A mutant E2 protein of human papillomavirus type 16 and its application

Abstract

This invention provides a mutant human papillomavirus (HPV) type 16 E2 protein and its application. The mutant E2 protein is obtained by the following three mutations based on the wild-type HPV type 16 E2 protein: (1) the serine at position 317 of the wild-type HPV type 16 E2 protein is mutated to proline; (2) the threonine at position 17 of the wild-type HPV type 16 E2 protein is mutated to arginine, and the asparagine at position 55 is mutated to arginine; (3) the histidine at position 218 of the wild-type HPV type 16 E2 protein is mutated to proline. This invention obtains the target protein through amino acid mutation and codon optimization, resulting in a more stable protein structure that is more conducive to expression, thereby significantly improving the yield and preparation efficiency of the HPV type 16 E2 protein. This antigen can be used for the detection of HPV type 16 E2 antibodies or to evaluate the humoral immunogenicity of therapeutic vaccines targeting HPV type 16 E2.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to a mutant E2 protein of human papillomavirus type 16 and its applications. Background Technology

[0002] Human papillomavirus (HPV) is a small, non-enveloped DNA virus containing a double-stranded DNA genome. High-risk HPV types include 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, and 68, with types 16 and 18 being the two most common high-risk genotypes. Studies have shown that globally, types 16 and 18 can be detected in approximately 70% of cervical cancer patients.

[0003] The HPV genome encodes eight open reading frames (ORFs). Based on their function, the genome can be divided into three regions: the early protein-coding region (ER), which primarily encodes proteins E1, E2, E4, E5, E6, and E7; the late protein-coding region (LR), which encodes proteins L1 and L2; and the long terminal control region (LCR). E6 and E7 are considered the most important pathogenic genes of HPV. After HPV infects the host, the viral oncoprotein E6 binds to the body's p53 (a tumor suppressor gene), causing p53 to lose its normal function. This triggers DNA repair, apoptosis, or growth arrest in host cells, ultimately leading to abnormal cell development. Therefore, the E6 protein can be selected as a target antigen for HPV-related tumor therapeutic vaccines. The E2 protein, with its ability to regulate viral transcription, its induction of immune responses, its enhancement of antibody-dependent cell-mediated cytotoxicity (ADCC), and its cross-reactivity, plays a crucial role in HPV infection and the development of related tumors. In the early stages of viral infection and precancerous lesions, the expression level of E2 protein is significantly higher than that of E6 and E7 proteins. Furthermore, the development of tumor tissue exhibits significant heterogeneity across different regions. Vaccines designed targeting the E2 protein are expected to more effectively eliminate early-infected cells and early precancerous lesion cells, and may synergize with E6 and E7 proteins, thereby potentially significantly improving treatment efficacy, broadening clinical applications, and benefiting more patients.

[0004] Currently, several therapeutic vaccines targeting HPV16 / 18-related precancerous lesions or tumors have entered clinical trials both domestically and internationally. However, most of these vaccines target the E6 and E7 proteins, such as BioNTech's mRNA vaccine BNT113 and NykodeTherapeutics ASA's DNA vaccine VB10.1. Given the significant role of the E2 protein in carcinogenesis, the preparation of the HPV16 E2 protein and the establishment of a method for detecting the humoral immunogenicity of therapeutic vaccines targeting HPV16 E2 have strong application value. Summary of the Invention

[0005] The purpose of this invention is to provide a mutant human papillomavirus (HPV) type 16 E2 protein and its applications. A mutant HPV type 16 E2 protein was screened out. Through amino acid mutations (S317P, T17R, N55R, and H218P) and codon optimization of the HPV type 16 E2 protein, the expression and stability of the target protein were improved using an *E. coli* fermentation system, thereby significantly improving the preparation efficiency of the HPV type 16 E2 protein and obtaining a high-purity HPV type 16 E2 protein that retains its natural activity. This method is simple and inexpensive. The HPV type 16 E2 protein prepared using this method can be used as a coating antigen to establish an indirect ELISA method for evaluating the humoral immunogenicity of vaccines targeting HPV type 16 E2.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] In a first aspect of the present invention, a mutant human papillomavirus type 16 (HPV) E2 protein is provided, wherein the mutant HPV E2 protein is obtained by performing the following three mutations on the wild-type HPV E2 protein:

[0008] (1)S317P: The serine at position 317 of the wild-type HPV16 E2 protein is mutated to proline;

[0009] (2) T17R and N55R: The threonine at position 17 of the wild-type HPV16 E2 protein is mutated to arginine, and the asparagine at position 55 is mutated to arginine;

[0010] (3)H218P: The histidine at position 218 of the wild-type HPV16 E2 protein is mutated to proline.

[0011] Furthermore, the amino acid sequence of the human papillomavirus type 16 mutant E2 protein is shown in SEQ ID NO.1.

[0012] In a second aspect of the invention, a codon-optimized nucleic acid molecule encoding the human papillomavirus type 16 mutant E2 protein is provided.

[0013] Furthermore, the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO: 2.

[0014] In a third aspect of the invention, an expression vector for a human papillomavirus type 16 mutant E2 protein is provided, the expression vector comprising the nucleic acid molecule.

[0015] Furthermore, the expression vector can express the nucleic acid in prokaryotic or eukaryotic host cells. The vector can be a conventional vector; specifically, it can be a plasmid vector, a bacteriophage vector, or a viral vector.

[0016] In a fourth aspect of the present invention, a method for preparing a human papillomavirus type 16 mutant E2 protein expression vector is provided, wherein the nucleic acid molecule is constructed into a prokaryotic expression vector or a eukaryotic expression vector to obtain a human papillomavirus type 16 mutant E2 protein expression vector.

[0017] Further, the method includes:

[0018] An expression vector for the mutant E2 protein of human papillomavirus type 16 was obtained;

[0019] The expression vector of the human papillomavirus type 16 mutant E2 protein was transformed into Escherichia coli competent cells to obtain the engineered expression strain;

[0020] The expressed engineered bacteria were induced to express and purified to obtain human papillomavirus type 16 mutant E2 protein.

[0021] In a fifth aspect of the invention, a recombinant bacterium or engineered cell line comprising the expression vector is provided.

[0022] In a sixth aspect of the present invention, a method for preparing the human papillomavirus type 16 mutant E2 protein is provided, the method comprising: expressing and purifying the recombinant bacteria or engineered cell line in prokaryotes or eukaryotes to obtain the human papillomavirus type 16 mutant E2 protein.

[0023] In a seventh aspect of the invention, the use of human papillomavirus type 16 mutant E2 protein, or the said nucleic acid molecule, or the said recombinant vector, or the said recombinant bacteria or engineered cell line in the preparation of products for detecting HPV type 16 E2 antibodies or for evaluating the humoral immunogenicity of therapeutic vaccines targeting HPV type 16 E2 is provided.

[0024] In an eighth aspect of the present invention, an ELISA kit for detecting human papillomavirus type 16 E2 antibody is provided, the ELISA kit comprising: an ELISA plate coated with the human papillomavirus type 16 mutant E2 protein.

[0025] Further, the coating concentration of the human papillomavirus type 16 mutant E2 protein is 2-6 μg / mL (100 μL / well). Preferably, the coating concentration of the human papillomavirus type 16 mutant E2 protein is 4 μg / mL (100 μL / well).

[0026] Furthermore, the ELISA detection kit also includes:

[0027] Horseradish peroxidase-labeled enzyme-labeled secondary antibody;

[0028] Standard negative serum;

[0029] Standard positive serum;

[0030] Test reagents: coating solution, coating washing solution, diluent, washing solution, blocking solution, antibody diluent, colorimetric solution and stop solution.

[0031] In the above technical solution, the negative control serum is derived from SPF mice, and the positive serum is derived from SPF mice vaccinated with the immune-targeted human papillomavirus type 16 E2 vaccine; the enzyme-labeled secondary antibody is horseradish peroxidase-labeled rabbit anti-mouse IgG.

[0032] In a ninth aspect of the present invention, a method of using an ELISA detection kit employing the aforementioned human papillomavirus type 16 antibody is provided, the method comprising:

[0033] The human papillomavirus type 16 mutant E2 protein was diluted and added to an ELISA plate. After incubation at 4°C overnight, the plate was air-dried and then blocked with blocking buffer to obtain an ELISA plate coated with human papillomavirus type 16 mutant E2 protein.

[0034] The test serum, negative serum, and positive serum were added as primary antibodies to the wells of the ELISA plate coated with human papillomavirus type 16 mutant E2 protein and incubated. The liquid was discarded, and the plate was washed and dried. Horseradish peroxidase-labeled secondary antibody was added and incubated. The plate was then washed and dried.

[0035] Add the colorimetric solution and incubate at room temperature in the dark. Then add the stop solution to terminate the reaction. Measure the OD value at 450 nm wavelength using an ELISA reader.

[0036] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0037] 1. The human papillomavirus type 16 mutant E2 protein of the present invention has high expression level in the Escherichia coli expression system, good protein stability, and strong affinity, and can be used to detect human papillomavirus type 16 E2 antibody.

[0038] 2. The ELISA detection kit for human papillomavirus type 16 E2 antibody provided by the present invention can be used for the detection of human papillomavirus type 16 E2 antibody, and can also be used to evaluate the humoral immune efficacy of therapeutic vaccines targeting HPV type 16 E2. Attached Figure Description

[0039] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0040] Figure 1 SDS-PAGE electrophoresis image of HPV16 E2 protein expressed in E. coli expression system. Detailed Implementation

[0041] The present invention will be described in detail below with reference to specific embodiments and examples, thereby making the advantages and various effects of the present invention more clearly apparent. Those skilled in the art should understand that these specific embodiments and examples are for illustrative purposes only and are not intended to limit the present invention.

[0042] Throughout this specification, unless otherwise specified, the terminology used herein should be understood as having the meaning commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In the event of any conflict, this specification shall prevail.

[0043] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be obtained by purchasing them from the market or by existing methods.

[0044] This invention provides a mutant human papillomavirus type 16 E2 protein and its application. The overall concept is as follows:

[0045] Based on the prediction and analysis of the E2 protein structure using AlphaFold3 and DynaMut (DynaMut combines static (based on FoldX) and dynamic (based on ENCOM) analysis to predict the impact of mutations on protein structure and stability), and based on general protein structure design principles (introducing disulfide bonds, proline residues; constructing salt bridges; filling hydrophobic cavities, etc.), we designed the following mutation sites:

[0046] Table 1 Mutation site design

[0047]

[0048]

[0049] Replacing serine (S) at position 317 with proline (P) allows for charge interaction with R302 and Y303, forming a spatially stable structure. Mutations at T17R and N55R form salt bridges with surrounding K351 and K306, further enhancing overall structural stability. Additionally, the loop region is flexible; an H218P mutation at the active position strengthens steric repression to some extent. In summary, these mutations maintain overall structural stability, thereby improving protein expression efficiency and facilitating antibody binding.

[0050] The sequence encoding the E2 protein was further optimized using E. coli codon preference, and the nucleic acid sequence of E2 is shown in SEQ ID NO: 2. This sequence was inserted into a plasmid, which enabled soluble expression of the E2 protein through an E. coli expression system. The expressed protein could be purified by metal affinity chromatography to obtain a recombinant protein with high purity and activity.

[0051] The following will provide a detailed description of a human papillomavirus type 16 mutant E2 protein and its applications, in conjunction with embodiments and experimental data.

[0052] Example 1: Expression and purification of human papillomavirus type 16 mutant E2 protein

[0053] I. Materials:

[0054] 1. Types of bacteria

[0055] BL21 Escherichia coli

[0056] 2. Plasmid vector name

[0057] pET-32m3c: Purchased from Addgene, Catalog #196475.

[0058] 3. Name of protein purification column

[0059] Ni Sepharose (10280275, Cytiva)

[0060] 4. Instruments:

[0061] Table 2

[0062]

[0063]

[0064] 5. Consumables:

[0065] Table 3

[0066] reagents Item number factory <![CDATA[T4 DNA ligase]]> 9015-85-4 Takara Bio Engineering (Dalian) Co., Ltd. Restriction endonucleases NO.B600236 Sangon Biotech (Shanghai) Co., Ltd. PBS buffer powder (pH 7.3) ZLI-9061 Wuxi Aorui Dongyuan Biotechnology Co., Ltd. 1mL sterile insulin syringe 328421 BD Shurui 1.5mL nuclease-free centrifuge tube MCT-001-015 Lanjie Technology Co., Ltd. ELISA plate 504201 Wuxi Nice Life Science & Technology Co., Ltd. skim milk powder A600669-0250 Sangon Biotech (Shanghai) Co., Ltd. HRP-goat-anti-mouse IgG A0216 Biyuntian Biotechnology Co., Ltd. TMB Display Fluid P0209-500ml Biyuntian Biotechnology Co., Ltd. TMB color-stopping solution P0215-500ml Biyuntian Biotechnology Co., Ltd.

[0067] II. Construction of the carrier

[0068] 1. Amino acid sequence optimization

[0069] The sequence of the HPV16 E2 protein is derived from the E2 protein [Human papillomavirus 16]. Its sequence number on the UniProt protein database website is P03120, and its sequence number on the NCBI database is Gene ID: 1489080. Compared with the wild-type HPV16 E2 protein, we designed a four-amino acid mutation (S317P, T17R, N55R, H218P) and performed codon optimization to make the protein structure more stable and easier to express and purify. The amino acid sequence is shown in SEQ ID NO. 1.

[0070] Replacing serine (S) at position 317 with proline (P) allows for charge interaction with R302 and Y303, forming a spatially stable structure. Mutations at T17R and N55R form salt bridges with surrounding K351 and K306, further enhancing overall structural stability. Additionally, the loop region is flexible; the H218P mutation at the active position enhances steric repression to some extent. In summary, these mutations maintain overall structural stability, thereby improving protein expression efficiency and facilitating antibody binding.

[0071] 2. Construction of recombinant plasmids

[0072] A gene synthesis company was commissioned to synthesize the target gene (nucleotide sequence shown in SEQ ID NO.2) of the HPV16 E2 protein mutant, which had undergone codon preference optimization for E. coli. The target gene DNA fragment was then recombined into the BamHI and BglII restriction sites of the pET-32m3c plasmid vector. The primer pair sequences are as follows:

[0073] Table 4 Primer sequences for HPV16 E2 protein mutants

[0074] Group Sequence (5'-3') upstream primer CGGGATCCATGGAGACTTTGTGTCAAAGGTTAAAC(SEQ ID NO.3) Downstream primer GAAGATCTTATGGACATAAACCCAGTGGACAC(SEQ ID NO.4)

[0075] 3. Transformation

[0076] Add 1 μL of the above recombinant plasmid to 100 μL of BL21 competent cells; place on ice for 30 min, then heat shock at 42°C for 75 s, and immediately place on ice for 2 min. Then add 100 μL of antibiotic-free LB medium, incubate at 37°C for 30 min, spread the bacterial culture on plates, and incubate overnight at 37°C for 12–16 h for transformation.

[0077] III. Protein Expression and Purification

[0078] 1. Escherichia coli amplification culture

[0079] Single colonies were selected by plate spreading. BL21 single colonies transformed with the target plasmid were picked and cultured in 10 mL of LB medium containing ampicillin resistance for 7-8 hours with shaking. Then, they were transferred to Erlenmeyer flasks containing 1 L of LB medium and cultured at 37°C and 250 rpm for 4-6 hours with shaking. The final concentration of ampicillin was 50 μg / mL.

[0080] 2. Fermentation preparation of target protein

[0081] Detect the OD value of the bacterial culture in the conical flask. When the OD concentration of the bacterial culture reaches 0.6-0.8, lower the temperature of the shaker to 16℃. After cooling for 20 min, add the inducer IPTG (isopropyl β-D-Thiogalactoside) to a final concentration of 200 μM. Induce protein expression at low temperature for 18-22 hours, with 21 hours being optimal. Collect the bacterial culture and centrifuge at 4000 rpm for 15 min at room temperature to obtain precipitated bacteria. Discard the supernatant and resuspend the bacterial cells in binding buffer. Use 45 mL of binding buffer per 1 L of bacterial culture for resuspending. After resuspending, the cells can be stored at -20℃ for long-term storage or immediately lysed.

[0082] 3. Cell lysis and protein purification

[0083] Collect the bacterial cells, repeatedly shake to resuspend them evenly, and use a high-pressure homogenizer to lyse the cells at low temperature: 4°C, 650-750 bar, 3 min. After complete cell lysis, centrifuge at 18000 rpm, 4°C, for 30 min, collect the supernatant, and then perform nickel column affinity chromatography to purify the protein. Pack new nickel column beads (Ni Sepharose) into a specially designed 50 mL glass column, wash the nickel column twice with ddH2O, and equilibrate the nickel column with one column volume of binding buffer.

[0084] Before use, purge the nickel column and add the supernatant collected after high-speed centrifugation to the nickel column, allowing it to bind with the nickel beads for at least 30 minutes, stirring every 10 minutes to ensure sufficient contact between the protein and the nickel beads and to allow the supernatant to flow through the nickel column. Take a sample of the supernatant. Wash the nickel column directly with one column volume of washing buffer to remove non-specifically bound proteins, and take a sample of the flow-through. Add 15 mL of elution buffer to the nickel column, allowing it to contact the nickel beads for 30 minutes, elute and collect the target protein, and take a sample for subsequent identification.

[0085] 4. Dialysis

[0086] Boil a dialysis bag (cellophane) of appropriate size and length in ddH2O for 10 minutes. Seal the bottom of the dialysis bag to ensure there is no leakage, then pour in the target protein solution purified and eluted by a nickel column. Seal the top and place the bag in a 2L beaker containing a GB buffer. Stir at low speed at 4°C for 24 hours. Open the dialysis bag, pour out the target protein, and filter it through a 0.22μm filter membrane to remove the precipitated flocculent protein, obtaining the desired target protein. The purified protein sample is identified and its purity is evaluated by SDS-PAGE electrophoresis.

[0087] Table 5. Formulations of protein purification-related buffers

[0088] Buffer imidazole NaCl Tris EDTA DTT pH Binding Buffer 5mM 490mM 20mM \ \ 7.5 Washing Buffer 60mM 500mM 20mM \ \ 7.6 Elution Buffer 1M 500mM 20mM \ \ 7.8 GB Buffer \ 100mM 50mM 1mM 1mM 7.8

[0089] Next, protein yield and purity were tested, as detailed in Experiment Example 1 below.

[0090] Comparative Example 1: Expression and purification of native E2 protein

[0091] The DNA of the comparative natural E2 protein (Gene ID: 1489080 in the NCBI database) was synthesized by a bioengineering company. Its amino acid sequence is shown in SEQ ID NO.7, and its nucleic acid sequence is shown in SEQ ID NO.8. The DNA fragment was then recombined into the BamHI and BglII restriction sites of the pET-32m3c plasmid vector. Specifically, it was obtained by PCR using the FPrimer and RPrimer primer pairs followed by enzyme digestion and ligation. The primer pair sequences are as follows:

[0092] Table 6 Primer sequences for wild-type HPV16 E2

[0093] Group Sequence (5'-3') upstream primer CGGGATCCATGGAAACCCTCTGTCAGCGATT(SEQ ID NO.5) Downstream primer CTCGAGGATCGACATGAAGCCCGTGGAAAC(SEQ ID NO.6)

[0094] Experiment 1: Protein Yield and Purity Detection

[0095] 1. Protein quantification detection

[0096] The protein yields of Example 1 and Comparative Example 1 were determined using gel chromatography. The concentrations of the two proteins (3 batches) are shown in Table 7.

[0097] Table 7. Yield of target protein in each batch of fermentation.

[0098]

[0099] Protein quantification results showed that the yield of natural E2 protein (amino acid sequence as shown in SEQ ID NO.3) in the three batches of Comparative Example 1 was 2.7±0.65 mg / L, while the yield of mutant E2 protein (amino acid sequence as shown in SEQ ID NO.1) in Example 1 of this invention was 5.9±1.0 mg / L, which was significantly higher than that of natural protein (p<0.05, t test).

[0100] 2. Protein purity detection

[0101] The purified protein samples in Example 1 and Comparative Example 1 were analyzed by SDS-PAGE electrophoresis to determine the molecular weight and purity of the proteins. The results are as follows: Figure 1 As shown, the molecular weight of the three batches of E2 protein mutants was around 45KD, which is in line with expectations. The protein concentration was significantly higher than that of wild-type protein, and the purity of the purified protein was over 90%, making them suitable as coating proteins for ELISA kits.

[0102] The above results show that the expression level of the mutant E2 protein in Example 1 is significantly higher than that of the wild-type E2 protein in Comparative Example 1, indicating that the human papillomavirus type 16 mutant E2 protein of the present invention has high stability in expression in Escherichia coli and is not easily degraded, while the optimization of the codon further improves the expression level.

[0103] Example 2: Serum Human Papillomavirus Type 16 E2 Antibody ELISA Detection Kit and its Preparation Method

[0104] I. Serum Human Papillomavirus Type 16 E2 Antibody ELISA Detection Kit

[0105] The ELISA detection kit includes:

[0106] HPV16 E2 protein prepared in Example 1: coating concentration of 2-8 μg / mL, 100 μL well, preferably 4 μg / mL, 100 μL / well;

[0107] Horseradish peroxidase-labeled enzyme-labeled secondary antibody;

[0108] Standard negative serum;

[0109] Standard positive serum;

[0110] Test reagents: coating solution, coating washing solution, diluent, washing solution, blocking solution, antibody diluent, colorimetric solution and stop solution.

[0111] It should be noted that the human papillomavirus type 16 mutant E2 protein provided by this invention can be used to prepare ELISA kits, and can also be used to prepare various forms of products such as immunogold test strips, immunofluorescence, immunoturbidimetry, and chemiluminescence.

[0112] II. Procedure for Using the Serum Human Papillomavirus Type 16 E2 Antibody ELISA Kit

[0113] Purified HPV16 E2 protein was coated onto ELISA plates at concentrations of 2 μg / mL, 4 μg / mL, 6 μg / mL, and 5% skim milk blocking buffer. After blocking with vaccine-immunized mouse serum and horseradish peroxidase-conjugated rabbit anti-mouse IgG antibody, the plates were then tested. The target antigen of the vaccine is HPV16 E2 protein. The optimal coating concentration was determined using standard positive serum titration (see Table 9).

[0114] 1. Mouse immunization

[0115] Five female C57BL / 6J mice aged 6-8 weeks were selected as the experimental group. Each mouse was immunized with 10 μg of vaccine, with an injection volume of 50 μL per mouse. 50 μL of vaccine was drawn up using a 1 mL disposable sterile insulin syringe and injected into the hind thigh muscle. Mice were vaccinated twice, with a second booster immunization given 14 days after the first. The negative control group received sterile 1×PBS intramuscular injection, with 5 mice receiving 50 μL per mouse.

[0116] 2. Mouse serum collection

[0117] After immunization, the mice were observed for their condition and weight. Blood was collected 14 days after the second immunization. After standing at room temperature for 3 hours, the whole blood of the mice was centrifuged at 3000 rpm for 15 minutes at room temperature. The supernatant serum was carefully aspirated with a pipette and transferred to a 1.5 mL sterile centrifuge tube. The serum was then inactivated by incubating in a 56 °C water bath for 30 minutes before use.

[0118] 3. ELISA detection of antibody titers in serum

[0119] (1) Enzyme-labeled plate coating: Take HPV16 E2 protein, dilute it to 4 μg / mL, add 100 μL / well to the enzyme-labeled plate, and coat overnight at 4℃ (16-20 h). Discard the coating solution, add 300 μL washing buffer to each well, wash the plate 4 times, and then add 200 μL blocking buffer / well, and block at room temperature in the dark for 2 h.

[0120] (2) Serum dilution: The serum was serially diluted according to Table 4 using diluent. The negative serum was the serum of mice injected with PBS. 5 μL of each was mixed together to form a negative mixed serum for later use. Then, 5 μL of the negative mixed serum was diluted 1000 times with 4995 μL of diluent.

[0121] Table 8 Serum graded dilution

[0122]

[0123]

[0124] (3) Sample addition and incubation: After blocking, add 100 μL / well of diluted test serum (S1-S8), negative mixed serum, positive control serum, and blank control. All samples are replicates. Incubate at room temperature for 1 h. Add 300 μL of washing buffer to each well and wash the plate 4 times consecutively, allowing it to stand for 1 min each time, and then pat dry.

[0125] (4) Secondary antibody incubation: Dilute the secondary antibody HRP-goat-anti-mouse IgG 1000 times with dilution buffer, mix well and add 100 μL / well to the ELISA plate, incubate at room temperature for 1 h. Add 300 μL washing buffer to each well and wash the plate 4 times consecutively, letting it stand for 1 min each time, and then pat dry.

[0126] (5) Color development termination: Add 100 μL of TMB color development solution to each well and place at room temperature in the dark for 8–15 min (the termination time is determined according to the color development). Add 50 μL of termination solution directly to each well to terminate the reaction.

[0127] (6) Reading: The absorbance at OD 450nm was detected by an ELISA reader. The average OD of the blank control and negative serum should not be higher than 0.1. The cut-off value was calculated based on the average OD of the negative serum. When the average OD of the negative serum was not higher than 0.05, it was calculated as 0.05. The comparison results of HPV16 E2 protein coating concentration are shown in Table 9, and the reading results of different samples are shown in Table 10.

[0128] Table 9 Comparison of HPV16 E2 protein coating concentration

[0129]

[0130] Based on the results in Table 9, the optimal coating concentration was determined to be 4 μg / mL.

[0131] Table 10 shows the OD values ​​of serum ELISA results from the experimental group of mice.

[0132]

[0133] Cut-off value = average OD of negative serum × 2.1. A positive result is defined as a serum with an average OD higher than the cut-off value. The highest dilution at which a positive result is determined is the serum titer. Geometric mean titer analysis was performed on the serum titers of the experimental group mice, and the GMT value was calculated using the GEOMEAN function. The results are shown in Table 11.

[0134] Table 11 Serum titers and GMT values ​​of mice in the experimental group

[0135]

[0136] The data in Table 11 shows that:

[0137] The serum E2 protein titers against HPV16 in 5 mice ranged from 1600 to 6400, with a GMT value of 3200. All 5 mice were considered positive (5 / 5). The kit was used to test 5 immunized mouse serum samples, and all results were positive, indicating that the kit has good accuracy.

[0138] The above experimental results show that the ELISA detection kit for detecting human papillomavirus type 16 E2 antibodies provided in this embodiment of the invention has good accuracy and can be used to detect the antibody level of human papillomavirus type 16 E2 protein.

[0139] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

[0140] Finally, it should be noted that the terms “comprising,” “including,” or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.

[0141] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of the invention.

[0142] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. A mutant E2 protein of human papillomavirus type 16, characterized in that, The human papillomavirus type 16 mutant E2 protein was obtained by the following three mutation methods based on the wild-type HPV E2 protein: (1) S317P: The serine at position 317 of the wild-type HPV16 E2 protein is mutated to proline; (2) T17R and N55R: The threonine at position 17 of the wild-type HPV16 E2 protein is mutated to arginine, and the asparagine at position 55 is mutated to arginine; (3) H218P: The histidine at position 218 of the wild-type HPV16 E2 protein is mutated to proline; The amino acid sequence of the human papillomavirus type 16 mutant E2 protein is shown in SEQ ID NO.

1.

2. A nucleic acid molecule encoding the human papillomavirus type 16 mutant E2 protein of claim 1.

3. The nucleic acid molecule according to claim 2, characterized in that, The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO:

2.

4. An expression vector for a mutant human papillomavirus type 16 E2 protein, characterized in that, The expression vector comprises the nucleic acid molecule as described in any one of claims 2-3.

5. A recombinant bacterium or engineered cell line comprising the expression vector of claim 4.

6. A method for preparing the human papillomavirus type 16 mutant E2 protein according to claim 1, characterized in that, The method includes: expressing and purifying the recombinant bacteria or engineered cell line described in claim 5 in prokaryotes or eukaryotes to obtain human papillomavirus type 16 mutant E2 protein.

7. The use of the human papillomavirus type 16 mutant E2 protein of claim 1, or any of the nucleic acid molecules of claims 2-3, or the expression vector of claim 4, or the recombinant bacteria or engineered cell line of claim 5 in the preparation of products for detecting HPV type 16 E2 antibodies or for evaluating the humoral immunogenicity of therapeutic vaccines targeting HPV type 16 E2.

8. An ELISA detection kit for human papillomavirus type 16 (HPV) E2 antibody, characterized in that, The ELISA detection kit comprises an ELISA plate coated with the human papillomavirus type 16 mutant E2 protein as described in claim 1.

9. The ELISA kit for detecting human papillomavirus type 16 E2 antibody according to claim 8, characterized in that, The coating amount of the human papillomavirus type 18 mutant E6 protein is 2-6 μg / well.

Images