance of the compound.
[0042] As an embodiment of the present invention, the temperature of the addition reaction can be 0 to 50°C, or 20 to 30°C. In an embodiment of the present invention, the temperature of the addition reaction can be specifically 0, 10, 15, 20, 25, 30, 40, 45 or 50°C. The time of the addition reaction can be 4 to 12 hours, or 8 to 10 hours. In an embodiment of the present invention, the time of the addition reaction can be specifically 4, 6, 7, 8, 9, 10, 11 or 12 hours. In the present invention, by limiting the process parameters of the addition reaction, the forward reaction is further promoted, the compound formation is promoted, and the antibacterial performance of the compound is further improved.
[0043] As one embodiment of the present invention, the addition reaction can be carried out under stirring; the stirring rate can be 500-1200 rpm / min, or 700-900 rpm / min. In the present invention, by limiting the stirring rate, sufficient contact reaction between the raw materials is ensured, the occurrence of side reactions is reduced, and the antibacterial properties of the compound are further improved.
[0044] As one embodiment of the present invention, the addition reaction can be terminated using saturated saline solution; the volume ratio of the aromatic hydrocarbon to the saturated saline solution can be 1 mmol:(10-20) mL, or 1 mmol:(15-18) mL. In the present invention, by limiting the amount of saturated saline solution, the addition reaction can be completely terminated, avoiding excessive reaction and further ensuring the performance of the compound.
[0045] As an embodiment of the present invention, after the addition reaction is completed, post-treatment may be performed; the post-treatment may include extraction, drying, concentration and column chromatography purification performed in sequence.
[0046] As one embodiment of the present invention, the extraction solvent can be ethyl acetate; the volume ratio of the extraction solvent to the amount of aromatic hydrocarbon can be (5-10) mL:1 mmol, or (6-8) mL:1 mmol; the number of extractions can be 3-4 times, or 3 times. In the present invention, by limiting the process parameters of the extraction process, the separation of the product can be ensured, the purification of the product can be achieved, the influence of impurities on the performance of the compound can be avoided, and its antibacterial performance can be further improved.
[0047] The present invention has no particular limitation on the drying operation, as long as the organic phase obtained by the extraction can be dried. In an embodiment of the present invention, the drying can be performed using anhydrous sodium sulfate.
[0048] The present invention has no particular limitation on the concentration operation, as long as the solvent can be completely removed. In an embodiment of the present invention, the concentration can be reduced-pressure concentration.
[0049] As one embodiment of the present invention, the stationary phase for column chromatography purification can be column chromatography silica gel; the particle size of the column chromatography silica gel can be 200-300 mesh, or 250-280 mesh; the eluent for column chromatography purification can be ethyl acetate-petroleum ether; the volume ratio of ethyl acetate to petroleum ether in the eluent can be 1:(8-100), or 1:(20-50). In the present invention, by limiting the process parameters of column chromatography, the compound can be further removed from impurities, the influence of impurities on the performance of the compound can be avoided, and the antibacterial performance can be further improved.
[0050] The present invention controls the process parameters of raw material preparation and post-processing to ensure sufficient contact reaction between the raw materials, promote the forward progress of the raw materials, reduce the occurrence of side reactions, and simultaneously cooperate with post-processing to remove by-products and impurities, thereby avoiding the influence of by-products and impurities on the performance of the compound, and effectively improving the antibacterial performance and broad-spectrum antibacterial properties of β-hydroxy dithiophosphate compounds.
[0051] The present invention also provides the use of the β-hydroxy dithiophosphate compound described in the above technical solution in plant disease resistance and antibacterial and rice plant growth promotion.
[0052] As an embodiment of the present invention, the β-hydroxy dithiophosphate compound can be used to inhibit rice blast, rice sheath blight, corn ear rot, corn leaf blight, tobacco wildfire, tobacco angular leaf spot, rice bacterial leaf blight and Chinese cabbage soft rot.
[0053] As an embodiment of the present invention, the β-hydroxy dithiophosphate compound can promote the growth of rice plants.
[0054] The present invention has no particular limitation on the specific application of the β-hydroxy dithiophosphate compound, and any application method of antibacterial compounds well known to those skilled in the art can be used.
[0055] The present invention also provides a pesticide preparation comprising the β-hydroxy dithiophosphate compound described in the above technical solution.
[0056] As an embodiment of the present invention, the pesticide preparation can be an injection, tablet, capsule, aerosol, suppository, film, pill, ointment, controlled release agent, sustained release agent or nano preparation.
[0057] The present invention has no particular limitation on the types of auxiliary materials in the pesticide formulation and the preparation method of the pesticide formulation. The preparation method of the pesticide formulation containing antibacterial compounds well known to those skilled in the art can be adopted.
[0058] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions of the present invention. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.
[0059] Example 1
[0060] A (4-chlorophenyl)-β-hydroxy dithiophosphate ethyl ester - ZQ230712B3, having the chemical structure shown below:
[0061]
[0062] The preparation method of the (4-chlorophenyl)-β-hydroxy dithiophosphate ethyl ester is as follows:
[0063] In a 10 mL round-bottom flask equipped with a magnetic stirrer, 1.0 mmol of 4-chlorostyrene, 1.5 mmol of ethyl disulfide dialkylphosphate, and 2 mL of a 0.5 mol / L ethanol solution were added in sequence, wherein the volume ratio of the amount of 4-chlorostyrene, the amount of ethyl disulfide dialkylphosphate, and the ethanol solution was 1.0 mmol:1.5 mmol:2 mL. The addition reaction was carried out at a stirring rate of 750 rpm / min and 5° C. for 8 h, and then 15 mL of saturated brine was added to terminate the reaction. The product was extracted three times with 8 mL of ethyl acetate. The organic phases were combined and dried over anhydrous Na2SO4, the desiccant was removed by filtration, and the organic solvent was removed by concentration under reduced pressure. The product was then purified by column chromatography to isolate (4-chlorophenyl)-β-hydroxydithiophosphate ethyl ester. The column chromatography purification was performed using silica gel with a particle size of 250-280 mesh, and the eluent was ethyl acetate:petroleum ether in a volume ratio of 1:30.
[0064] The nuclear magnetic resonance spectroscopy was used to characterize (4-chlorophenyl)-β-hydroxy dithiophosphate ethyl ester, and the obtained nuclear magnetic hydrogen spectrum was as follows: Figure 1 As shown. Figure 1 It can be seen that the hydrogen element absorption signal corresponding to the compound proves that Example 1 indeed obtains the compound with the shown chemical structure.
[0065] Example 2
[0066] A (4-bromophenyl)-β-hydroxy dithiophosphate ethyl ester - ZQ230626CD4, having the chemical structure shown below:
[0067]
[0068] The preparation method of the (4-bromophenyl)-β-hydroxy dithiophosphate ethyl ester is as follows:
[0069] In a 10 mL round-bottom flask equipped with a magnetic stirrer, 1.0 mmol of 4-bromostyrene, 1.5 mmol of ethyl disulfide dialkylphosphate, and 2 mL of a 0.5 mol / L ethanol solution were added in sequence, wherein the volume ratio of the amount of 4-bromostyrene, the amount of ethyl disulfide dialkylphosphate, and the ethanol solution was 1.0 mmol:1.5 mmol:2 mL. The addition reaction was carried out at a stirring rate of 750 rpm / min and 0° C. for 8 h. The reaction was then terminated by adding 10 mL of saturated brine. The product was extracted three times with 8 mL of ethyl acetate. The organic phases were combined, dried over anhydrous Na2SO4, filtered to remove the desiccant, concentrated under reduced pressure to remove the organic solvent, and purified by column chromatography to isolate (4-bromophenyl)-β-hydroxyethyl dithiophosphate. The column chromatography purification was performed using silica gel with a particle size of 250-280 mesh, and the eluent was ethyl acetate:petroleum ether in a volume ratio of 1:50.
[0070] The nuclear magnetic resonance spectroscopy was used to characterize (4-bromophenyl)-β-hydroxy dithiophosphate ethyl ester. The obtained nuclear magnetic hydrogen spectrum was as follows: Figure 2 As shown. Figure 2 It can be seen that the hydrogen element absorption signal corresponding to the compound proves that Example 2 indeed obtains the compound with the shown chemical structure.
[0071] Example 3
[0072] An S-(1-hydroxy-2,3-dihydro-1H-inden-2-yl) dithiophosphate ethyl ester - ZQ230626F3, having the chemical structure shown below:
[0073]
[0074] The preparation method of the S-(1-hydroxy-2,3-dihydro-1H-inden-2-yl) dithiophosphate ethyl ester is as follows:
[0075] In a 10 mL round-bottom flask equipped with a magnetic stirrer, 1.0 mmol of indene, 1.5 mmol of ethyl dithiodialkylphosphate, and 2 mL of a 0.5 mol / L ethanol solution were added in sequence, wherein the volume ratio of indene, ethyl dithiodialkylphosphate, and ethanol solution was 1.0 mmol:1.5 mmol:2 mL. The addition reaction was carried out at a stirring rate of 750 rpm / min and 5°C for 10 h. The reaction was then terminated by adding 15 mL of saturated brine, and the mixture was extracted three times with 10 mL of ethyl acetate. The organic phases were combined and dried over anhydrous Na2SO4, the desiccant was removed by filtration, and the organic solvent was removed by concentration under reduced pressure. The mixture was then purified by column chromatography to isolate ethyl S-(1-hydroxy-2,3-dihydro-1H-inden-2-yl) dithiophosphate. The column chromatography phase was 250-280 mesh silica gel, and the eluent was ethyl acetate:petroleum ether in a volume ratio of 1:35.
[0076] The nuclear magnetic resonance spectra of S-(1-hydroxy-2,3-dihydro-1H-inden-2-yl) dithiophosphate were characterized. Figure 3 As shown. Figure 3 It can be seen that the hydrogen element absorption signal corresponding to the compound proves that Example 3 indeed obtains the compound with the shown chemical structure.
[0077] Example 4
[0078] A (4-methylphenyl)-β-hydroxy dithiophosphate ethyl ester having the chemical structure shown below:
[0079]
[0080] The preparation method of the (4-methylphenyl)-β-hydroxy dithiophosphate ethyl ester is as follows:
[0081] In a 10 mL round-bottom flask equipped with a magnetic stirrer, 1.0 mmol of 4-methylstyrene, 1.5 mmol of ethyl disulfide dialkylphosphate, and 2 mL of a 0.5 mol / L ethanol solution were added in sequence, wherein the volume ratio of 4-methylstyrene, ethyl disulfide dialkylphosphate, and ethanol solution was 1.0 mmol:1.5 mmol:2 mL. The addition reaction was carried out at a stirring rate of 750 rpm / min and 4° C. for 10 h, and then 12 mL of saturated brine was added to terminate the reaction. The mixture was extracted three times with 8 mL of ethyl acetate. The organic phases were combined, dried over anhydrous Na2SO4, filtered to remove the desiccant, concentrated under reduced pressure to remove the organic solvent, and purified by column chromatography to isolate (4-methylphenyl)-β-hydroxyethyl dithiophosphate. The column chromatography purification phase was 250-280 mesh silica gel, and the eluent was ethyl acetate:petroleum ether in a volume ratio of 1:80.
[0082] The nuclear magnetic resonance spectroscopy was used to characterize (4-methylphenyl)-β-hydroxy dithiophosphate ethyl ester, and the obtained nuclear magnetic hydrogen spectrum was as follows: Figure 4 As shown. Figure 4 It can be seen that the hydrogen element absorption signal corresponding to the compound proves that Example 4 indeed obtains the compound with the shown chemical structure.
[0083] Example 5
[0084] A (4-fluorophenyl)-β-hydroxy dithiophosphate ethyl ester having the chemical structure shown below:
[0085]
[0086] The preparation method of the (4-fluorophenyl)-β-hydroxy dithiophosphate ethyl ester is as follows:
[0087] In a 10 mL round-bottom flask equipped with a magnetic stirrer, 1.0 mmol of 4-fluorostyrene, 1.5 mmol of ethyl disulfide dialkylphosphate, and 2 mL of a 0.5 mol / L ethanol solution were added in sequence, wherein the volume ratio of the amount of 4-fluorostyrene, the amount of ethyl disulfide dialkylphosphate, and the ethanol solution was 1.0 mmol:1.5 mmol:2 mL. The addition reaction was carried out at a stirring rate of 750 rpm / min and 0°C for 8 h. The reaction was then terminated by adding 10 mL of saturated brine, and the mixture was extracted three times with 8 mL of ethyl acetate. The organic phases were combined, dried over anhydrous Na2SO4, filtered to remove the desiccant, concentrated under reduced pressure to remove the organic solvent, and purified by column chromatography to isolate (4-fluorophenyl)-β-hydroxyethyl dithiophosphate. The column chromatography purification was performed using silica gel with a particle size of 250-280 mesh, and the eluent was ethyl acetate:petroleum ether in a volume ratio of 1:60.
[0088] The nuclear magnetic resonance spectroscopy was used to characterize (4-fluorophenyl)-β-hydroxy dithiophosphate ethyl ester, and the obtained nuclear magnetic hydrogen spectrum was as follows: Figure 5 As shown. Figure 5 It can be seen that the hydrogen element absorption signal corresponding to the compound proves that Example 5 indeed obtains the compound with the shown chemical structure.
[0089] Example 6
[0090] A (4-tert-butylphenyl)-β-hydroxy dithiophosphate ethyl ester having the chemical structure shown below:
[0091]
[0092] The preparation method of the (4-tert-butylphenyl)-β-hydroxy dithiophosphate ethyl ester is as follows:
[0093] In a 10 mL round-bottom flask equipped with a magnetic stirrer, 1.0 mmol of 4-tert-butylstyrene, 1.5 mmol of ethyl dialkylphosphodisulfide, and 2 mL of a 0.5 mol / L ethanol solution were added in sequence, wherein the volume ratio of the amount of 4-tert-butylstyrene, the amount of ethyl dialkylphosphodisulfide, and the ethanol solution was 1.0 mmol:1.5 mmol:2 mL. The addition reaction was carried out at a stirring rate of 750 rpm / min and 4° C. for 6 h. The reaction was then terminated by adding 12 mL of saturated brine, and the mixture was extracted three times with 8 mL of ethyl acetate. The organic phases were combined, dried over anhydrous Na2SO4, filtered to remove the desiccant, and concentrated under reduced pressure to remove the organic solvent. The mixture was then purified by column chromatography to isolate (4-tert-butylphenyl)-β-hydroxyethyl dithiophosphate. The column chromatography purification phase was 250-280 mesh silica gel, and the eluent was ethyl acetate:petroleum ether in a volume ratio of 1:30.
[0094] The nuclear magnetic resonance spectroscopy was used to characterize (4-tert-butylphenyl)-β-hydroxy dithiophosphate ethyl ester, and the obtained nuclear magnetic hydrogen spectrum was as follows: Figure 6 As shown. Figure 6 It can be seen that the hydrogen element absorption signal corresponding to the compound proves that Example 6 indeed obtains the compound with the shown chemical structure.
[0095] Example 7
[0096] A ((4-phenyl)phenyl)-β-hydroxy dithiophosphate ethyl ester having the chemical structure shown below:
[0097]
[0098] The preparation method of the (4-tert-butylphenyl)-β-hydroxy dithiophosphate ethyl ester is as follows:
[0099] In a 10 mL round-bottom flask equipped with a magnetic stirrer, 1.0 mmol of 4-phenylstyrene, 1.5 mmol of ethyl disulfide dialkylphosphate, and 2 mL of a 0.5 mol / L ethanol solution were added in sequence, wherein the volume ratio of the amount of 4-phenylstyrene, the amount of ethyl disulfide dialkylphosphate, and the ethanol solution was 1.0 mmol:1.5 mmol:2 mL. The addition reaction was carried out at a stirring rate of 750 rpm / min and 0° C. for 8 h. The reaction was then terminated by adding 10 mL of saturated brine, and the mixture was extracted three times with 8 mL of ethyl acetate. The organic phases were combined, dried over anhydrous Na2SO4, filtered to remove the desiccant, concentrated under reduced pressure to remove the organic solvent, and purified by column chromatography to isolate ((4-phenyl)phenyl)-β-hydroxyethyl dithiophosphate. The column chromatography purification was performed using silica gel with a particle size of 250-280 mesh, and the eluent was ethyl acetate:petroleum ether in a volume ratio of 1:50.
[0100] The nuclear magnetic resonance (NMR) spectra of ((4-phenyl)phenyl)-β-hydroxydithiophosphate ethyl ester were characterized. Figure 7 As shown. Figure 7 It can be seen that the hydrogen element absorption signal corresponding to the compound proves that Example 7 indeed obtains the compound with the shown chemical structure.
[0101] Example 8
[0102] A (4-nitrophenyl)-β-hydroxy dithiophosphate ethyl ester having the chemical structure shown below:
[0103]
[0104] The preparation method of the (4-nitrophenyl)-β-hydroxy dithiophosphate ethyl ester is:
[0105] In a 10 mL round-bottom flask equipped with a magnetic stirrer, 1.0 mmol of 4-nitrostyrene, 1.5 mmol of ethyl disulfide dialkylphosphate, and 2 mL of a 0.5 mol / L ethanol solution were added in sequence, wherein the volume ratio of the amount of 4-nitrostyrene, the amount of ethyl disulfide dialkylphosphate, and the ethanol solution was 1.0 mmol:1.5 mmol:2 mL. The addition reaction was carried out at a stirring rate of 750 rpm / min and 0° C. for 8 h. The reaction was then terminated by adding 10 mL of saturated brine, and the mixture was extracted three times with 8 mL of ethyl acetate. The organic phases were combined, dried over anhydrous Na2SO4, filtered to remove the desiccant, concentrated under reduced pressure to remove the organic solvent, and purified by column chromatography to isolate (4-nitrophenyl)-β-hydroxydithiophosphate ethyl ester. The column chromatography purification was performed using silica gel with a particle size of 250-280 mesh, and the eluent was ethyl acetate:petroleum ether in a volume ratio of 1:50.
[0106] The nuclear magnetic resonance spectroscopy was used to characterize (4-nitrophenyl)-β-hydroxy dithiophosphate ethyl ester. The obtained nuclear magnetic hydrogen spectrum was as follows: Figure 8 As shown. Figure 8 It can be seen that the hydrogen element absorption signal corresponding to the compound proves that Example 8 indeed obtains the compound with the shown chemical structure.
[0107] Test Example 1
[0108] The compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 were subjected to biological activity tests, and the specific steps are as follows:
[0109] (1) Construction of a carrier for sugar transporter
[0110] The nucleotide sequence of rice OsSWEET4 (LOC_Os02g19820, https: / / phytozome.jgi.doe.gov / pz / portal.html) was amplified by conventional polymerase chain reaction (PCR) using the cDNA of wild-type rice ZH11 inoculated with rice blast fungus race Guy11 for 48 h as a template.
[0111] The PCR reaction system is:
[0112] 1 μL cDNA from rice ZH11 inoculated with rice blast fungus race Guy11 for 48 hours
[0113] Forward primer: GGGGACAAGTTTGTACAAAAAAGCAGGCTTCCTCGAGATG GTCTCGCCGGACACC (SEQ ID NO. 1) 1 μL
[0114] Reverse primer: GGGGACCACTTTGTACAAGAAAGCTGGGGTGGGGCCCGTAG CGGCCGTTGGCGGC (SEQID NO.2) 1μL
[0115] 2×PCR mix 25μL
[0116] Double distilled water 22 μL;
[0117] The PCR amplification procedure was as follows: pre-denaturation at 95°C for 3 minutes, denaturation at 95°C for 15 seconds, annealing at 59°C for 15 seconds, and extension at 72°C for 1.5 minutes. The denaturation, annealing, and extension process was repeated 33 times, and a final extension at 72°C for 10 minutes was performed. After the PCR amplification was completed, the fragment was recovered by agarose gel electrophoresis and gel cutting. The size of the PCR amplified fragment was 777 bp.
[0118] The recovered fragments were homologously recombined with the pDONR221 vector (Kanamycin) via the Gateway method to obtain the pDONR221-OsSWEET4 ligation product. Positive clones were selected and sequenced for verification. The verified positive clones were again homologously recombined with the pDRf-eGFP-GW vector via the Gateway method to obtain the ligation product pDRf-OsSWEET4. Positive clones were selected and sequenced for verification to obtain the correct yeast expression vector.
[0119] The same method was used to amplify the wheat TaSWEET2a (TRITD_6Bv1G065430, https: / / www.ensembl.org / index.html?redirect=no) nucleotide sequence, the maize ZmSWEET4a (Zm00001d015905, https: / / db.cngb.org / zeamap / ) nucleotide sequence, and the Arabidopsis AtSWEET1 (At1g21460, https: / / www.arabidopsis.org / ) nucleotide sequence. The amplified wheat TaSWEET2a nucleotide sequence and the amplified maize ZmSWEET4a nucleotide sequence were constructed into the pDRf vector using the same method to obtain pDRf-TaSWEET2a and pDRf-ZmSWEET4a. The amplified Arabidopsis AtSWEET1 nucleotide sequence was constructed into the pDR196 vector using the same method to obtain pDR196-AtSWEET1.
[0120] (2) Transform the recombinant vector into the EBY4000 yeast strain
[0121] A. Preparation of reagents
[0122] Polyethylene glycol 4000 (PEG4000) reagent: Add 10 g PEG4000 to an appropriate amount of ddH2O and dilute to 20 mL, then sterilize.
[0123] Lithium acetate (LiAc) reagent: Add 3.2995 g LiAc powder to an appropriate amount of ddH2O and dilute to 50 mL. Sterilize.
[0124] 10× TE buffer: Add 100 mL of 1 mol / L Tris-HCl and 20 mL of 500 mmol / L ethylenediaminetetraacetic acid (EDTA) to 800 mL of ddH2O and adjust the volume to 1 L. The pH should be between 6.5 and 7.5. Sterilize.
[0125] B. Yeast strain activation
[0126] Streak a YPM plate with the frozen strain EBY4000 stored at -80°C and culture at 28-30°C until colonies form; pick a single colony and culture it in 2 mL of YPM liquid containing 2 g / 100 mL maltose for 24 hours to obtain a bacterial solution; wherein the strain EBY4000 is the strain EBY4000 described in the prior art "Concurrent knock-out of at least 20 transporter genesis required to block uptake of hexoses in Saccharomyces cerevisiae; Wieczorke R, et al.";
[0127] C. Yeast transformation
[0128] The bacterial solution obtained in step B was added to a 2 mL centrifuge tube in a clean bench, centrifuged at 10,000 rpm for 1 min, and the supernatant culture medium was discarded;
[0129] The precipitated bacteria were resuspended in 1 mL of ddH2O and then centrifuged at 10,000 rpm for 1 min. After centrifugation, the resuspension and centrifugation process was repeated once, and the yeast was resuspended in 300 μL of ddH2O.
[0130] The yeast transformation system consists of:
[0131] PEG4000 reagent 70 μL, LiAc reagent 8 μL, 10× TE buffer 8 μL, yeast obtained in step C 10 μL, salmon sperm DNA 2 μL, and plasmid DNA 5 μL;
[0132] The plasmid DNAs are pDRf-OsSWEET4, pDRf-TaSWEET2a, pDRf-ZmSWEET4a, pDR196-AtSWEET1 and pDRf-eGFP-GW respectively to form yeast transformation systems a to e;
[0133] The reaction procedure for yeast transformation is:
[0134] The yeast-transformed system was incubated at 28°C for 30 minutes, then heated to 42°C for 13 minutes, and then cooled to 28°C for 2 minutes. The system was then centrifuged in a handheld centrifuge for 1 minute, the supernatant discarded, and the precipitated bacteria resuspended in 50 μL of ddH2O to obtain a bacterial solution. The bacterial solution was spread on a defective SD / -Ura medium containing maltose and cultured at 28°C until positive yeast colonies A to E grew on the culture medium plate.
[0135] The effects of the compounds obtained in Examples 1 to 3 on the activity of sugar transporters were detected. The specific detection method is as follows:
[0136] Preparation of culture medium:
[0137] Mix 1 g of yeast extract powder, 2 g of agar powder, and 2 g of peptone powder, add to an appropriate amount of ddH2O, and dilute to 90 mL. Sterilize to obtain YP medium.
[0138] Add 2 g of glucose and maltose to an appropriate amount of ddH2O, dilute to 10 mL, and sterilize to obtain glucose medium and maltose medium respectively.
[0139] YP + 1% Maltose medium was obtained by mixing 1% Maltose medium with 99% YP medium by volume;
[0140] Calculated by volume percentage, 1% glucose medium was mixed with 99% YP medium to obtain YP + 1% glucose medium;
[0141] Compounds ZQ230712B3, ZQ230626CD4, and ZQ230626F3 of Examples 1 to 3 were dissolved in dimethyl sulfoxide (DMSO) to prepare stock solutions with a concentration of 50 mmol / L, and sterilized.
[0142] After sterilization, YP + 1% Maltose medium ZQ230712B3-350 μL containing 350 μL ZQ230712B3, YP + 1% Maltose medium ZQ230712B3-700 μL containing 700 μL ZQ230712B3, and YP + 1% Maltose medium Mock containing an equal volume of DMSO to the test compound, and YP + 1% Glucose medium ZQB3-350 μL containing 350 μL ZQ230712B3, YP + 1% Glucose medium ZQB3-700 μL containing 700 μL ZQ230712B3, and YP + 1% Glucose medium Mock containing an equal volume of DMSO to the test compound were prepared using the stock solution of compound ZQ230712B3 in Example 1 and the above culture medium.
[0143] The corresponding culture media of compounds ZQ230626CD4 and ZQ230626F3 of Examples 2 and 3 were prepared respectively using the same preparation method;
[0144] Yeast drop plate:
[0145] A single colony of the yeast transformation product-positive yeast colony A was added to 2 mL of YPM (YP+1% Maltose) medium and cultured for 24 h to obtain a turbid culture solution. The culture solution was centrifuged at 10,000 rpm for 1 min, the supernatant was discarded, and the bacteria were collected. The bacteria were washed twice with 1 mL of ddH2O each time in a clean bench, and the OD value was measured and then a bacterial suspension was prepared with ddH2O. The optical density (OD) value of the bacterial suspension was 0.05. The obtained bacterial suspension was diluted to 10 -1 , 10 -2 , 10 -3 , 10 -4 Dilute four concentration gradients; the yeast transformation product positive yeast colonies B to E were obtained using the same method to obtain 10 -1 , 10 -2 , 10 -3 , 10 -4 Four concentration gradients of bacterial suspension;
[0146] 4 μL of the obtained bacterial suspension was dropped onto the YP+1% Maltose and YP+1% Glucose mock culture media, as well as the YP+1% Maltose and YP+1% Glucose culture media containing different contents of the compounds of Examples 1 to 3, respectively. After the droplets on the culture media were completely dried, the culture media were sealed and cultured at 28-30°C until colonies grew. The trend was observed and photographed. The results were as follows: Figure 9 As shown. Figure 9 It can be seen that compared with the YP+1% Maltose medium Mock, adding 350 μL or 700 μL of the compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 to the YPM medium, i.e., YP+1% Maltose medium, respectively, did not affect the growth of yeast; while compared with the YP+1% Glucose medium Mock, adding 350 μL or 700 μL of the compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 to the YPD medium, i.e., YP+1% Glucose medium, respectively, did not affect the growth of yeast. or 700 μL of the compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 significantly inhibited the growth of yeast, indicating that the compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 had a significant inhibitory effect on the activity of transport glycoproteins, and the inhibitory effect was stronger when the addition amount was 700 μL than when 350 μL was added, that is, as the amount of the compound increased, the inhibitory effect also increased.
[0147] The effects of the parent nuclei of the compounds obtained in Examples 1 to 3 on the activity of sugar transporters were detected. The parent nuclei of the compounds obtained in Examples 1 to 3 were 4-chlorostyrene, 4-bromostyrene, and indene, respectively. The specific detection method was as follows:
[0148] The contents of the compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 in the above culture medium were reduced to 50 μL and 70 μL, respectively, and the same sugar transporter activity test was conducted. The same sugar transporter activity test was then conducted by replacing the compounds of Examples 1 to 3 in the culture medium with the compound contents of 50 μL and 70 μL with the compound cores of Examples 1 to 3. The results were as follows: Figure 10 As shown. Figure 10 It can be seen that compared with the YP+1% Maltose medium Mock, adding 50 μL or 70 μL of the compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 or the mother nuclei of the compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 to the YPM medium, i.e., YP+1% Maltose medium, did not affect the growth of yeast; while compared with the YP+1% Glucose medium Mock, adding 50 μL or 70 μL of the compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 to the YPM medium, i.e., YP+1% Maltose medium, did not affect the growth of yeast. Adding 50 μL or 70 μL of the compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 to the +1% glucose medium significantly inhibited yeast growth, while adding the parent nucleus of the compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 had no effect on yeast growth, indicating that it is the compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3, rather than the parent nucleus, that have an inhibitory effect on the activity of sugar transporters.
[0149] Test Example 2
[0150] The antibacterial activities of the compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 were tested by mycelial growth assay. The specific detection method is as follows:
[0151] Composition of CM medium:
[0152] Ammonium tartrate powder: 0.5g
[0153] Ammonium sulfate powder ((NH4)2SO4): 0.1g
[0154] Potassium dihydrogen phosphate powder (KH2PO4): 0.1g
[0155] Magnesium sulfate heptahydrate powder (MgSO4·7H2O): 0.05g
[0156] Sodium chloride powder (NaCl): 0.01g
[0157] Calcium chloride powder (CaCl2): 0.01g
[0158] Sucrose powder: 1.5g
[0159] Biotin: 5x10 -6 g
[0160] Sodium tetraborate decahydrate (Na2B4O7·10H2O): 0.001 mg
[0161] Sodium ferric ethylenediaminetetraacetate (FeNaEDTA): 0.01 mg
[0162] Copper sulfate (CuSO4): 0.01 mg
[0163] Manganese sulfate (MnSO4): 0.02mg
[0164] Sodium molybdate (Na2MoSO4): 0.002 mg
[0165] Zinc sulfate (ZnSO4): 0.2 mg;
[0166] Mix the above components and add ddH2O to make up to 100 mL, then sterilize;
[0167] Compounds ZQ230712B3, ZQ230626CD4, and ZQ230626F3 of Examples 1 to 3 were dissolved in DMSO to prepare stock solutions with a concentration of 50 mmol / L. The stock solutions were diluted with CM culture medium to prepare culture medium plates containing the compounds of Examples 1 to 3. The final concentration of the compounds of Examples 1 to 3 in the culture medium plates was 50 μmol / L. Culture medium plates containing the parent cores of the compounds of Examples 1 to 3 were prepared in the same manner. CM culture medium containing an equal volume of DMSO to the test compound was used as a mock control, CM culture medium containing the fungicide pyraclostrobin was used as a positive control, and CM culture medium without any compound was used as a control group.
[0168] Cakes of frozen rice sheath blight, rice blast, corn ear rot, corn leaf blight and peanut southern rot were activated on potato culture medium (PDA) and inoculated onto prepared culture medium containing Mock, 50 μmol / L pyraclostrobin, 50 μmol / L ZQ230712B3, 50 μmol / L ZQ230626CD4, 50 μmol / L ZQ230626F3, 50 μmol / L ZQ230712B3-mother core, 50 μmol / L ZQ230626CD4-mother core, 50 μmol / L ZQ230626F3-mother core and no compound, and cultured at 28°C. The results are shown in Tables 1 and 2. Figure 11 As shown. Figure 11 It can be seen that compared with the respective mother cores of Mock, pyraclostrobin and the compounds of Examples 1 to 3, the compounds of Examples 1 to 2 have significant inhibitory effects on rice sheath blight, rice blast, corn ear rot and corn leaf blight; the compound of Example 3 has significant inhibitory effects on rice sheath blight, rice blast, corn ear rot and peanut white spot.
[0169] The antibacterial activities of compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 were detected by mycelial growth test as shown in Table 1:
[0170] Table 1 Antibacterial activity of compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3
[0171]
[0172] As can be seen from Table 1, for different plant pathogens, the colony diameters of the culture medium containing the compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 were significantly smaller than the colony diameters in the control group, the CM medium containing DMSO, and the CM medium containing pyraclostrobin, indicating that the compounds of Examples 1 to 3 have a significant inhibitory effect on plant pathogens.
[0173] Test Example 3
[0174] The antibacterial activities of the compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 were tested by a bacterial growth rate test. The specific detection method is as follows:
[0175] The compounds ZQ230712B3, ZQ230626CD4, and ZQ230626F3 of Examples 1 to 3 were dissolved in DMSO to prepare stock solutions with a concentration of 50 mmol / L. The stock solutions were diluted with LB or Xiebenzhe liquid culture medium to prepare culture solutions with a final concentration of 50 μmol / L of the compounds of Examples 1 to 3. At the same time, culture solutions of the corresponding compound cores (ZQ230712B3-core, ZQ230626CD4-core, and ZQ230626F3-core) were prepared at the same concentrations. DMSO containing an equal volume of the test compound and LB or Xiebenzhe culture medium without any compound were used as mock and control culture solutions, respectively.
[0176] Composition of Xiebenzhe culture medium:
[0177] Sucrose powder: 4g
[0178] Peptone powder: 1g
[0179] Magnesium sulfate heptahydrate powder (MgSO4·7H2O): 0.05g
[0180] Potassium phosphate powder (K2PO4): 0.1g
[0181] Agar powder (Agar): 2.4g;
[0182] Mix the above components, add ddH2O to make up to 200 mL, and sterilize;
[0183] The activated tobacco wildfire pathogen, tobacco angular leaf spot pathogen, tobacco bacterial wilt pathogen and Chinese cabbage soft rot pathogen were dissolved in 2 mL of LB culture medium, and cultured at 30°C and 220 rpm for 16 h to obtain a bacterial suspension. 10 μL of the bacterial suspension was mixed with 2 mL of the above-mentioned LB culture medium containing the compounds of Examples 1 to 3, the compound nuclei of Examples 1 to 3, kanamycin sulfate, DMSO and no compound. The activated rice bacterial leaf blight pathogen was dissolved in 2 mL of Xiebenzhe culture medium and cultured with shaking according to the above method. Then, 10 μL of the bacterial suspension was mixed with 2 mL of the above-mentioned liquid culture medium containing the compounds of Examples 1 to 3, the compound nuclei of Examples 1 to 3, DMSO and no compound.
[0184] 300 μL of the mixed liquid was aspirated to measure the OD600 before incubation and recorded, marked as OD1; the remaining liquid was placed in a shaking incubation at 30°C and 220 rpm for 16 hours, and the OD600 after incubation was measured and recorded, marked as OD2; the inhibitory effect of the test compound on pathogenic bacteria was determined by calculating the growth rate of the OD of pathogenic bacteria before and after incubation in different treatment groups; the calculation formula is as follows:
[0185] Growth rate calculation formula: (OD2-OD1) / OD1*100%
[0186] The test results are shown in Table 2 and Figure 12 As shown, from Figure 12 It can be seen that the compound ZQ230712B3 of Example 1 and the compound ZQ230626CD4 of Example 2 can effectively inhibit three pathogens, namely, tobacco pyrolyticus, tobacco angular leaf spot pathogen and rice bacterial blight pathogen. The compound ZQ230626F3 of Example 3 can effectively inhibit tobacco pyrolyticus and Chinese cabbage soft rot pathogen. This shows that the compounds provided by the present invention can act on a variety of pathogens and have broad-spectrum antibacterial properties.
[0187] The antibacterial activities of compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 were detected using a bacterial growth rate test, as shown in Table 2:
[0188] Table 2 Antibacterial activity of compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3
[0189]
[0190] As can be seen from Table 2, for different plant pathogens, the colony diameters of the culture medium containing the compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 were significantly smaller than the colony diameters in the control culture medium, indicating that the compounds of Examples 1 to 3 have a significant inhibitory effect on plant pathogens.
[0191] Test Example 4
[0192] The growth-promoting effects of the compounds of Examples 1 to 3 on plants were tested by growth-promoting tests. The specific testing method is as follows:
[0193] Compounds ZQ230712B3, ZQ230626CD4, and ZQ230626F3 from Examples 1 to 3 were dissolved in DMSO to prepare stock solutions at a concentration of 50 mmol / L. The stock solutions were diluted with MS culture medium to prepare culture solutions with a final concentration of 50 μmol / L for the compounds from Examples 1 to 3. DMSO containing an equal volume of the test compound and MS culture medium without any compound were used as mock and control culture solutions, respectively.
[0194] Wild-type rice (Nipponbare) seeds that had been germinated with water in advance were placed in a culture medium containing the five combinations described above and hydroponically cultured in a constant temperature climate chamber at 28°C, 12 h light / 12 h dark for 7 days. After 7 days, the rice growth was recorded and statistically analyzed.
[0195] The test results are as follows Figure 13 As shown in Table 3:
[0196] Table 3 Growth-promoting effects of compounds ZQ230712B3, ZQ230626CD4 and ZQ230626F3 of Examples 1 to 3 on rice
[0197]
[0198] from Figure 13 As can be seen from Table 3, compared with the control group (CK) and the mock group, the compounds of Examples 1 to 3 can effectively promote the growth of rice seedling roots and the height of rice seedlings. The above shows that the compounds provided by the present invention have a certain growth-promoting effect on rice plants.
[0199] In summary, the above embodiments and test examples show that the β-hydroxy dithiophosphate compounds provided by the present invention can not only inhibit plant pathogens by inhibiting the activity of sugar transporters, but also have excellent antibacterial effects and broad-spectrum antibacterial properties, and also have a significant growth-promoting effect on plant growth.
[0200] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.
Claims
1. A β-hydroxy dithiophosphate compound for use in plant disease resistance and antibacterial treatment and rice plant growth promotion, wherein the β-hydroxy dithiophosphate compound has a chemical structure as shown in Formula I or Formula II: ; ; In the formula I, R 1 It is one of p-CH3, p-Cl, p-F, p-Br, pt-Bu, p-Ph, and p-NO2; The plant pathogens that can be inhibited by the β-hydroxy dithiophosphate compound of the chemical structure represented by Formula I are rice sheath blight, rice blast, corn ear rot, corn leaf blight, tobacco wildfire, tobacco angular leaf spot, and rice bacterial leaf blight. The plant pathogens that can be inhibited by the β-hydroxy dithiophosphate compounds of the chemical structure represented by Formula II are rice sheath blight, rice blast, corn ear rot, peanut southern rot, tobacco syringa, and Chinese cabbage soft rot.
2. A pesticide formulation, characterized in that The β-hydroxy dithioate compound according to claim 1 has a chemical structure as shown in Formula I or Formula II. ; ; In the formula I, R 1 It is p-Ph.
Citation Information
Patent Citations
Preparation method of beta-hydroxy phosphorodithioate
CN116969991A