Neurospora crassa and application thereof

Abstract

The invention relates to the technical field of microorganisms, in particular to Neurospora crassa and application of the Neurospora crassa. The Neurospora crassa provided by the invention is any one of the following A1) to A4): A1), a strain with an ITS sequence and a sequence as shown in SEQ ID NO: 3 having at least 98% of identity; the invention discloses Neurospora crassa MN146427, which is preserved in the Guangdong Microbial Culture Collection Center with the preservation number of GDMCC No.65442, and the Neurospora crassa MN146427 is preserved in the Guangdong Microbial Culture Collection Center with the preservation number of GDMCC No.65442. A3) a strain having at least 98.65% identity with the ITS sequence of the strain in A2); a4), wherein the average nucleotide consistency of the genome of the strain is at least 98% with that of the genome of any one of the strains (A1) to (A3); the mycelium protein of neurospora crassa has the advantages of high protein, high dietary fiber, low cholesterol and a proper amount of unsaturated fatty acid, is rich in ergothioneine, and is simple in production process, low in cost and suitable for industrial production.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to Neurospora crassa and uses thereof. Background Art

[0002] Animal meat is rich in high-quality protein, essential vitamins and minerals, and other nutrients, and plays an important role in the human diet. However, despite the above advantages of animal meat, it also contains high levels of cholesterol and unsaturated fatty acids. Long-term intake of high cholesterol and unsaturated fatty acids may have adverse effects on human health. For example, high cholesterol can easily cause fatty liver, hyperlipidemia, hypertension, atherosclerosis, cerebral infarction and other diseases. Although foods with high levels of unsaturated fatty acids are good for health, excessive intake may increase the risk of cardiovascular disease. Therefore, it is very meaningful to seek a meat substitute protein that contains low cholesterol, moderate amounts of unsaturated fatty acids, and is rich in nutrients needed by humans (such as dietary fiber, trace elements, amino acids, etc.).

[0003] As a new type of protein resource, microbial protein is rich in nutrients, with high protein content in the bacteria, complete amino acid components, especially high essential amino acid content. It is also rich in carbohydrates, vitamins and minerals. Its production is not affected by external conditions such as climate, and its output rate is high. Based on this, the processing of microbial protein into food has become a new research hotspot, among which imitation meat products using microbial protein as raw materials are increasingly attracting the attention of R&D personnel and consumers.

[0004] Neurospora crassa is a fungus of the phylum Ascomycoya, class Ascomycetes, order Sordariales, family Sordariaceae, and genus Neurospora. The mycelium of the crassa Neurospora is rich in protein, and there are related documents that disclose the use of mycelium of crassa Neurospora to prepare meat substitute protein. However, the document does not study other nutrients in the mycelium of the crassa Neurospora, and has not yet developed a mycelial protein of crassa Neurospora that simultaneously satisfies high protein, high dietary fiber, low cholesterol, and an appropriate amount of unsaturated fatty acids, which may be difficult to meet the nutritional and health needs of humans as a meat substitute protein product. In addition, the strain culture pH is acidic, which limits the nitrogen source used, and due to the low culture pH, it is difficult to use alkaline nitrogen sources such as ammonia water to supplement during the culture period, and the production process is complicated.

[0005] Ergothioneine (mercaptohistidine trimethyl salt, ergothioneine, EGT) is a thiol compound with a chemical name of 2-thioimidazole amino acid, and its left-handed structure has good physiological activity. Ergothioneine has two isomeric forms, thiol and thiol, and mainly exists in the form of thiol in aqueous solution. Ergothioneine plays an important role in human cells and tissues, which is mainly reflected in the following aspects: 1. Ergothioneine has excellent antioxidant properties and stability, can remove cell active oxygen, resist oxidative damage and maintain redox balance; 2. Ergothioneine has the potential to prevent and treat diseases such as cancer, cardiovascular disease, cognitive dysfunction caused by oxidative stress; 3. Ergothioneine also has the effect of improving sleep disorders, improving intestinal health, and resisting ultraviolet damage and photoaging. Due to these characteristics of ergothioneine, it is determined that it has a wide range of uses and market prospects in the fields of medicine, food and beverage, functional food, animal feed, cosmetics and biotechnology. Ergothioneine was originally isolated from the ergot fungus of rye in the Poaceae family. Mycobacteria, Methylobacterium, cyanobacteria and mushrooms can all synthesize ergothioneine naturally. Ergothioneine has been shown to be present in almost all human cells and tissues, usually in the brain, bone marrow, lens and cornea of ​​the eye, and red blood cells at millimolar levels, but the human body itself cannot synthesize ergothioneine and can usually only be taken in and supplemented from food. However, there is no relevant literature publicly using Neurospora crassa to produce high-yield ergothioneine. Summary of the invention

[0006] Therefore, the technical problem to be solved in the present invention is to provide a kind of Neurospora crassa (Neurospora crassa) and its use, the mycelial protein of the Neurospora crassa simultaneously satisfies the advantages of high protein, high dietary fiber, low cholesterol, and an amount of unsaturated fatty acids, and is rich in ergothioneine, and the production process is simple, low cost, and can be applicable to industrialized production.

[0007] To this end, the present invention provides the following technical solutions:

[0008] The embodiment of the present invention discloses a Neurospora crassa, which is any one of the following A1) to A4):

[0009] A1), a strain whose ITS sequence is at least 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99% or 100% identical to the sequence shown in SEQ ID NO: 3;

[0010] A2), Neurospora crassa MN146427, deposited in Guangdong Microbiological Culture Collection Center, with the deposit number of GDMCC No.65442;

[0011] A3) a strain having at least 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99% or 100% identity with the ITS sequence of the strain described in A2);

[0012] A4), a strain whose genome has an average nucleotide identity of at least 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99% or 100% with the genome of any of the strains described in A1) to A3).

[0013] As used herein, "identity" with respect to nucleic acid sequences refers to the extent to which the two nucleic acid sequences have identical nucleotide residues at the same position when the two nucleic acid sequences are aligned to achieve the maximum level of identity, expressed as a percentage. Wherein, the "identity" between the sequences of two nucleic acid molecules can be determined using a known computer algorithm, such as at least one of the GCG program package, BLASTN or FASTA, and other commercial or publicly available programs may also be, for example, DNAStar-"MegAlign" program.

[0014] In addition, with the rapid development of second-generation and third-generation sequencing technologies, strain identification based on whole genome sequencing has become possible, which also makes the strain identification results more accurate. The average nucleotide identity (ANI) of bacterial genomes refers to the similarity of homologous genes between two bacterial genomes. At present, there are various mature ANI value calculation tools, such as local calculation software Jspecies ( / jspecies) and Gegenees ( / documentation.html), online calculation tools ANI caculator (http: / enveomics.gatech.edu / ), EzGenome ( / ezgenome / ani) and ANItools, etc. Therefore, the ANI value of the isolated strain and MN146427 can be calculated by any of the above local calculation software or online calculation tools or other tools or methods known in the art.

[0015] The culture characteristics of the rough Neurospora MN146427 are that after 4 days of MEA plate culture, the colony diameter is 3.8 cm. The colony is initially powdery and granular, and then becomes fluffy, pink to light orange, with loose mycelium and spreading septa all around. The conidia are spherical, smooth, with spore septa, in chains, and aggregated into clumps. The surface of the substrate is white, and the substrate becomes orange-yellow after being left for a long time. Morphological characteristics: It has loose and reticular long hyphae, with septa, branches, and multiple nuclei. Asexual reproduction forms conidia, which are generally oval, forming branch chains at the top of aerial hyphae, and the conidia are orange-yellow. The ascus is cylindrical, with a short stalk at the bottom and a ring at the top. The hyphae are 800-4000 μm in length and 1-10 μm in diameter; the sexual process forms pear-shaped ascocarps, producing asci containing up to 8 ascospores.

[0016] In some embodiments, the Neurospora crassa MN146427 comprises an ergothioneine synthesis gene; in a preferred embodiment, the Neurospora crassa comprises a sequence that is at least 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99% or 100% identical to the sequence of at least one of the ergothioneine synthesis genes EGT-1 and EGT-2.

[0017] The present invention discloses a microbial agent, including the Neurospora crassa, its inactivated material, its culture, its fermented material, and / or its extract. The "culture", "fermentation broth", "inactivated material" and "extract" used herein include any component, compound, substance or by-product (including but not limited to small molecule secondary metabolites) produced by the Neurospora crassa strain described herein and having any beneficial effect disclosed in the present invention. Any component, compound, substance or by-product of the beneficial effect includes protein, trace elements, dietary fiber, ergothioneine, etc.

[0018] The embodiment of the present invention discloses a mycelial protein or mycelium, which is prepared from the Neurospora crassa or the microbial agent.

[0019] In some embodiments, the hyphae length of the hyphae protein or mycelium is 800-4000 μm, and / or the hyphae diameter is 1-10 μm.

[0020] In some embodiments, the hyphal protein or mycelium contains at least one of cholesterol, unsaturated fatty acids, dietary fiber, protein, ergothioneine, amino acids and trace elements.

[0021] In some embodiments, the mycelial protein or mycelium has a protein content of 45 g / 100 g dry basis or more, and a protein content of 9 g / 100 g wet basis or more. Preferably, the protein content is 45-65 g / 100 g dry basis, or 9-13 g / 100 g wet basis.

[0022] In some embodiments, the cholesterol content in the mycelial protein or mycelium is less than 0.9 mg / 100 g, whether on a wet basis or a dry basis.

[0023] In some embodiments, the unsaturated fatty acids include at least one of total monounsaturated fatty acids and total polyunsaturated fatty acids. Among the total monounsaturated fatty acids, the content of the mycelial protein or mycelium in dry basis is 0.5g / 100g or more, and the content in wet basis is 0.1g / 100g or more; among the total polyunsaturated fatty acids, the content of the mycelial protein or mycelium in dry basis is 1g / 100g or more, and the content in wet basis is 0.2g / 100g or more;

[0024] Preferably, the total monounsaturated fatty acid content in the mycelial protein or mycelium is 0.5-2 g / 100 g dry basis, or 0.1-0.4 g / 100 g wet basis; the total polyunsaturated fatty acid content in the mycelial protein or mycelium is 1-3 g / 100 g dry basis, or 0.2-0.6 g / 100 g wet basis.

[0025] In some embodiments, the dietary fiber includes at least one of soluble dietary fiber and insoluble dietary fiber; in a preferred embodiment, the total dietary fiber content of the mycelial protein or mycelium in dry basis is more than 25g / 100g, and the total dietary fiber content in wet basis is more than 5g / 100g.

[0026] Preferably, the total dietary fiber content in the mycelial protein or mycelium is 25-30 g / 100 g dry basis, or 5-6 g / 100 g wet basis.

[0027] In some embodiments, in terms of the dry weight of mycelial protein or mycelium, the ergothioneine content 500-2000 μg / g dry weight of the mycelial protein or mycelium is significantly higher than the ergothioneine content in other natural fungi reported, such as the ergothioneine content 466~850 μg / g dry weight (Genghof, 1970) in the reported Neurospora crassa, higher than the dry weight (Dubost et al. (2007)) of ergothioneine content 210ng / mg~2600ng / mg (Pleurotus ostreatus) in other fungi. Explanation, Neurospora crassa of the present invention can be used for fermenting high-yield ergothioneine. Further, the mycelial protein or mycelium are applied to the field of food, so that food is rich in ergothioneine, with the function of ergothioneine, such as anti-oxidation, disease prevention, health care functions such as improving sleep, and thus, the mycelial protein or mycelium can be used for preparing health food or functional food. Furthermore, according to the multiple functions of ergothioneine, the mycelial protein or mycelium can also be used to prepare cosmetics, medicines, etc.

[0028] In some embodiments, the trace element includes at least one of calcium, iron, sodium, and potassium;

[0029] In some embodiments, the amino acids include but are not limited to tryptophan.

[0030] The embodiment of the present invention discloses the use of Neurospora crassa in producing mycelial protein or mycelium, and the Neurospora crassa or the microbial agent is used for fermentation culture.

[0031] The embodiment of the present invention discloses a method for producing mycelial protein or mycelium, comprising fermenting and culturing the Neurospora crassa or the microbial agent, separating mycelium from the fermented product, and obtaining mycelial protein. In the present invention, mycelium, mycelial protein, and mycelial protein all represent the same product.

[0032] In some embodiments, the fermentation culture includes at least one of liquid fermentation and solid fermentation; preferably, it is liquid fermentation. The volume of the liquid fermentation can be more than 1L, and can be any one of 1L, 5L, 10L, 20L, 30L, 40L, 50L, 100L, 200L, 300L, etc., or a range between any two of the above values. In some embodiments, the inoculation amount of Neurospora crassa MN146427 is a conventional inoculation amount, such as an inoculation amount of 1 to 10 v / v% of the total volume of the culture medium.

[0033] In some embodiments, the nitrogen source in the liquid culture medium used in the fermentation culture includes at least one of an inorganic nitrogen source and an organic nitrogen source. In some embodiments, the inorganic nitrogen source includes but is not limited to at least one selected from ammonium nitrate, ammonium phosphate, ammonium sulfate, ammonium chloride, ammonium hydroxide, and ammonia water; in some embodiments, the organic nitrogen source includes but is not limited to at least one selected from urea, urea compounds, yeast extract, defatted soybean meal, corn steep liquor, and soybean meal extract.

[0034] In some embodiments, the liquid culture medium used in the fermentation culture further includes at least one of a carbon source, trace elements, organic acids, and vitamins.

[0035] In some embodiments, the carbon source includes but is not limited to at least one of sugar, alcohol, honey, and starch; in some embodiments, the carbon source includes sucrose, maltose, glucose, fructose, glycerol, polyols, corn starch, maltodextrin, cyclodextrin, glucose syrup, modified starch, corn starch saccharification liquid, rice starch saccharification liquid, sweet potato starch saccharification liquid, molasses, hydrogenated glucose syrup, maltitol syrup, sorbitol syrup, beet pulp, agricultural pulp, wood pulp, dried distiller's grains, brewery waste, carbon refined syrup, desalted syrup, enzyme-converted syrup and / or a combination thereof. In a preferred embodiment, the carbon source is selected from corn starch saccharification liquid.

[0036] In some embodiments, the trace elements include but are not limited to at least one of potassium, magnesium, calcium, manganese, iron, and zinc; in a preferred embodiment, the potassium source is selected from potassium salts, preferably potassium nitrate and potassium dihydrogen phosphate. The magnesium source is selected from magnesium salts, preferably magnesium sulfate heptahydrate. The calcium source is selected from calcium salts, preferably calcium chloride. The manganese source is selected from manganese salts, preferably manganese sulfate monohydrate. The iron source is selected from iron salts, preferably iron sulfate heptahydrate. The zinc source is selected from zinc salts, preferably zinc chloride. In a preferred embodiment, the K content of the fermentation medium used in the fermentation culture is 0.1%; ... + The concentration is 1-10g / L, Mg 2+ The concentration is 0.3-5g / L, Ca 2+ The concentration is 0.01-1g / L, preferably, K + The concentration is 1-5g / L, Mg 2+ The concentration is 0.3-2g / L, Ca 2+ Concentration is 0.01-0.5g / L;

[0037] In some embodiments, the organic acid is selected from citric acid.

[0038] In some embodiments, the vitamins include, but are not limited to, B family vitamins;

[0039] In some embodiments, the fermentation medium used in the fermentation culture comprises 20 to 35 parts by weight of a carbon source, 0.01 to 30 parts by weight of a nitrogen source, and 0.01 to 10 parts by weight of an inorganic salt.

[0040] In a preferred embodiment, the fermentation medium comprises: 20 to 35 parts by weight of corn starch saccharification liquid; 0.1 to 2 parts by weight of citric acid; 1 to 5 parts by weight of potassium dihydrogen phosphate; 0.01 to 10 parts by weight of ammonium sulfate; 0.3 to 2 parts by weight of magnesium sulfate heptahydrate; 0.01 to 1 parts by weight of calcium chloride; and, optionally, 0.001 to 0.1 parts by weight of trace elements.

[0041] Preferably, the fermentation medium further comprises a vitamin complex.

[0042] In some embodiments, the pH of the liquid culture medium used in the fermentation culture is 4-8, and the pH can be any one of 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8 or a range between any two of the above values, and the preferred pH is 4-6. From the above, it can be seen that the pH range is relatively wide, indicating that the crassa Neurospora MN146427 has a high pH tolerance, and the strain is easy to separate and culture, and is suitable for scale-up culture, fermentation or industrial fermentation, such as adapting to the reduction of the pH value in the system after fermentation culture. For another example, due to its wide pH range, the range of raw materials available in its culture medium is wider, and cheap carbon sources, nitrogen sources and other raw materials in industrial production can be selected. The nitrogen source can be selected from alkaline ammonia water, which is cheaper and saves costs, and can be used as a nitrogen source to supplement the pH value of the mycelium. Under the condition of pH equal to 4-6, the mycelium can grow well and produce high protein.

[0043] In a more preferred embodiment, the pH of the liquid culture medium used in the fermentation culture is 4.

[0044] In some embodiments, the fermentation culture temperature is 28-40°C, and the temperature can be any one of 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40°C or a range between any two of the above values, and the preferred temperature is 37°C. As can be seen from the above, the culture temperature range is relatively wide, indicating that the Neurospora crassa MN146427 has a high temperature tolerance, the strain is easy to separate and culture, and is suitable for scaled-up culture, fermentation or industrial fermentation. For example, a high-volume culture or fermentation system is prone to high temperature, and the strain of the present invention has good temperature tolerance, which can ensure that it can still grow and ferment well under high temperature conditions.

[0045] In a preferred embodiment, before fermentation, the process further comprises the steps of activating the Neurospora crassa MN146427, seed culturing and / or amplifying the culturing.

[0046] In a preferred embodiment, the activation culture is carried out on a solid culture medium. The culture medium used for the activation culture can be any conventional culture medium. In a preferred embodiment, the activation culture medium includes but is not limited to conventional fungal culture media such as MEA plate culture medium, Sabouraud culture medium (SDA), and potato dextrose agar medium (PDA). The temperature and time of the activation culture are conventional culture conditions. In some embodiments, the culture temperature is 28-40°C and the culture time is 24-96h, preferably the culture temperature is 32-37°C and the culture time is 24-72h.

[0047] In some embodiments, the seed culture medium used in the seed culture comprises at least one of a nitrogen source, a carbon source, a trace element, an organic acid, and a vitamin. The types of the nitrogen source, the carbon source, the trace element, the organic acid, and the vitamin are consistent with the carbon source, the trace element, the organic acid, and the vitamin used in the aforementioned fermentation culture.

[0048] In some embodiments, the seed culture medium comprises: 25 to 35 parts by weight of a carbon source, 10 to 35 parts by weight of a nitrogen source, and 0.1 to 2 parts by weight of an inorganic salt.

[0049] In a preferred embodiment, the seed culture medium comprises: 25 to 35 parts by weight of glucose, 10 to 35 parts by weight of yeast extract powder, 1 to 5 parts by weight of potassium dihydrogen phosphate, 0.3 to 2 parts by weight of magnesium sulfate heptahydrate, and 0.01 to 1 parts by weight of calcium chloride.

[0050] In a preferred embodiment, the amplified culture is carried out in a liquid culture medium, and the culture medium used can be any conventional culture medium. Further, the culture medium used is a common seed culture medium, and the seed culture medium includes but is not limited to at least one of a nitrogen source, a carbon source, a trace element, an organic acid, and a vitamin. The types of the nitrogen source, carbon source, trace element, organic acid, and vitamin are consistent with the carbon source, trace element, organic acid, and vitamin used in the aforementioned fermentation culture. In a specific embodiment, the culture medium includes but is not limited to glucose, yeast extract powder, potassium dihydrogen phosphate, magnesium sulfate heptahydrate, and calcium chloride. In a preferred embodiment, KH2PO4 5g / L, MgSO4 0.5g / L, and CaCl2 0.5g / L. When the volume of the culture medium is 1L or more, such as 50L, in a preferred embodiment, KH2PO4 1g / L, MgSO4 0.3g / L, and CaCl2 0.01g / L.

[0051] In a preferred embodiment, the pH of the liquid culture medium for the amplified culture is 4 to 8, and the pH can be any one of 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8 or a range between any two of the above values, and the preferred pH is 4. From the above, it can be seen that the pH range is relatively wide, indicating that the crassa Neurospora MN146427 has a high pH tolerance, and the strain is easy to separate and culture, and is suitable for amplified culture, fermentation or industrial fermentation, such as adapting to the reduction of the pH value in the system after fermentation culture. For another example, due to its wide pH range, the range of raw materials available in its culture medium is wider, and cheap carbon sources, nitrogen sources and other raw materials in industrial production can be selected. The nitrogen source can be selected from alkaline ammonia water, which is cheaper and saves costs, and can be used as a nitrogen source to supplement the pH value of the mycelium. Under the condition of pH equal to 4, the mycelium can grow well and produce high protein.

[0052] In some embodiments, the conditions for the amplified culture are conventional culture conditions. In some embodiments, the preferred culture temperature is 28-40°C, and the temperature can be any one of 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40°C or a range between any two of the above values, and the preferred temperature is 37°C. As can be seen from the above, the culture temperature range is relatively wide, indicating that the Neurospora crassa MN146427 has a high temperature tolerance, and the strain is easy to separate and culture, and is suitable for amplified culture, fermentation or industrial fermentation. For example, a high-volume culture or fermentation system is prone to high temperature, and the strain of the present invention has good temperature tolerance, which can ensure that it can still grow and ferment well under high temperature conditions.

[0053] In some embodiments, the time of amplified culture can be any time, and the preferred culture time is 24 to 48 hours. In some embodiments, the culture speed is a conventional speed condition, and the preferred speed is 100-300rpm. The amplified culture is at least one level seed liquid culture, and preferably, the amplified culture includes but is not limited to a first-level seed liquid culture and a second-level seed liquid culture. In some embodiments, the volume of the seed liquid culture can be any volume, preferably ≥50mL, such as any one of 50mL, 1L, 5L, 10L, 20L, 30L, 40L, 50L, etc. or the range between any two of the above values. In some embodiments, the inoculation amount of the crassa Neurospora MN146427 is a conventional inoculation amount, such as an inoculation amount of 1 to 10v / v% of the total volume of the culture medium.

[0054] In some embodiments, when producing mycelial protein rich in ergothioneine, the culture medium used further includes a nutrient component that promotes the synthesis of ergothioneine.

[0055] In a preferred embodiment, the nutritional components include but are not limited to at least one of histidine and ferrous sulfate;

[0056] In some embodiments, the culture medium used includes a seed culture medium and / or a fermentation culture medium. In a preferred embodiment, in the culture medium used, the concentration of histidine and ferrous sulfate is 0.1-10 g / L. Preferably, the concentration range of histidine and ferrous sulfate is 0.5-2 g / L, and more preferably, the concentration of histidine and ferrous sulfate is 1 g / L.

[0057] The embodiment of the present invention discloses a mycelial protein or mycelium obtained by the method for producing mycelial protein.

[0058] The embodiments of the present invention disclose the use of the Neurospora crassa, the microbial agent, or the hyphal protein or mycelium in preparing alternative proteins, preparing alternative protein products, preparing ergothioneine, or preparing products of ergothioneine.

[0059] In some embodiments, the alternative protein product comprises a food, a condiment or a feed.

[0060] In some embodiments, the product of the ergothioneine includes food, medicine or cosmetics. Optionally, the food includes health products or functional foods.

[0061] In some embodiments, the food includes but is not limited to at least one of a meat analog, a plant-based protein meat product, a dairy product, a beverage, a dietary fiber food, a bakery product, a spreadable product, a health product, or a functional food;

[0062] In some embodiments, the meat analogs include, but are not limited to, meat analogs of livestock, seafood, and poultry;

[0063] In some embodiments, the plant-based protein meat products include, but are not limited to, plant-based protein meat products from livestock, seafood, and poultry;

[0064] In some embodiments, the livestock include but are not limited to at least one of pigs, cattle, and sheep;

[0065] In some embodiments, the seafood includes but is not limited to at least one of fish, shrimps, crabs, and shellfish;

[0066] In some embodiments, the plant-based protein meat products include, but are not limited to, plant-based protein meat products derived from soy protein, pea protein, peanut protein, and wheat protein;

[0067] In some embodiments, the meat analogs and plant-based protein meat products include, but are not limited to, meat sausages, minced meat, meat balls, meat patties, meat-like cuts, and meat-like sliced ​​products such as ham and bacon;

[0068] Optionally, the dietary fiber food includes cereal product substitutes and fruit and vegetable product substitutes.

[0069] Optionally, the health product or functional food includes a protein supplement, an amino acid supplement or a dietary fiber supplement;

[0070] Optionally, the feed includes poultry feed, livestock feed, aquaculture feed or pet feed.

[0071] Embodiments of the present invention disclose a protein food ingredient comprising a. cultured Neurospora crassa biomass in an amount of at least 2.1% w / w; and b. water in an amount of up to 97.9% w / w;

[0072] In some embodiments, the Neurospora crassa is any one of the following A1) to A4):

[0073] A1), a strain whose ITS sequence is at least 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99% or 100% identical to the sequence shown in SEQ ID NO: 3;

[0074] A2), Neurospora crassa MN146427, deposited in Guangdong Microbiological Culture Collection Center, with the deposit number of GDMCC No.65442;

[0075] A3) a strain having at least 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99% or 100% identity with the ITS sequence of the strain described in A2);

[0076] A4), a strain whose genome has an average nucleotide identity of at least 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99% or 100% with the genome of any of the strains described in A1) to A3);

[0077] In some embodiments, the Neurospora crassa biomass is the Neurospora crassa mycelial protein or mycelium;

[0078] In some embodiments, the protein food ingredient comprises 5% w / w-55% w / w of the cultured fungal biomass and 95% w / w-45% w / w water;

[0079] In some embodiments, the protein food ingredient comprises 5% w / w-15% w / w of the cultured Neurospora crassa biomass and 95% w / w-85% w / w water;

[0080] In some embodiments, the protein food ingredient comprises 90% w / w-99% w / w of the cultured Neurospora crassa biomass and 1% w / w-10% w / w water;

[0081] In some embodiments, the protein food ingredient further comprises carbohydrates, fat, protein, fiber, or any combination thereof;

[0082] In some embodiments, the carbohydrate comprises glucose, fructose, galactose, maltose, sucrose, lactose, starch, or any combination thereof;

[0083] In some embodiments, the carbohydrate comprises white sugar, brown sugar, black sugar, agar, pectin, gum arabic, molasses, honey, cane sugar, wheat starch, corn starch, potato starch, food starch, dextrose, or any combination thereof;

[0084] In some embodiments, the fat comprises vegetable oil, animal oil, or any combination thereof;

[0085] In some embodiments, the fat comprises safflower oil, sunflower oil, olive oil, coconut oil, sunflower oil, safflower oil, rapeseed oil, canola oil, vegetable glycerin, soy lecithin, or any combination thereof;

[0086] In some embodiments, the protein comprises plant protein, animal protein, microbial protein, or any combination thereof;

[0087] In some embodiments, the protein comprises texturized pea protein, texturized wheat protein, texturized soy protein, soy protein, wheat protein, pea protein, rice protein, potato protein, albumin, or any combination thereof;

[0088] In some embodiments, the fiber includes pea fiber, oat bran, other plant fiber, bamboo fiber, cellulose, citrus fiber, soy fiber, or any combination thereof;

[0089] In some embodiments, the protein food ingredient further includes soybeans, lentils, lentil flour, soy flour, pea flour, yeast extract, nutritional yeast (fixed dry yeast), mushroom powder, white button mushroom powder, shiitake mushroom powder, chickpeas, isolated oat products, isolated pea products, fermented rice extract, kelp extract, algae, silicon dioxide, vitamins, dry yeast, citrus extract, beet pulp, beet juice, beet juice extract, turmeric, mushroom extract, shiitake mushroom stems, shiitake mushrooms, white button mushrooms, tofu, soy hydrolyzate, maltodextrin, sodium ascorbate, calcium carbonate, yeast extract, seaweed, spices, sweeteners, natural flavoring agents, or any combination thereof.

[0090] The embodiment of the present invention discloses an edible composition, comprising the mycelial protein or mycelium, or the protein food component, and food additives; the amount of the mycelial protein or protein food component added is ≥0.01wt% of the total amount. Further, the amount of the mycelial protein added is 0.05wt%, 1wt%, 2wt%, 3wt%, 4wt%, 5wt%, 8wt%, 10wt%, 15wt%, 20wt%, 30wt%, 40wt%, 50wt%, 60wt%, 70wt%, 80wt%, 90wt%, 100wt% of the total amount, any one of the values ​​or the range between any two values. In some embodiments, the food additives are such as plant or animal protein, fat, emulsifier, thickener, stabilizer, flavoring agent, pH adjuster, oil, spices, salt, etc.

[0091] The technical solution of the present invention has the following advantages:

[0092] 1. The Neurospora crassa provided by the present invention is any one of the following A1) to A4):

[0093] A1), a strain whose ITS sequence is at least 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99% or 100% identical to the sequence shown in SEQ ID NO: 3; A2), Neurospora crassa MN146427, deposited in Guangdong Provincial Microbiological Culture Collection Center, with the deposit number GDMCC No.65442; A3), a strain having at least 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99% or 100% identity with the ITS sequence of the strain described in A2); A4), a strain having an average nucleotide identity of at least 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99% or 100% with the genome of the strain described in any one of A1) to A3); the mycelium grown by the above strain is straight and without bifurcation, the filter cake is light meat color, tough, and has no peculiar smell, the tasting result is good, and it can be applied to the food field. What is important is that the hyphae protein or mycelium of the rough Neurospora simultaneously meets the advantages of high protein, high dietary fiber, low cholesterol, and appropriate amount of unsaturated fatty acids, and is rich in ergothioneine, and the production process is simple and the cost is low, and it can be applied to industrial production.

[0094] Furthermore, the Neurospora crassa MN146427 has pH tolerance and temperature tolerance and strong adaptability, which further indicates that it is more suitable for scale-up production and application in industrial production.

[0095] Furthermore, after the amplified production process, the mycelial protein or mycelium produced by Neurospora crassa MN146427 has a protein content of 48-60%, a yield of 70 g / L in wet weight and 8.75 g / L in dry weight, and the mycelial protein produced has a high yield and high protein content.

[0096] Biological Deposit Certificate

[0097] Neurospora crassa MN146427 is deposited in Guangdong Microbiological Culture Collection Center (GDMCC), the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Postal Code 510070, deposit date: November 8, 2024, and the deposit number is GDMCC No.65442. BRIEF DESCRIPTION OF THE DRAWINGS

[0098] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0099] Figure 1 This is a growth observation diagram of strain MN146427 on a MEA plate in Example 1;

[0100] Figure 2 is a microscopic observation of the mycelium of the strain MN146427 in Example 1;

[0101] Figure 3 This is the phylogenetic tree of strain MN146427 in Example 1.

[0102] Figure 4 This is a photo of the fermentation cake of strain MN146427 in Example 4.

[0103] Figure 5 is a chromatogram of L-ergothioneine standard working solution;

[0104] Figure 6 is a standard curve graph of L-ergothioneine;

[0105] Figure 7 It is the L-ergothioneine detection result corresponding to the fermentation medium before optimization in Example 6;

[0106] Figure 8 It is the L-ergothioneine detection result corresponding to the fermentation medium optimized in Example 6. DETAILED DESCRIPTION

[0107] The following examples are provided for a better understanding of the present invention, but are not intended to limit the best mode of implementation, nor to limit the content and protection scope of the present invention. Any product identical or similar to the present invention obtained by anyone under the inspiration of the present invention or by combining the features of the present invention with other prior arts shall fall within the protection scope of the present invention.

[0108] If no specific experimental steps or conditions are specified in the examples, the conventional experimental steps or conditions described in the literature in the field can be used. If no manufacturer is specified for the reagents or instruments used, they are all conventional reagent products that can be obtained commercially.

[0109] Example 1 Isolation and identification of strain MN146427

[0110] 1.1 Sample collection: Traditional Chinese medicinal materials collected from Beijing in January 2023.

[0111] 1.2 Separation process:

[0112] Weigh 2 g of sample, add 20 mL of 0.7% sodium carboxymethyl cellulose suspension (CMC) or other buffer, and shake on a shaker for 30 min (150 rpm) to obtain 10 -1 g / ml concentration of sample diluent, pipette 1mL of sample into 9mL of saline, mix well to 10 -2 g / ml concentration of the sample diluent, and then serially diluted to 10 -3 ~10 -4 g / ml, take 10 -2 g / ml, 10 -3 g / ml two gradients of bacterial solution were spread on potato dextrose agar plates (PDA plates for short, formula: 200g potato extract, 20g glucose, 15g agar, 1L water), and inverted cultured in a constant temperature incubator at 25°C for 3-7d.

[0113] 1.3 Purification process:

[0114] Purification was performed by the hyphae end step-by-step transplantation method: after the colonies were formed on the plate, the hyphae at the edge of the single colony were picked up on the PDA plate and cultured at 25°C until pure colonies were obtained. The obtained colonies were stored at 4°C and recorded as strain MN146427.

[0115] 2. Strain Identification

[0116] 2.1 Morphological characteristics of strain MN146427

[0117] The strain MN146427 was inoculated into MEA medium (Huankai Biotechnology) and cultured at 28°C for 4 days. The strain was identified based on growth rate, hyphae shape, colony color, number and shape of small conidia and large conidia, spore-forming cells, shape and presence of thick-walled spores, fruiting body type, etc.

[0118] Colony culture characteristics: After 4 days of culture, the diameter of the strain colony is 4-6cm. The colony is powdery and granular at first, then fluffy, pink to light orange, with loose mycelium and spreading septa. Conidia are spherical, smooth, with septa, in chains, and mostly aggregated into clumps. The surface of the substrate is white, and the substrate turns orange after long-term storage. The culture plate is as follows Figure 1 shown.

[0119] Mycelial morphological characteristics: long, loosely meshed hyphae with septa, branches, and multiple nuclei. Asexual reproduction forms conidia, which are generally oval in shape, forming branched chains at the top of aerial hyphae, and the conidia are orange-yellow. Asci are cylindrical, with a short stalk below and a ring at the top. Mycelial length: 800-4000μm, mycelial diameter 1-10μm. The sexual process forms pear-shaped ascocarps, producing asci containing up to 8 ascospores. Mycelial morphology is as follows Figure 2 shown.

[0120] 2.2 Molecular biological identification of strain MN146427

[0121] 2.2.1 ITS sequence analysis

[0122] 2.2.1.1. DNA template preparation

[0123] Pick an appropriate amount of bacteria from the surface of the colony cultured on the MEA plate into a PCR tube containing 50 μL of lysis solution, put it into a PCR instrument (Dongshenglong ETC811), heat it at 95℃ for 30 minutes, and transfer it to -20℃ for freezing for 15 minutes. After taking it out, put it into a centrifuge (SIGMA3K15) at 3000rpm for 2 minutes to allow the cell fragments and lysis solution to settle to the bottom of the PCR tube, and the supernatant is basically clear. At this time, the fungal genetic material is dissolved in the supernatant.

[0124] 2.2.1.2. PCR system preparation

[0125] Prepare 25 μL of PCR system in a PCR tube according to the following requirements: 2 μL of supernatant; 8.8 μL of ultrapure sterile water; 12 μL of 2×PCRMix (Beijing Qingke Biotechnology); 1 μL of dimethyl sulfoxide (DMSO); 0.6 μL of 10 μmol / L forward primer; 0.6 μL of 10 μmol / L reverse primer. The primer sequences are as follows:

[0126] Table 1. Primer sequences

[0127]

[0128]

[0129] PCR amplification

[0130] In a PCR tube, prepare the PCR system and place it in a PCR instrument (Dongshenglong ETC811) for PCR amplification. The PCR reaction conditions are:

[0131] ITS: pre-denaturation at 94°C for 2.5 min; denaturation at 95°C for 30 s, annealing at 52°C for 30 s, amplification at 72°C for 1 min, 30 cycles; maintain at 72°C for another 5 min.

[0132] After amplification, the PCR product was sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing using a sequencer (abi3730XL).

[0133] 2.2.1.4. Sequences obtained by PCR

[0134] ITS sequence:

[0135] 5'-CAGAGTTGCAAAACTCCCACAAACCATCGCGAATCTTACCCGTACGGTTGCCTC GGCGCTGGCGGTCCGGAAAGGCCTTCGGGCCCTCCCGGATCCTCGGGTCTCCCGCTCGCGGGAGGCTGCCCGCCGGAGTGCCGAAACTAAACTCTTGATATTTTATGTCTCTCTGAGTAAACTTTT AAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGC TCGCCAGTATTCTGGCGAGCATGCCTGTTCGAGCGTCATTTCAACCATCAAGCTCTGCTTGCGTTGGGGATCCGCGGCTGTCCGCGGTCCCTCAAAATCAGTGGCGGGCTCGCTAGTCACACCGAG CGTAGTAACTCTACATCGCTATGGTCGTGCGGCGGGTTCTTGCCGTAAAACCCCCCATTTCTAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGATTAAAAAGGGGG-3' (see SEQ. Shown as ID NO.3)

[0136] The gene sequences were aligned using the NCBI online alignment system (blast), and the alignment database was Nucleotidecollection (nr / nt). The most similar alignment results are shown in the following table:

[0137] Table 2. ITS sequence alignment results

[0138] Gene Accession Species name Identity / % Coverage / % E-value ITS KU319440.1 Neurospora crassa 100 97 0.0

[0139] ITS sequences of neurospora were collected from NCBI, and the evolutionary position of the current strain was analyzed by constructing a single gene evolutionary tree. MUSCLE was used to perform multiple sequence alignment of the target sequence, and then MEGA was used to construct a single gene evolutionary tree based on the maximum likelihood method (ML). Figure 3 shown.

[0140] Based on morphological characteristics and ITS sequence analysis, strain MN146427 is Neurosporacrassa. The strain was deposited in Guangdong Microbiological Culture Collection Center (GDMCC) on November 8, 2024, with the deposit address on the fifth floor of Building 59, No. 100 Xianlie Middle Road, Guangzhou, zip code 510070, and the deposit number is GDMCC No.65442.

[0141] Example 2 Determination of mycelial protein

[0142] Activate strain MN146427: Inoculate strain MN146427 onto MEA plate culture medium (Huankai Biotechnology) and culture at 28°C for 48-96 hours.

[0143] The activated strain was inoculated into a 250 mL tri-conical flask containing 50 mL of the primary screening medium and cultured at 200 rpm for 48 h. The primary screening medium formula was: 30 g / L glucose, 30 g / L yeast extract powder, 1 g / L KH2PO4, 0.5 g / L MgSO4·7H2O, 0.2 g / L CaCl2, and sterilized by high pressure steam at 115°C for 30 min before use.

[0144] After constant temperature shaking culture for 48 hours, the filter cake was filtered by vacuum filtration device, washed thoroughly, and dried in an electric blast drying oven at 60°C. The mass of the dried filter cake was accurately weighed and the biomass concentration was calculated. Then, the crude protein of mycelium was determined by Kjeldahl nitrogen determination method in accordance with GB5009.5-2016 National Food Safety Standard Determination of Protein in Food. The results are as follows:

[0145] Table 3. Mycelium crude protein determination results

[0146] Mycelium morphology Filter cake color Filter cake texture Dry weight g / 50mL Biomass% Mycelial protein content% Filamentous Orange Flexible 0.46 0.92 52.79

[0147] Biomass = mycelium dry weight / medium volume × 100%;

[0148] Mycelial protein content = crude protein mass / total mass of mycelium × 100%.

[0149] Therefore, the use of strain MN146427 to ferment and prepare mycelial protein can obtain filamentous mycelial morphology, orange-red filter cake color, elastic texture of the filter cake, dry weight of 0.46 g / 50 mL, biomass of 0.92%, and mycelial protein content of 52.79%.

[0150] Example 3 Study on the Optimal Culture Conditions

[0151] 1. Bacteria activation

[0152] The strain MN146427 was inoculated into MEA plate culture medium (Huankai Biotechnology) and cultured at 28°C for 72 h.

[0153] 2. Shake flask culture

[0154] The activated strain MN146427 was inoculated into a 250 mL three-concave conical flask containing 50 mL of seed culture medium by punching, and cultured at 28°C, 200 rpm constant temperature shaking for 36 to 48 hours. The seed culture medium formula is as shown in the table below, and it was sterilized by high pressure steam at 115°C for 30 minutes before use.

[0155] Table 4. Seed culture medium formula

[0156]

[0157]

[0158] 3. Research on the optimal culture temperature

[0159] 50 mL of seed culture solution obtained in shake flask culture in 2 was inoculated into 4 2L tri-conical flasks containing 1L of seed culture medium (see Table 4), and cultured in constant temperature shaking boxes at 28°C, 32°C, 37°C, and 40°C for 24 h.

[0160] After the cultivation is completed, the filter cake is obtained by filtration with a vacuum filtration device, and the obtained filter cake is fully washed, and the mass of the filter cake is accurately weighed to obtain the wet weight, and then placed in an electric heating blast drying oven at 60°C for drying, and the mass of the dried filter cake is accurately weighed, and then the mycelial protein content (crude protein mass / total mass of bacteria × 100%) is determined by the Kjeldahl nitrogen determination method in accordance with GB 5009.5-2016 National Food Safety Standard Determination of Protein in Food. The results of the determination are as follows:

[0161] Table 5. Results of determination of optimum culture temperature

[0162] Measurement index / temperature 28℃ 32℃ 37℃ 40℃ Wet weight / g 66.46 64.46 76.81 21.14 Dry weight / g / L 8.71 9.28 9.68 4.82 Protein content / % 48.55 52.16 53.37 42.27

[0163] From the results in the above table, it can be seen that strain MN146427 can grow at a temperature of 28°C-40°C, and can obtain the highest dry weight of 9.68g / L and the highest protein content of 53.37% when cultured at 37°C. The above shows that strain MN146427 has a high temperature tolerance and is easy to separate and culture, making it more suitable for scale-up culture, fermentation and industrial fermentation. In addition, since strain MN146427 can tolerate high temperatures, fermentation at 37°C in high temperature areas can greatly save energy consumption.

[0164] 4. Study on the Optimal Culture pH Value

[0165] 2. Inoculate 50 mL of seed culture solution obtained from shake flask culture into 4 2 L tri-conical flasks containing 1 L of seed culture medium (see Table 4), then adjust the pH of the culture medium to five gradients of 4, 5, 6, 7, and 8 with phosphoric acid and NaOH, respectively, and culture in a constant temperature shaking box at 28 °C for 24 h.

[0166] After the culture was completed, the hyphae length, number of branches, and number of spores were observed under a microscope, and then the wet weight / g, dry weight / g / L, and protein content / % were determined according to the method in "3. Study on the Optimal Culture Temperature". The results are as follows:

[0167] Table 6. Results of determination of optimum culture pH

[0168]

[0169]

[0170] As can be seen from the table above, strain MN146427 can grow in the pH range of 4 to 8, indicating that strain MN146427 has strong pH tolerance and can adapt to a wider pH range. It can also be seen from the above that strain MN146427 has strong acidophilicity, and has a higher dry weight of 10.29 g / L and the highest protein content of 48.66% under the culture of pH 4, and has excellent mycelial morphology, with mycelial slender and straight, without obvious bifurcation and spore production.

[0171] 5. Study on the optimal concentration of metal ions for culture

[0172] 50mL of seed culture solution obtained from shake flask culture in 2. were inoculated into 4 2L three-concave conical flasks containing 1L of seed culture medium (see Table 4), and an orthogonal experiment was designed according to three levels and three factors. The potassium dihydrogen phosphate, magnesium sulfate and calcium chloride in the seed culture medium were set at three different concentration levels, namely high concentration, medium concentration and low concentration. The specific formula and measurement results are shown in the following table. Place in a 28℃ constant temperature shaking box and culture for 24h.

[0173] After the culture is completed, the protein content / % is determined according to the method in "3. Study on the optimal culture temperature".

[0174] Table 7. Results of determination of optimal culture metal ion concentrations

[0175]

[0176]

[0177] Among them, K1, K2, K3 represent the sum of indicators at each level of each factor, and R represents the range, which is equal to the maximum average yield - the minimum average yield. For example, K1(KH2PO4) = 48.71 + 44.58 + 47.98; R(KH2PO4) = 47.20-45.72.

[0178] It can be seen from the above table that according to the results of orthogonal test range analysis, the optimal ion formula for strain MN146427 to produce high protein is medium concentration KH2PO4, low concentration MgSO4, and medium concentration CaCl2.

[0179] Example 4 50 L scale-up production process of strain MN146427

[0180] 1. Bacteria activation

[0181] The strain MN146427 was inoculated into MEA plate culture medium (Huankai Biotechnology) and cultured at 28°C for 72 hours.

[0182] 2. Seed cultivation

[0183] The activated strain MN146427 was inoculated into a 250mL three-concave conical flask containing 50mL of the first-level seed culture medium, and cultured at 32-37°C with shaking at 200rpm for 24h. Then the obtained first-level seed solution was transferred to a 3L three-concave conical flask containing 1L of the second-level seed culture medium at a 5v / v% inoculation amount, and cultured at 32-37°C with a shaking speed of 200rpm for 24h. The preparation of the second-level seed culture medium uses the above seed culture medium, and the amount of yeast extract powder is reduced to 10g / L. The first and second-level seed culture media are shown in the table below, and they are sterilized by high-pressure steam at 115°C for 30min before use.

[0184] Table 8: Seed culture medium composition is as follows

[0185] Formula Materials Primary seed culture medium (g / L) Secondary seed culture medium (g / L) glucose 30 30 Yeast extract powder 30 10 Potassium dihydrogen phosphate 1 1 Magnesium sulfate heptahydrate 0.5 0.5 Calcium chloride 0.2 0.2

[0186] 3. Fermentation culture

[0187] The obtained secondary seed liquid was transferred to a production fermenter filled with 50L fermentation medium at a 5v / v% inoculation rate, stirred at 50-200rpm, dissolved oxygen linkage controlled at 20-50%, aeration 15-300L / min, pH controlled at 4-6 during the fermentation process, fermented at 32-37°C, and fermented for 24h. The fermentation medium formula (solvent is deionized water) is as shown in the following table, and sterilized by high-pressure steam at 115°C for 30min before use.

[0188] Table 9. Production fermentation medium

[0189]

[0190]

[0191] After the fermentation was completed, microscopic examination and protein detection were performed. Microscopic examination showed that there were no spores, the filaments were excellent, the filter cake was light flesh color, tough, and had no odor; therefore, the tasting result was good. The protein detection result was 48% to 60%, and the yield was 62.1 g / L in wet weight and 8.65 g / L in dry weight (wet weight / g, dry weight / g / L, and protein content / % were determined according to the method in "3. Optimal culture temperature study" in Example 3). The fermentation filter cake was as follows Figure 4 shown.

[0192] Example 5 300 L scale-up production process of strain MN146427

[0193] 1. Bacteria activation

[0194] The strain MN146427 was inoculated into MEA plate culture medium (Huankai Biotechnology) and cultured at 28°C for 72 hours.

[0195] 2. Seed cultivation

[0196] The activated strain MN146427 was inoculated into a 250mL three-concave conical flask containing 50mL of the first-level seed culture medium, and cultured at 32-37°C with shaking at 200rpm for 24h. Then the obtained first-level seed liquid was transferred to a 3L three-concave conical flask containing 1L of the second-level seed culture medium at a 5v / v% inoculation amount, and cultured at 32-37°C with a shaking speed of 200rpm for 24h. The preparation of the second-level seed culture medium uses the above seed culture medium, and the amount of yeast extract powder is reduced to 10g / L. The first and second-level seed culture media are shown in the table below, and they are sterilized by high-pressure steam at 115°C for 30min before use.

[0197] Table 10: Seed culture medium composition is as follows

[0198] Formula Materials Primary seed culture medium (g / L) Secondary seed culture medium (g / L) glucose 30 30 Yeast extract powder 30 10 Potassium dihydrogen phosphate 1 1 Magnesium sulfate heptahydrate 0.5 0.5 Calcium chloride 0.2 0.2

[0199] 3. Seed tank enlargement culture

[0200] Inoculate 1L of the secondary seed liquid into a 50L seed tank for amplification and culture, shake at 50-200rpm, control dissolved oxygen linkage at 20-50%, aeration at 15-300L / min, pH at 4-6, temperature at 32-37°C, and culture for 24-48h. The formula of 50L seed culture medium (solvent is deionized water) is as shown in the following table, and sterilize by high pressure steam at 115°C for 30min before use.

[0201] Table 11, 50L seed culture medium formula

[0202] Formula Materials g / L glucose 30 Yeast extract powder 10 Potassium dihydrogen phosphate 1 Magnesium sulfate heptahydrate 0.3 Calcium chloride 0.01

[0203] 4. 300L fermentation to produce mycelial protein

[0204] The seed culture liquid obtained by amplifying the culture in 3,50L seed tanks was inoculated into a production fermentation tank containing 300L fermentation medium, with an inoculation amount of 5%, 50-200rpm stirring culture, pH fermentation process controlled at 6.5, fermentation at 28°C, ventilation 15-300L / min, dissolved oxygen linkage control 20-50%, and fermentation time 24h. The formula of 300L fermentation medium (solvent is deionized water) is as shown in the following table, and it is sterilized by high-pressure steam at 115°C for 30min before use.

[0205] Table 12, 300L fermentation medium

[0206] Element Fermentation medium Corn starch saccharification liquid 30g / L Citric acid 1g / L Potassium dihydrogen phosphate 3g / L Ammonium sulfate 3g / L Magnesium sulfate heptahydrate 0.3g / L Calcium chloride 0.05g / L Manganese sulfate monohydrate 1.7mg / L Ferrous Sulfate Heptahydrate 5mg / L Zinc chloride 1.7mg / L Vitamin B solution (commercially available) 1mL / L Yeast extract powder 1g / L

[0207] After the fermentation, microscopic examination and protein detection were performed. The microscopic examination results were: no spores, good filamentous morphology, straight hyphae without bifurcation, the separated hyphae protein was light flesh color, tough, without peculiar smell, and the tasting results were good. The protein detection result was 48% to 60%, the yield was 70g / L in wet weight and 8.75g / L in dry weight (wet weight / g, dry weight / g / L, protein content / %) were determined according to the method in "3. Study on the Optimal Culture Temperature" in Example 3.)

[0208] Example 6 Detection of ergothioneine in hyphae protein of strain MN146427

[0209] 1. Detection of key synthetic genes of ergothioneine

[0210] Ergothioneine key synthetic gene is EGT-1 and EGT-2 (NCU11365, NCU04343), the protein sequence of the above two ergothioneine synthetic genes is collected to build an ergothioneine synthetic gene database, by blastp software, the protein sequence of strain MN146427 is compared with the ergothioneine synthetic gene database, with sequence similarity ≥ 60%, sequence coverage ≥ 60%, as screening criteria, the ergothioneine synthetic gene in the target strain is obtained. Its homology and coverage are both 100%, indicating that strain MN146427 has ergothioneine key synthetic genes EGT-1 and EGT-2. Comparison results are as follows:

[0211] Table 13 Comparison results

[0212] Sequence number protein Reference sequence % identity Coverage % Length (amino acids) MN146427_004081-T1 EGT-1 NCU04343 100 100 876 MN146427_002766-T1 EGT-2 NCU11365 100 100 473

[0213] 2. Detection of ergothioneine in mycelial protein

[0214] The method for detecting ergothioneine content is in accordance with the agricultural industry standard NY / T 3872-2021, as follows:

[0215] 1) Sample preparation and extraction

[0216] Weigh 1g of sample (accurate to 0.01g) and place it in a 50mL centrifuge tube. Add 40.00mL of 70v / v% methanol aqueous solution accurately. Ultrasonic extraction was performed in an ultrasonic cleaner for 30min. Centrifuge at 4000r / min for 5min. Take 2mL of the extract and blow it to near dryness. Redissolve it with 2mL of methanol solution containing 0.1v / v% formic acid. After filtering through a 0.22μm filter membrane, take 1mL of the filtrate for determination by ultra-performance liquid chromatography.

[0217] 2) Chromatographic reference conditions

[0218] Chromatographic column: HILIC column (2.1mm×100mm, 1.7μm), or chromatographic column of equivalent specifications;

[0219] Mobile phase: acetonitrile solution containing 0.1 v / v% formic acid-water solution containing 0.1 v / v% formic acid;

[0220] Elution method: the mobile phase contains 0.1v / v% formic acid in acetonitrile solution: 0.1v / v% formic acid in water solution at a volume ratio of 50%:50% for isocratic elution;

[0221] Flow rate: 0.4 mL / min;

[0222] Column temperature: 40°C;

[0223] Wavelength: 262nm;

[0224] Injection volume: 3 μL.

[0225] 3) Drawing of standard curve

[0226] Use L-ergothioneine series standard working solution, measure with reference to the above-mentioned chromatographic conditions, take the mass concentration of standard working solution as abscissa, peak area as ordinate to draw the standard curve of L-ergothioneine. The chromatogram of L-ergothioneine standard working solution is shown in Figure 5 The standard curve of L-ergothioneine is as follows: Figure 6 .

[0227] 2.1. Culture of strain MN146427

[0228] 2.1.1 Bacterial Activation

[0229] The strain MN146427 was inoculated into MEA plate culture medium (Huankai Biotechnology) and cultured at 28°C for 72 hours.

[0230] 2.1.2 Seed cultivation

[0231] The activated strain MN146427 was cultured in a seed medium and then inoculated into a 50 L fermenter for culture. The fermentation method was the same as in Example 4, except that the fermentation medium used was replaced with medium A or medium B. The fermentation medium formula (solvent was deionized water) was as shown in the following table, and was sterilized by high pressure steam at 115° C. for 30 min before use.

[0232] Table 14, ergothioneine production medium formula

[0233] Formula Materials Medium A g / L Medium B g / L glucose 30 30 Yeast extract powder 10 10 Potassium dihydrogen phosphate 1 1 Magnesium sulfate heptahydrate 0.5 0.5 Calcium chloride 0.2 0.2 Ferrous Sulfate 0 1 Histidine 0 1

[0234] After culturing, the mycelium obtained is used as sample, 6g sample (accurate to 0.01g) is weighed, placed in a 50mL centrifuge tube, 100ml pure water is added to mix, homogenized by homogenizer 8000-10000rpm for 15min, and mycelium homogenate is obtained. 10mL mycelium homogenate is evenly taken and added with 70v / v% methanol aqueous solution, ultrasonic cleaner is ultrasonically extracted for 30min, 4000r / min, centrifuged for 5min, 2mL extract is taken and blown to nearly dry, and 2mL is redissolved with the methanol solution containing 0.1v / v% formic acid, after crossing 0.22 μm filter membrane, 1mL filtrate is taken and detected according to the aforementioned thioneine content detection method. Test result is as shown in Figure 7 and Figure 8 As shown, the peak time of ergothioneine in the two figures is different from that of the standard ( Figure 5 ) is consistent, with a peak at 9 minutes, Figure 7 The peak area of ​​ergothioneine in is 840320. Substitute Figure 6The standard curve of 25.8 mg / L was used to calculate the ergothioneine concentration in the sample, and the ergothioneine content in the mycelium was 1846.4 μg / g dry weight (the calculation formula was ergothioneine mass / mycelium dry weight × 100%). Figure 8 For culture medium formula, histidine and ferrous sulfate are additionally added, and the peak area of ​​thioneine is 928546, 66.52mg / L in sample, and thioneine content is 2047.8μg / g dry weight in mycelium. It can be illustrated by the above that the mycelium of bacterial strain MN146427 of the present invention is rich in thioneine, significantly higher than the thioneine content in other natural fungi reported by existing, such as thioneine content 466~850μg / g dry weight (Genghof, 1970) in Neurospora crassa reported, higher than the dry weight (people such as Dubost (2007)) of thioneine content 210ng / mg~2600ng / mg (Pleurotus ostreatus) in other fungi. In addition, bacterial strain MN146427 of the present invention adds histidine and ferrous sulfate in culture medium formula, can significantly improve the thioneine content in its mycelium, improves 1.57 times.

[0235] Example 7 Detection of nutritional components in mycelial protein of strain MN146427

[0236] The mycelium obtained by fermentation in Example 4 was used as a sample for nutrient component detection. The nutrient component detection method was based on: cholesterol GB 5009.128-2016, unsaturated fatty acids GB 5009.168-2016, dietary fiber GB 5009.88-2023. The test results are as follows:

[0237] Table 15. Nutritional content of mycelial protein

[0238]

[0239] Table 15 continued, nutritional content

[0240]

[0241] It can be seen from the above table that, in terms of cholesterol content, the cholesterol content in the dry and wet basis of mycelial protein or mycelium of the strain MN146427 of the present invention is very low, much lower than that of beef and chicken.

[0242] In terms of total monounsaturated fat content, the dry-basis and wet-basis total monounsaturated fat content of the mycelial protein or mycelium of the strain MN146427 of the present invention is lower than that of beef and chicken.

[0243] In the total dietary fiber content, the dry basis total dietary fiber content of mycelial protein or mycelium of the strain MN146427 of the present invention is 27.44%, while beef and chicken do not contain total dietary fiber.

[0244] In terms of protein content, the protein content in the dry basis of mycelial protein or mycelium of the strain MN146427 of the present invention is significantly better than that of chicken and beef.

[0245] The above description shows that the mycelial protein or mycelium of the strain MN146427 of the present invention is healthier when applied in the food field. Compared with chicken and beef, it has low cholesterol and unsaturated fatty acid content, and is rich in dietary fiber and protein, which is comparable to high-quality meat. The protein content is even higher than that of high-quality meat. That is, the mycelium of the strain MN146427 of the present invention has higher nutritional components.

[0246] In addition, the mycelial protein or mycelium of the strain MN146427 of the present invention is rich in amino acids such as tryptophan, trace elements required by the human body such as calcium, iron, sodium, potassium, etc., in addition to the nutrients in Table 14, and has the advantages of high energy and low carbohydrates.

[0247] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the invention.

Claims

1. A Neurospora crassa, characterized in that Any one of the following A1) to A4): A1), a strain whose ITS sequence is at least 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99% or 100% identical to the sequence shown in SEQ ID NO: 3; A2), Neurospora crassa MN146427, deposited in Guangdong Microbiological Culture Collection Center, with the deposit number of GDMCC No.65442; A3) a strain having at least 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99% or 100% identity with the ITS sequence of the strain described in A2); A4), a strain whose genome has an average nucleotide identity of at least 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99% or 100% with the genome of any of the strains described in A1) to A3).

2. The Neurospora crassa according to claim 1, characterized in that The Neurospora crassa contains an ergothioneine synthesis gene; Optionally, the Neurospora crassa comprises a sequence that is at least 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99% or 100% identical to the sequence of at least one of the ergothioneine synthesis genes EGT-1 and EGT-2.

3. A microbial agent, characterized in that: The invention comprises the Neurospora crassa according to claim 1 or 2, its inactivated product, its culture, its fermentation product, and / or its extract.

4. A mycelial protein or mycelium, characterized in that: The method comprises culturing the Neurospora crassa according to claim 1 or 2 or the microbial agent according to claim 3; preferably, the hyphae length of the hyphae protein or mycelium is 800-4000 μm, and / or the hyphae diameter is 1-10 μm; Preferably, the hyphae protein or mycelium contains at least one of cholesterol, unsaturated fatty acids, dietary fiber, protein, ergothioneine, amino acids and trace elements; Preferably, the protein content is higher than 45% based on the dry weight of mycelial protein or mycelium; Preferably, the protein content is 45% to 65% based on the dry weight of mycelial protein or mycelium; Preferably, the dietary fiber content is higher than 25% based on the dry weight of mycelial protein or mycelium; Preferably, the dietary fiber content is 25%-30% based on the dry weight of mycelial protein or mycelium; Preferably, the mycelial protein or mycelium has an ergothioneine content of 500-2000 μg / g dry weight; Preferably, the unsaturated fatty acid comprises at least one of total monounsaturated fatty acids and total polyunsaturated fatty acids; And / or, the dietary fiber includes at least one of soluble dietary fiber and insoluble dietary fiber; And / or, the trace elements include at least one of calcium, iron, sodium and potassium; And / or, the amino acids include but are not limited to tryptophan.

5. The use of Neurospora crassa in the production of mycelial protein or mycelium, characterized in that: Fermentation culture is carried out using the Neurospora crassa described in claim 1 or 2 or the microbial agent described in claim 3.

6. A method for producing mycelial protein or mycelium, characterized in that: The method comprises the following steps: using Neurospora crassa for fermentation culture, separating mycelium from the fermentation product, and obtaining mycelium protein; Preferably, the Neurospora crassa is the Neurospora crassa described in claim 1 or 2 or the microbial agent described in claim 3; Preferably, before fermentation culture, the method further comprises the steps of activating the Neurospora crassa, seed culture and / or amplifying culture; Preferably, the fermentation culture includes at least one of liquid fermentation and solid fermentation; preferably, it is liquid fermentation; Preferably, the pH of the medium used in the fermentation culture is 4-8, preferably, the pH is 4-6; And / or, the fermentation culture temperature is 28-40°C, preferably 32-37°C; Preferably, the nitrogen source in the liquid culture medium used in the fermentation culture includes at least one of an inorganic nitrogen source and an organic nitrogen source; Optionally, the inorganic nitrogen source includes but is not limited to at least one of ammonium phosphate, ammonium sulfate, ammonium chloride, ammonium nitrate, ammonium hydroxide, and ammonia water; Optionally, the organic nitrogen source includes but is not limited to at least one of yeast extract, defatted soybean powder, corn steep liquor, and soybean meal extract; Optionally, the liquid culture medium used in the fermentation culture further includes at least one of a carbon source, trace elements, organic acids, and vitamins; Optionally, the carbon source includes but is not limited to at least one of sugar, alcohol, honey and starch; Preferably, the carbon source comprises sucrose, maltose, glucose, fructose, glycerol, polyol, corn starch, maltodextrin, cyclodextrin, glucose syrup, modified starch, corn starch saccharification liquid, rice starch saccharification liquid, sweet potato starch saccharification liquid, molasses, hydrogenated glucose syrup, maltitol syrup, sorbitol syrup, beet pulp, agricultural pulp, wood pulp, dried distiller's grains, brewery waste, carbon refined syrup, desalted syrup, enzyme-converted syrup and / or a combination thereof; Optionally, the trace elements include but are not limited to at least one of potassium, magnesium, calcium, manganese, iron and zinc; preferably, the K + The concentration is 1-10g / L, Mg 2+ The concentration is 0.3-5g / L, Ca 2+ The concentration is 0.01-1g / L, preferably, K + The concentration is 1-5g / L, Mg 2+ The concentration is 0.3-2g / L, Ca 2+ Concentration is 0.01-0.5g / L; Optionally, the vitamins include but are not limited to B family vitamins; Preferably, when producing mycelial protein rich in ergothioneine, the culture medium used also includes adding nutritional components that promote the synthesis of ergothioneine; Optionally, the nutritional components include but are not limited to at least one of histidine and ferrous sulfate; Optionally, the concentration of the histidine and ferrous sulfate is 0.1-10 g / L, preferably, the concentration of the histidine and ferrous sulfate is 1 g / L.

7. A mycelial protein or mycelium obtained by the method according to claim 6.

8. Use of Neurospora crassa according to claim 1 or 2, the microbial agent according to claim 3, or the mycelial protein or mycelium according to claim 4 or 7 in the preparation of alternative proteins, alternative protein products, ergothioneine or ergothioneine products; Preferably, the alternative protein product includes food, condiment or feed; Preferably, the product of ergothioneine includes food, medicine or cosmetics; optionally, the food includes health products or functional foods; Preferably, the food includes but is not limited to at least one of meat analogs, plant-based protein meat products, dairy products, beverages, dietary fiber foods, baked products, spreadable products, health products or functional foods; Optionally, the meat analogs include, but are not limited to, meat analogs of livestock, seafood, and poultry; Optionally, the plant-based protein meat products include, but are not limited to, plant-based protein meat products from livestock, seafood, and poultry; Optionally, the livestock includes but is not limited to at least one of pigs, cattle, and sheep; Optionally, the seafood includes but is not limited to at least one of fish, shrimps, crabs, and shellfish; Optionally, the plant-based protein meat products include, but are not limited to, plant-based protein meat products derived from soy protein, pea protein, peanut protein, and wheat protein; Optionally, the meat analogs and plant-based protein meat products include but are not limited to sausages, minced meat, meat balls, meat patties, meat-like cuts, meat-like sliced ​​products such as ham and bacon; Optionally, the dietary fiber food includes cereal product substitutes and fruit and vegetable product substitutes; Optionally, the health product or functional food includes a protein supplement, an amino acid supplement or a dietary fiber supplement; Optionally, the feed includes poultry feed, livestock feed, aquaculture feed or pet feed.

9. A protein food ingredient, characterized in that comprising a. cultured Neurospora crassa biomass in an amount of at least 2.1% w / w; and b. water in an amount of up to 97.9% w / w; Preferably, the Neurospora crassa is the Neurospora crassa described in claim 1 or 2; Preferably, the Neurospora crassa biomass is the Neurospora crassa mycelial protein or mycelium as described in claim 4 or 7; Preferably, the protein food ingredient comprises 5%-55% of the cultured Neurospora crassa biomass and 95%-45% water; Preferably, the protein food ingredient comprises 5%-15% of the cultured Neurospora crassa biomass and 95%-85% of water; Preferably, the protein food ingredient comprises 90%-99% of the cultured Neurospora crassa biomass and 1%-10% water; Preferably, the protein food ingredient further comprises carbohydrates, fat, protein, fiber or any combination thereof; Preferably, the carbohydrate comprises glucose, fructose, galactose, maltose, sucrose, lactose, starch or any combination thereof; Preferably, the carbohydrate comprises white sugar, brown sugar, black sugar, agar, pectin, gum arabic, molasses, honey, cane sugar, wheat starch, corn starch, potato starch, food starch, dextrose or any combination thereof; Preferably, the fat comprises vegetable oil, animal oil or any combination thereof; Preferably, the fat comprises safflower oil, sunflower oil, olive oil, coconut oil, sunflower oil, safflower oil, rapeseed oil, canola oil, vegetable glycerin, soy lecithin or any combination thereof; Preferably, the protein comprises plant protein, animal protein, microbial protein or any combination thereof; Preferably, the protein comprises texturized pea protein, texturized wheat protein, texturized soy protein, soy protein, wheat protein, pea protein, rice protein, potato protein, albumin or any combination thereof; Preferably, the fiber comprises pea fiber, oat bran, other plant fiber, bamboo fiber, cellulose, citrus fiber, soy fiber or any combination thereof; Preferably, the protein food ingredient further comprises soybeans, lentils, lentil flour, soybean flour, pea flour, yeast extract, nutritional yeast (fixed dry yeast), mushroom powder, white Agaricus bisporus powder, shiitake mushroom powder, chickpeas, isolated oat products, isolated pea products, fermented rice extract, kelp extract, algae, silicon dioxide, vitamins, dry yeast, citrus extract, beet pulp, beet juice, beet juice extract, turmeric, mushroom extract, shiitake mushroom stems, shiitake mushrooms, white Agaricus bisporus, tofu, soybean hydrolyzate, maltodextrin, sodium ascorbate, calcium carbonate, yeast extract, seaweed, spices, sweeteners, natural flavoring agents or any combination thereof.

10. An edible composition, characterized in that The method comprises the mycelial protein or mycelium according to claim 4 or 7, or the protein food component according to claim 9, and a food additive; the amount of the mycelial protein or protein food component added is ≥0.01wt% of the total amount.

Images