Recombinant human XVII type collagen as well as preparation method and application thereof

Abstract

The invention discloses recombinant human XVII type collagen as well as a preparation method and application thereof. The recombinant human XVII type collagen is obtained by repeating an amino acid sequence from natural human XVII type collagen. The amino acid sequence of the recombinant human XVII type collagen is derived from natural human XVII type collagen, and the recombinant human XVII type collagen does not generate adverse immune response when being used for a human body. The recombinant human XVII type collagen can be secreted and expressed in a commercial yeast expression system, the expression quantity is greater than 10g / L, the preparation method is simple, and the high-yield recombinant human XVII type collagen can be obtained at low cost; in addition, the cell adhesion promoting activity of the recombinant human XVII type collagen is obviously superior to that of human collagen.

Description

Technical Field

[0001] The present invention belongs to the technical field of synthetic biology, and relates to a recombinant human type XVII collagen with high yield and good cell adhesion promoting activity, and a preparation method and application thereof. Background Art

[0002] Collagen XVII (COL17) is a transmembrane protein that mediates skin homeostasis. COL17 relies on the conserved GXY repeat sequence to assemble into a triple helical structure, where X and Y are mainly proline and hydroxyproline residues. The biological activity of COL17 is supported by functional domains, such as collagen domains, which are associated with hemichromosomes and extracellular matrix proteins to maintain skin health. It is challenging to use microorganisms to biosynthesize full-length collagen because the full-length molecule is insoluble. Therefore, how to obtain recombinant human type XVII collagen with good biological activity and easy expression has always been a concern for technicians. Summary of the invention

[0003] In view of the technical problems existing in the above-mentioned prior art, the object of the present invention is to provide a recombinant human type XVII collagen that can be expressed in high yield in a commercial Pichia pastoris expression system and has good cell adhesion promoting activity.

[0004] The technical solution of the present invention includes:

[0005] 1. A polypeptide or recombinant human type XVII collagen, which is obtained by repeating the amino acid sequence of any one of SEQ ID No. 1 to 6 n times, wherein n is an integer greater than or equal to 1.

[0006] 2. The polypeptide or recombinant human type XVII collagen according to item 1, wherein n is an integer greater than or equal to 6.

[0007] 3. The polypeptide or recombinant human type XVII collagen according to item 1, wherein n is an integer less than or equal to 20.

[0008] 4. The polypeptide or recombinant human type XVII collagen according to item 1, wherein n is an integer less than or equal to 15. For example, n may be 13.

[0009] 5. A polynucleotide encoding the polypeptide or recombinant collagen described in item 1.

[0010] 6. An expression vector comprising the polynucleotide described in item 5. The expression vector may be a Ppic9k vector, a Ppic3.5k vector, a pGAPZaA vector, a PpicZaA vector, a shuttle vector, etc.; preferably, the expression vector is a PpicZaA vector.

[0011] 7. A host cell into which the expression vector according to item 6 has been introduced. The host cell may be, for example, a prokaryotic cell, a yeast or a eukaryotic cell. Preferably, the host cell is Pichia pastoris X-33.

[0012] 8. A method for producing the recombinant human type XVII collagen described in item 1, comprising: culturing the host cell described in item 4 to express the recombinant human type XVII collagen, and collecting the cell culture.

[0013] 9. A product comprising the recombinant human type XVII collagen according to item 1. The product may be, for example, a cosmetic, a medicine, a health product or a medical device.

[0014] 10. Use of the recombinant human type XVII collagen described in item 1 in the preparation of cosmetics, medicines, health products or medical devices.

[0015] Effects of the Invention

[0016] The present invention provides a recombinant human type XVII collagen obtained by repeating an amino acid sequence from natural human type XVII collagen and a preparation method thereof. The amino acid sequence of the recombinant human type XVII collagen is derived from natural human type XVII collagen and will not produce adverse immune responses when used in the human body. The recombinant human type XVII collagen can be secreted and expressed in a commercial yeast expression system with an expression amount greater than 10 g / L. The preparation method is simple and a high yield of recombinant human type XVII collagen can be obtained at a low cost; moreover, the cell adhesion promoting activity of the recombinant human type XVII collagen is significantly better than that of human collagen. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is the electrophoresis result of recombinant human type XVII collagen. DETAILED DESCRIPTION

[0018] The present invention is described in detail below in conjunction with specific embodiments. In the absence of conflict, the scientific terms in this specification have the meanings commonly understood by those skilled in the art. If there is a conflict, the definitions in this specification shall prevail.

[0019] Example 1: Construction and expression of recombinant human type XVII collagen

[0020] 1. Construction of recombinant human type XVII collagen bacteria

[0021] (1) Construction of recombinant plasmid

[0022] According to the amino acid sequence of recombinant human type XVII collagen C1R6, the codons of the yeast expression system were optimized to obtain the target gene sequence. The target gene sequence was commissioned to Qingke Biotechnology Co., Ltd. for gene synthesis. The synthesized gene was connected to the pPicZαA plasmid to obtain the pPicZαA-XVII plasmid.

[0023] The amino acid sequence of recombinant human type XVII collagen C1R6 is obtained by repeating the amino acid sequence of C1 polypeptide (GPPGQKGEMGTPGPKGDRGPAGPPGHPGPPGPRGHKGEKGDKGDQ, SEQ ID No.6) six times, and its encoding nucleotide sequence is shown in SEQ ID No.7.

[0024] SEQ ID No.7

[0025] GGACCACCAGGACAGAAAGGAGAGATGGGTACCCCTGGACCAAAAG

[0026] GAGACCGTGGTCCAGCAGGTCCTCCAGGTCACCCAGGCCCTCCAGGT

[0027] CCTAGAGGACATAAGGGAGAGAAAGGCGATAAGGGTGACCAAGGAC

[0028] CTCCCGGTCAGAAGGGTGAAATGGGAACTCCCGGTCCAAAGGGAGAT

[0029] CGTGGTCCTGCTGGACCTCCCGGTCATCCTGGACCCCCAGGCCCTCGT

[0030] GGTCATAAGGGAGAAAAAGGTGACAAAGGCGATCAGGGTCCTCCTG

[0031] GTCAGAAAGGCGAAATGGGTACTCCAGGCCCTAAAGGAGACAGAGG

[0032] TCCCGCAGGTCCACCTGGTCACCCAGGACCACCAGGTCCCCGTGGTC

[0033] ACAAGGGTGAAAAAGGTGATAAGGGTGACCAAGGTCCACCTGGTCA

[0034] GAAAGGAGAAATGGGTACGCCTGGTCCAAAAGGTGATAGAGGTCCTG

[0035] CAGGACCCCCAGGTCATCCCGGACCTCCTGGTCCTCGTGGTCACAAG

[0036] GGCGAGAAAGGAGACAAAGGCGACCAGGGTCCCCCAGGTCAGAAGG

[0037] GCGAAATGGGCACTCCAGGACCTAAAGGCGATAGAGGACCAGCAGG

[0038] TCCACCCGGCCATCCTGGTCCACCAGGTCCTAGAGGACACAAGGGAG

[0039] AAAAGGGAGATAAAGGTGATCAGGGCCCTCCCGGACAGAAAGGTGA

[0040] GATGGGAACTCCTGGACCAAAGGGTGACAGAGGACCTGCAGGACCT

[0041] CCTGGCCATCCTGGTCCTCCTGGACCTAGAGGACATAAGGGTGAGAA

[0042] GGGTGACAAGGGCGACCAG

[0043] (2) Construction of yeast expression strain

[0044] pPicZαA-XVII was linearized with Pme I and then transformed into Pichia pastoris X-33 competent cells. Bleomycin resistance was used as a selection marker to screen transformants to obtain a yeast expression strain.

[0045] 2. Induced expression of target protein

[0046] 1) Pick a single colony of the constructed yeast expression strain and add it to 5 ml YPD liquid medium (1% yeast extract, 2% peptone and 2% glucose), and culture it at 30°C, 200 rpm for 48 h for activation;

[0047] 2) Transfer the inoculum to a 500 ml Erlenmeyer flask (containing 200 ml of YPD culture medium) at 1% of the inoculum, and culture at 30°C, 200 rpm for 24 hours as the seed for the upper tank;

[0048] 3) Prepare 3 L of BSM medium and add it to a 5 L fermenter, sterilize at 121° C. for 20 min, cool to 30° C., adjust the pH to 5.0, and add the seeds prepared in (2) to the fermenter by flame inoculation for fermentation;

[0049] 4) When the OD600 reaches 70, 50% glycerol is added, and when the OD600 reaches about 120, the addition is stopped. When the dissolved oxygen rebounds to 100%, methanol is added for induction. During the induction process, the dissolved oxygen is controlled to be not less than 30%, and the pH is about 5.0. The induction is carried out for 40 hours, and the fermentation is terminated. The culture medium is centrifuged at 12000 rpm for 2 minutes, and the supernatant is taken to obtain the recombinant human type XVII collagen C1R6.

[0050] 5) Prepare buffer: 20mM / L potassium phosphate buffer (liquid A, pH 6.0), and use 20mM / L potassium phosphate buffer + 1mol / L Nacl (liquid B, pH 6.0) as the eluent. The collected supernatant is adjusted to pH and filtered before loading on a hydrophobic cation exchange chromatography column. Before loading, the column is equilibrated with liquid A, washed with 20% liquid B after loading, and finally eluted with liquid B. The eluted protein is the purified target protein. The protein expression is verified by SDS-PAGE.

[0051] The following recombinant human type XVII collagens were expressed using the same method as above, and the protein expression levels were verified using the SDS-PAGE method.

[0052] The amino acid sequence of recombinant human type XVII collagen C14R6 was obtained by repeating the amino acid sequence of C14 polypeptide (GPPGPPGAMGPPGPPGAPGPAGPAGLPGHQ, SEQ ID No. 1) 6 times.

[0053] The amino acid sequence of recombinant human type XVII collagen C13R6 was obtained by repeating the amino acid sequence of C13 polypeptide (GPPGPPGPRGPPGPSIPGPPGPRGPPGEGLPGPPGPPGSF, SEQ ID No. 2) 6 times.

[0054] The amino acid sequence of recombinant human type XVII collagen C12R6 was obtained by repeating the amino acid sequence of C12 polypeptide (GPPGPPGPPGPKGDQGPPGPRGHQGEQGLPGFS, SEQ ID No. 3) 6 times.

[0055] The amino acid sequence of recombinant human type XVII collagen C11R6 was obtained by repeating the amino acid sequence of C11 polypeptide (GPPGPPGPQGPKGDKGDPGVPGALGIP, SEQ ID No. 4) 6 times.

[0056] The amino acid sequence of recombinant human type XVII collagen C3R6 was obtained by repeating the amino acid sequence of C3 polypeptide (GGAGSLGAGGAFGEAAGDRGPYGTDIGPGGGYGAAAEGGMYAGNGG LLGAD, SEQ ID No. 5) 6 times.

[0057] The protein expression verification results showed that C14R6, C13R6, and C11R6 proteins were not expressed, while C12R6, C3R6, and C1R6 proteins were successfully expressed, and the protein expression levels were: C1R6>C3R6>C12R6. The SDS-PAGE electrophoresis results were as follows Figure 1 The expression results are shown in Table 1.

[0058] Table 1 Different amino acid sequences and expression results

[0059]

[0060] Example 2: Determination of the cell adhesion promoting activity of recombinant human type XVII collagen

[0061] Normally culture HSF (human skin fibroblast) cells, take C1R6, C12R6, C3R6 collagen purified lyophilized products, and the control substance is natural human collagen (purchased from Sigma, product number C7774) (commercially available, obtained by extraction method), prepared with PBS solution to 0.25 mg / L, 0.5 mg / L, 1 mg / L, respectively, act on HSF (human skin fibroblast) cells to promote cell adhesion experiment. The specific steps are as follows: human HSF cells were inoculated in a sterile 96-well plate, with 200 μL of culture medium in each well, and only PBS was added to the blank control group. After being placed at 37°C for 2 hours, each group was washed 3 times with PBS to wash away the non-adherent cells, 100 μL of culture medium and 50 μL of MTT solution were added to each well, shaken well, placed in an incubator for incubation for 4 hours, then the mixture was aspirated, 150 μL of DMSO was added to dissolve the purple crystal formazan, shaken for 10 minutes, placed in an enzyme reader, and the detection wavelength was 570 nm to measure the absorbance value of each well.

[0062] Cell adhesion promotion rate = (OD of experimental group - OD of blank group) × 100% / blank group.

[0063] The results are shown in Table 2, which shows that the recombinant human type XVII collagen C1R6 and C3R6 have better cell adhesion activity than commercial natural human collagen, and the cell adhesion activity is: C1R6>C12R6>C3R6.

[0064] Table 2 Cell adhesion promoting effect of different concentrations of recombinant collagen on skin fibroblasts

[0065]

[0066] Example 3: Preparation of C1R1 polypeptide and C1R13 recombinant human type XVII collagen and determination of cell adhesion promoting activity

[0067] The C1R1 polypeptide (SEQ ID No. 6) was commissioned to be synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0068] C1R13 recombinant human type XVII collagen (obtained by repeating the amino acid sequence of SEQ ID No. 6 13 times) was obtained with reference to Example 1.

[0069] The cell adhesion promoting activity of the above C1R1 polypeptide and C1R13 recombinant human type XVII collagen was measured by referring to the method of Example 2. The results are shown in Table 3. It can be seen that both have good cell adhesion promoting activity.

[0070] Table 3 Cell adhesion promoting effect of different concentrations of recombinant collagen on skin fibroblasts

[0071]

Claims

1. A polypeptide or recombinant human type XVII collagen, which is obtained by repeating the amino acid sequence of SEQ ID No. 6 n times, wherein: n is an integer greater than or equal to 1.

2. The polypeptide or recombinant human type XVII collagen according to claim 1, wherein The n is an integer greater than or equal to 6.

3. The polypeptide or recombinant human type XVII collagen according to claim 1, wherein The n is an integer less than or equal to 20.

4. The polypeptide or recombinant human type XVII collagen according to claim 1, wherein The n is an integer less than or equal to 15; the n may be 13, for example.

5. A polynucleotide encoding the polypeptide or recombinant collagen according to claim 1.

6. An expression vector comprising the polynucleotide of claim 5.

7. A host cell into which the expression vector according to claim 6 has been introduced; the host cell may be, for example, a prokaryotic cell, a yeast or a eukaryotic cell; preferably, the host cell is Pichia pastoris X-33.

8. A method for producing the recombinant human type XVII collagen according to claim 1, comprising: The step of culturing the host cell according to claim 4 to express the recombinant human type XVII collagen, and collecting the cell culture.

9. A product comprising the recombinant human type XVII collagen according to claim 1; the product may be, for example, a cosmetic, a medicine, a health product or a medical device.

10. Use of the recombinant human type XVII collagen according to claim 1 in the preparation of cosmetics, medicines, health products or medical devices.

Images