Eubacterium mucilaginosus E11405 and application thereof in bacteriostasis and anti-inflammation

Abstract

The invention relates to the technical field of microorganisms, in particular to Eubacterium mucilaginosus E11405 and application thereof in bacteriostasis and anti-inflammation. The preservation number of the mucus eubacterium is CGMCC (China General Microbiological Culture Collection Center) No.31231. The application comprises inhibition of microorganisms and anti-inflammation. The microorganisms comprise one or more of listeria monocytogenes, staphylococcus aureus, salmonella typhimurium or escherichia coli. The Eubacterium mucilaginosus provided by the invention can relieve various infection symptoms caused by salmonella infection, and shows the potential in preparation of drugs for treating and / or preventing infection of pathogenic bacteria such as salmonella. In addition, the Eubacterium mucilaginosus provided by the invention can also effectively relieve inflammatory bowel diseases and relieve intestinal mucosa injury and colitis symptoms, provides a new strategy for preventing and treating inflammatory bowel diseases, and has potential clinical application prospects.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to Eubacterium mucosum E11405 and applications thereof in antibacterial and anti-inflammatory activities. Background Art

[0002] Bacterial infections, especially those caused by foodborne pathogens such as Escherichia coli and Salmonella, have become a major problem that needs to be solved urgently in the field of public health. Escherichia coli can not only cause common diseases such as diarrhea and urinary tract infections, but can also lead to more serious complications, posing a serious threat to human health. Salmonella, as a widespread and highly pathogenic zoonotic pathogen, has a variety of transmission routes and can easily infect humans and animals through the food chain, causing severe symptoms such as acute fever, food poisoning and gastroenteritis, and even death in extreme cases. In livestock and poultry farming, Salmonella infection has also caused huge economic losses. The production performance of infected livestock and poultry has declined or they have died. At the same time, processed animal-derived foods may also become a hidden danger to food safety.

[0003] Currently, antibiotics are the main means of treating Salmonella infections. However, the abuse of antibiotics has caused serious problems such as the growth of drug-resistant bacteria and drug residues, posing new threats to public health and food safety. Therefore, the development of new and effective anti-Salmonella drugs or treatment strategies is of great significance for protecting human and animal health and maintaining food safety.

[0004] Inflammatory bowel disease (IBD) is a type of chronic intestinal inflammatory disease, mainly including ulcerative colitis (UC) and Crohn's disease (CD). The pathogenesis of IBD is complex, involving the interaction of multiple factors such as genetics, environment, immunity, intestinal microbiota and mucosal barrier function. Patients usually experience symptoms such as recurrent abdominal pain, diarrhea, weight loss, intestinal bleeding and possible intestinal stenosis or perforation, which seriously affect the quality of life of patients. Although there are currently a variety of treatment methods, such as drug therapy (including anti-inflammatory drugs, immunosuppressants, biological agents, etc.), nutritional support and surgical treatment when necessary, the treatment effect varies from person to person, and some patients may face drug side effects and decreased quality of life. Therefore, in-depth research on the pathogenesis of IBD and exploration of safer and more effective treatments remain one of the focuses of current medical research.

[0005] Eubacterium mucilaginosum belongs to the genus Eubacterium, is usually isolated from human feces, and is a resident flora in the human intestine. So far, no strain of Eubacterium mucilaginosum with antibacterial effect has been reported. Summary of the invention

[0006] In order to solve the problems existing in the prior art, the present invention provides a mucoid Eubacterium and application thereof in inhibiting microorganisms.

[0007] In a first aspect, the present invention provides a mucoid Eubacterium ( Eubacterium limosum ) El1405, the strain was deposited on July 3, 2024 at the General Microbiology Center of the China Microbiological Culture Collection Administration (CGMCC, address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code 100101), and was classified and named Eubacterium mucosum Eubacterium limosum , the deposit number is CGMCC No.31231.

[0008] In a second aspect, the present invention provides a bacterial agent, comprising the aforementioned Eubacterium mucilaginosum E11405 or a fermentation product thereof.

[0009] The fermentation product of the present invention may be a product excluding the strain itself (supernatant) or a total product including the strain itself.

[0010] Furthermore, the bacterial agent is a solid bacterial agent, a liquid bacterial agent or a microbial bacterial agent, and the total viable count of the Eubacterium mucosum El1405 in the bacterial agent is 1×10 7-10 CFU / mL.

[0011] Preferably, the bacterial liquid of Eubacterium mucosum El1405 obtained by culture can be prepared as a liquid bacterial agent directly or by adding auxiliary materials permitted in the field of microbial preparations, or the bacteria in the bacterial liquid can be collected and mixed with auxiliary materials permitted in the field of microbial preparations such as lyophilization protective agents and then prepared as a dry powder bacterial agent by vacuum freeze-drying.

[0012] In a third aspect, the present invention provides a method for preparing the bacterial agent, comprising: Eubacterium mucilaginosum E11405 was inoculated into the culture medium for fermentation.

[0013] Furthermore, the culture medium is a reinforced clostridial medium (RCM), and the fermentation culture conditions include: culturing at 35-40° C. and anaerobic conditions for 36-60 hours.

[0014] In a fourth aspect, the present invention provides a product, comprising the aforementioned Eubacterium mucosum El 1405, or the aforementioned bacterial agent, or a product prepared by the aforementioned preparation method; the product is preferably an antibacterial agent or a drug.

[0015] In a fifth aspect, the present invention provides the aforementioned Eubacterium mucosum El 1405, or the use of the aforementioned bacterial agent in inhibiting microorganisms; the microorganisms include one or more of Listeria monocytogenes, Staphylococcus aureus, Salmonella typhimurium or Escherichia coli.

[0016] The present invention further provides the use of the aforementioned Eubacterium mucosum E11405 or the aforementioned bacterial agent in the preparation of an antibacterial agent for inhibiting microorganisms; the microorganisms include one or more of Listeria monocytogenes, Staphylococcus aureus, Salmonella typhimurium or Escherichia coli.

[0017] The present invention further provides the use of the aforementioned Eubacterium mucilaginosum E11405 or the aforementioned bacterial agent in the preparation of a product for any of the following applications: i) inhibiting salmonella infection, ii) anti-inflammatory, iii) Prevention and treatment of inflammatory bowel disease, iv) Resist intestinal mucosal damage.

[0018] Furthermore, the inflammatory bowel disease is ulcerative colitis or Crohn's disease.

[0019] Furthermore, the inhibition of Salmonella infection includes: inhibiting weight loss, reducing the load of Salmonella, reducing the level of inflammatory factors or increasing the level of anti-inflammatory factors.

[0020] Furthermore, the reduction of inflammatory factors is the reduction of inflammatory factors in the serum of Salmonella-infected mice and DSS-induced colitis mice, and the inflammatory factors include: tumor necrosis factor-α (TNF-α), serum interleukin-1β (IL-1β), interleukin-17 (IL-17), interleukin-6 (IL-6) and lipopolysaccharide (LPS).

[0021] Furthermore, the anti-inflammatory factors include interleukin-10 (IL-10).

[0022] Furthermore, in addition to Eubacterium mucosum E11405, the aforementioned medicine may also contain other effective ingredients having preventive and therapeutic effects on Salmonella infection or inflammatory bowel disease, and / or contain carriers or excipients permitted in the pharmaceutical field.

[0023] The present invention has the following beneficial effects: The present invention screened and obtained a strain of Eubacterium mucosum E11405, which has an inhibitory effect on Escherichia coli, Salmonella, Staphylococcus aureus and Listeria monocytogenes. Animal experiments have verified that Eubacterium mucosum E11405 can alleviate the infection symptoms of mice caused by Salmonella typhimurium SL1344, resist the trend of weight loss in mice, and reduce the bacterial load in the liver and spleen of mice infected with Salmonella typhimurium SL1344, and is suitable for being used as a probiotic preparation to alleviate Salmonella infection, providing a new strategy for the prevention and treatment of Salmonella, and has potential clinical application prospects.

[0024] In addition, the DSS-induced colitis mouse model verified that the mucoid Eubacterium El1405 provided by the present invention can also relieve symptoms such as diarrhea and bloody stools in mice, reduce the disease activity index, reduce the degree of colon shortening, relieve colon tissue pathological changes, and reduce intestinal mucosal damage and inflammatory response in colitis mice. The strain has preventive and therapeutic effects on inflammatory bowel disease, provides a new strategy for the prevention and treatment of inflammatory bowel disease, and has potential clinical application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0026] Figure 1 This is a graph showing the gelatinase activity test results provided in Example 2 of the present invention; the positive control is Staphylococcus aureus ATCC 25923, and the negative control is Lactobacillus rhamnosus LGG.

[0027] Figure 2 : This is a graph showing the effect of Eubacterium mucosum E11405 provided in Example 3 of the present invention on the body weight of mice infected with Salmonella; wherein A is a graph showing the weight change trend of mice over 14 days; B is a statistical analysis of the body weight of mice on the 6th day, with the results shown as x±SD; *: P<0.05; **: P<0.01; ***: P<0.001; ****: P<0.0001, N=8.

[0028] Figure 3 This is a statistical analysis diagram of the Salmonella load in the liver of mice provided in Example 3 of the present invention, and the results are shown as x±SEM; *: P<0.05; N=6.

[0029] Figure 4 This is a statistical analysis diagram of the Salmonella load in the spleen of mice provided in Example 3 of the present invention, and the results are shown as x±SEM; *: P<0.05; N=6.

[0030] Figure 5 The factor level diagram of each group of mouse serum provided in Example 3 of the present invention, the results are shown as x±SEM; *: P<0.05; **: P<0.01; ***: P<0.001; ****: P<0.0001; N=8.

[0031] Figure 6The factor level diagram of the ileum of each group of mice provided in Example 3 of the present invention, the results are displayed as x±SEM; *: P<0.05; **: P<0.01; ***: P<0.001; ****: P<0.0001; N=8.

[0032] Figure 7 Schematic diagram of colon and statistical diagram of colon length provided in Example 4 of the present invention, the results are shown as x±SEM; *: P<0.05; **: P<0.01; ***: P<0.001; ****: P<0.0001; N=8.

[0033] Figure 8 The H&E stained pathological sections of the mouse colon provided in Example 4 of the present invention (scale: 200 μm; 50 μm) and the statistical analysis of the pathological scores are shown in x±SEM; *: P<0.05; **: P<0.01; ***: P<0.001; ****: P<0.0001; N=5.

[0034] Fig. 9 The levels of various factors in the serum of each group of mice provided in Example 4 of the present invention are shown as x±SEM; *: P<0.05; **: P<0.01; ***: P<0.001; ****: P<0.0001; N=8. DETAILED DESCRIPTION

[0035] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be clearly and completely described below in conjunction with the drawings of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0036] The experimental methods involved in the following examples, unless otherwise mentioned, are all conventional methods in the art, for example, reference may be made to experimental manuals in the art, or the conditions recommended in the manufacturer's instructions.

[0037] Unless otherwise specified, the experimental materials and reagents involved in the following examples can be obtained from commercial sources, for example: Example 1 Isolation and identification of strains 1. Strain Isolation Take an appropriate amount of healthy human fecal samples frozen in a -80 ℃ refrigerator and slowly thaw them on ice. After gradient dilution with PBS, transfer 100 μL of sample suspensions of different dilutions to RCM medium, spread evenly, and culture at 37 ℃ under anaerobic conditions for 2 days. Pick colonies with different morphological characteristics for subculture purification, and transfer three times in a row. The purified strains can be used for experiments or frozen storage.

[0038] The present invention isolated a strain of Eubacterium mucosum (named E11405) from a healthy human fecal sample, and evaluated the antibiotic sensitivity of the strain. The results showed that the strain was sensitive to all tested antibiotics except penicillin resistance, and the strain was tested for its efficacy in alleviating Salmonella infection in mice (all test methods refer to Examples 2-4).

[0039] 2. Preservation of strains RCM liquid culture medium containing 20% ​​glycerol was used as the bacterial preservation solution for cryopreservation of the strains. The method was as follows: 1.5 mL of the bacterial preservation solution was added to a 2 mL bacterial preservation tube, and the tube was sterilized by high pressure sterilization at 121 °C for 15 min for use. After the strain was transferred to the RCM solid culture medium for three consecutive times, a sterile inoculation loop was used to scrape the bacteria into the bacterial preservation tube and fully blend it into the bacterial preservation solution, and then the tube was frozen at -80 °C after mixing.

[0040] 3. Identification of strain 16S rRNA gene Extract bacterial genomic DNA, amplify the 16S rRNA gene of the isolated strain using universal primers for the 16S rRNA gene (27F: AGAGTTTGATCCTGGCTCA; 1492R: AAGTCGTAACAAGGTAGCCGT), sequence the PCR amplification product, and perform BLAST comparison on the NCBI online database. The PCR reaction conditions and the composition of the PCR system (30 μL) are as follows: PCR reaction system (30 μL): Premix Taq, 15 μL; ddH2O, 12 μL; upstream and downstream primers, 1 μL each; genomic DNA, 1 μL.

[0041] PCR amplification conditions: 94 °C pre-denaturation, 5 min; 94 °C denaturation, 0.5 min, 55 °C annealing, 0.5 min, 72 °C extension, 0.5 min, 30 cycles; 72 °C final extension, 1 min.

[0042] The sequencing results showed that the strain 16S rRNA gene sequence (SEQ ID NO.1) was:

[0043] The sequencing results of the strains to be tested were compared by BLAST on NCBI. The results showed that the sequence identity between the strain E11405 to be tested and the type strain of Eubacterium mucosum ATCC 8486 was 99.87%, which exceeded the interspecies threshold of 98.75%. Therefore, it was determined that the isolated strains were all Eubacterium mucosum strains.

[0044] Eubacterium mucilaginosa ( Eubacterium limosum ) El1405 was deposited on July 3, 2024 at the General Microbiology Center of the China Microbiological Culture Collection Administration (CGMCC, address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code 100101), and was classified and named Eubacterium mucosum Eubacterium limosum , the deposit number is CGMCC No.31231.

[0045] Example 2 Characteristic Analysis of Eubacterium mucosum E11405 1. Antibiotic sensitivity test of Eubacterium mucosum E11405 According to the Clinical and Laboratory Standards Institute (CLSI) M100 standard, the antibiotics recommended for testing anaerobic bacteria, namely penicillin, ampicillin, imipenem, meropenem, amoxicillin, ceftriaxone sodium, clindamycin, moxifloxacin, metronidazole, and tetracycline, were selected to conduct antibiotic sensitivity test on Eubacterium mucosum El1405. Bacteroides fragilis ATCC 25285 was used as the quality control strain (QC), and the antibiotic concentration gradient method (E-test method) was used to read its minimum inhibitory concentration (MIC) value.

[0046] The results are shown in Table 1, where S represents sensitive and R represents resistant. Except for penicillin resistance, the Eubacterium mucosum E11405 strain is sensitive to the other 9 selected antibiotics and has a high safety.

[0047] Table 1 Antibiotic susceptibility results of Eubacterium mucosum CGMCC No.31231

[0048] 2. Gelatinase activity test of Eubacterium mucilaginosum E11405 Prepare 3% gelatin-RCM medium: Add 3% gelatin to RCM solid medium and sterilize by autoclave. Adjust the concentration of Eubacterium mucosum El1405 to 1×10 8 CFU / mL, drop 10 μL on the culture medium, culture under anaerobic conditions at 37 ℃ for 48 h until colonies are formed, pour saturated ammonium sulfate on the plate, and observe the halo immediately; use Staphylococcus aureus ATCC25923 as a positive control and Lactobacillus rhamnosus LGG as a negative control. The results are as follows Figure 1 As shown, the gelatinase activity test of Eubacterium mucosum E11405 was negative.

[0049] 3. Biochemical identification of Eubacterium mucosum E11405 The biochemical reaction identification of Eubacterium mucosum E11405 was carried out using the bacterial system biochemical identification card API 50CHB / E produced by BioMérieux. The results are shown in Table 2.

[0050] Table 2 Biochemical characteristics identification results

[0051] Note: +, positive; -, negative; w, weak positive 4. Antibacterial test of Eubacterium mucilaginosum El1405 The antibacterial test of Eubacterium mucosum E11405 was carried out by agar superposition method. The concentration of Eubacterium mucosum E11405 was adjusted to 1×10 8 CFU / mL, aspirate 10 μL and drop it on the RCM plate, and culture it at 37 °C under anaerobic conditions for 24 h until colonies are formed.

[0052] Adjust the concentration of pathogenic bacteria to be tested to 1×10 9 CFU / mL, 0.1% was added to LB medium containing 0.6% agar, mixed and covered on the RCM plate formed by colony, and after drying, cultured at 37°C under aerobic conditions for 4-12 h (the culture time depends on the growth rate of the pathogenic bacteria). The antibacterial results of Eubacterium mucosum E1405 are shown in Table 3, indicating that Eubacterium mucosum E1405 has inhibitory effects on Escherichia coli, Salmonella, Staphylococcus aureus and Listeria monocytogenes.

[0053] Table 3 Antibacterial properties of Eubacterium mucilaginosum E11405

[0054] 5. Antibacterial test of fermentation supernatant of Eubacterium mucilaginosum CGMCC No.31231 The concentration was 1×10 8 CFU / mL of Eubacterium mucosum El1405 was inoculated into RCM liquid culture medium at a ratio of 1:100, cultured at 37 °C under anaerobic conditions for 48 h, and centrifuged at 8000 r / min for 10 min to collect the supernatant. The fermentation supernatant was concentrated to 10× concentrate using a high-speed freeze dryer, and the concentrated supernatant was filtered using a 0.22 μM filter membrane to obtain 10× sterile fermentation supernatant.

[0055] The Oxford cup method was used to conduct an antibacterial test on the fermentation supernatant of Eubacterium mucosum El1405 that was concentrated 10 times. First, LB medium containing 1.5% agar was prepared, and a thin layer was poured on the culture dish. After drying, a high-pressure sterilized Oxford cup was placed, and then filled with LB medium. After drying, the Oxford cup was taken out with high-pressure sterilized tweezers.

[0056] Adjust the concentration of pathogenic bacteria to be tested to 1×10 9 CFU / mL, spread on LB with a cotton swab, add 200 μL of concentrated fermentation supernatant into the well, culture at 37 ℃ for 12 h, set RCM medium as negative control, the antibacterial results of Eubacterium mucosum E11405 fermentation supernatant are shown in Table 4, indicating that Eubacterium mucosum E11405 fermentation supernatant has inhibitory effect on Escherichia coli, Salmonella and Staphylococcus aureus.

[0057] Table 4 Antibacterial properties of the fermentation supernatant of Eubacterium mucilaginosum E11405

[0058] Example 3 The alleviating effect of Eubacterium mucosum E11405 on Salmonella infection in mice 1. Construction of Salmonella infection mouse model: Female BALB / c mice (5-6 weeks old, 15-17 g) were purchased from Beijing Weitonglihua Experimental Animal Technology Co., Ltd. The mice were housed at 23 ± 2°C, 55% ± 5°C relative humidity, 12 h light-dark cycle, and specific pathogen-free conditions.

[0059] At the end of the 3-day adaptation period, the mice were randomly divided into 3 groups (8 mice in each group). From day -7 to day 6, each mouse was intragastrically administered with (1) NC control group: 0.2 mL PBS; (2) PBS model group: 0.2 mL PBS; (3) El1405 intervention group: 0.2 mL Eubacterium mucosum El1405 (1×10 8 CFU / 0.2 mL, suspended in PBS solution) by gavage. On day 0, each mouse in group (2) and group (3) was given 1×10 8 CFU of Salmonella typhimurium SL1344. The body weight of mice was measured daily, and mice were killed on the 6th day to collect serum, liver and spleen. 0.1 g of liver and spleen were weighed and added to 1 mL PBS and 3 mm steel beads to grind into tissue homogenate. Salmonella selective medium with streptomycin (50 μg / mL) was prepared to count the colonies of Salmonella in the liver and spleen of mice.

[0060] 2. Experimental results: The effects of Eubacterium mucilaginosum E11405 on the body weight of mice infected with Salmonella are shown in Tables 5 and Figure 2As shown. After pre-gavage with PBS or Eubacterium mucosum El1405 for seven days (Day-7~Day-1), no mice died in the three groups, and there was no difference in body weight between the PBS group and the NC group (P>0.05). On days 4-6, the weight of mice in the NC group was significantly higher than that in the PBS group (P<0.05); on day 6, the weight of mice in the El1405 group was significantly higher than that in the PBS group (P<0.05), proving that Eubacterium mucosum El1405 has the function of resisting the weight loss of mice infected with Salmonella.

[0061] Table 5 Daily body weight statistics of experimental mice (g)

[0062] Note: Compared with the PBS group, *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001.

[0063] like Figure 3 As shown, the Salmonella load in the liver of mice in the Eubacterium mucosum El1405 group was significantly lower than that in the liver of mice in the PBS group (P<0.05).

[0064] like Figure 4 As shown, the Salmonella load in the spleen of mice in the Eubacterium mucosum E11405 group was significantly lower than that in the spleen of mice in the PBS group (P<0.05), indicating that Eubacterium mucosum E11405 reduced the Salmonella load in the internal organs of mice infected with Salmonella.

[0065] The results are shown in Table 6, Table 7, Figure 5 and Figure 6 As shown: Compared with the NC group, the levels of inflammatory factors such as tumor necrosis factor-α (TNF-α), serum interleukin-1β (IL-1β), and interleukin-6 (IL-6) in the serum and ileum of mice in the PBS group were significantly increased (P<0.0001).

[0066] Compared with those in the PBS group, the levels of tumor necrosis factor-α (TNF-α, P<0.0001 in serum and P<0.001 in ileum), serum interleukin-1β (IL-1β, P<0.01 in serum and P<0.0001 in ileum), and interleukin-6 (IL-6, P<0.0001) in the serum and ileum of mice in the El1405 group were significantly decreased.

[0067] Compared with the NC group, the levels of anti-inflammatory factors such as interleukin-10 (IL-10) in the serum and ileum of mice in the PBS group were significantly decreased (P<0.01 in serum, P<0.0001 in ileum). Compared with the PBS group, the levels of interleukin-10 (IL-10) in the serum and ileum of mice in the El1405 group were significantly increased (P<0.05 in serum, P<0.0001 in ileum).

[0068] The results showed that Eubacterium mucosum El1405 reduced TNF-α by more than 30.3% and 23.6%, reduced IL-1β by more than 13.8% and 45.8%, reduced IL-6 by more than 18.3% and 24.1%, and increased IL-10 by more than 25.3% and 58.3%.

[0069] Table 6 Concentrations of inflammatory factors in mouse serum (pg / mL)

[0070] Note: Compared with the PBS group, *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001.

[0071] Table 7 Concentrations of inflammatory factors in mouse ileum (pg / mL)

[0072] Note: Compared with the PBS group, *, P<0.05; **, P<0.01; ***, P<0.001****, P<0.0001.

[0073] Example 4 Eubacterium mucosum E11405 improves DSS-induced colitis in mice 1. Construction of DSS-induced colitis model in mice: Female C57BL / 6J mice (5-6 weeks old, 16-18 g) were purchased from Beijing Weitong Lihua Experimental Animal Technology Co., Ltd. The mice were housed at 23±2℃, 55%±5℃ relative humidity, 12 h light-dark cycle, and specific pathogen-free conditions. At the end of the 3-day adaptation period, the mice were randomly divided into 3 groups (8 mice in each group). From day -7 to day 6, each mouse was gavaged with (1) NC control group: 0.2 mL PBS (2) PBS model group: 0.2 mL PBS (3) El1405 intervention group: 0.2 mL Eubacterium mucosum El1405 (1×10 8 CFU / 0.2mL, suspended in PBS solution) was gavaged. From day 0 to day 6, 3% ( w / v)DSS. The body weight, fecal characteristics, and occult blood status of mice were recorded daily, and the disease activity index (DAI) was calculated according to the scoring criteria shown in Table 8.

[0074] DAI = score obtained by weight loss + score obtained by stool characteristics + score obtained by occult blood status.

[0075] Table 8 Disease Activity Index Scoring Criteria

[0076] After the experiment, the length of the mouse colon was measured, and the distal colon was taken and immersed in 4% paraformaldehyde for subsequent histopathological analysis. The pathological scoring criteria are shown in Table 9.

[0077] Table 9 Pathological scoring criteria

[0078] 2. Experimental results: The effect of Eubacterium mucilaginosum El1405 on the body weight of colitis mice is shown in Table 10. After pre-oral administration of PBS or Eubacterium mucilaginosum El1405 for seven days (Day-7~Day-1), there was no difference in body weight between the PBS group and the NC group (P>0.05). From the 4th day, the body weight of mice in the PBS group began to decrease, and the body weight of mice in the NC group was significantly higher than that of mice in the PBS group (P<0.01); on the 6th day, the body weight of mice in the El1405 group was significantly higher than that of the PBS group (P<0.05), proving that Eubacterium mucilaginosum El1405 has the function of resisting the weight loss of mice with colitis.

[0079] Table 10 Daily body weight statistics of mice in each group (g)

[0080] Note: Compared with the PBS group, *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001.

[0081] Table 11 shows that the DAI scores of mice in the NC control group were significantly lower than those in the PBS model group from the second day (P<0.05) and continued until the end of the experiment; the DAI scores of the El1405 intervention group were significantly lower than those in the PBS group on the third and sixth days (P<0.05).

[0082] Table 11 DAI score table

[0083] Note: Compared with the PBS group, *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001.

[0084] Table 12 Colon length and pathological score

[0085] Note: Compared with the PBS group, *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001.

[0086] Table 12 shows the colon length of each group. Figure 7 The statistical graph of mouse colon showed that the colon length of PBS group and E11405 group was significantly shorter than that of NC group, and the colon of E11405 group was significantly longer than that of DSS group (P<0.01), which proved that Eubacterium mucosum E11405 had the ability to resist the shortening of colon in colitis mice.

[0087] The histopathological results are shown in Table 12. The total pathological score of the E11405 intervention group was significantly lower than that of the PBS model group (P < 0.001); Figure 8 The results show the effect of Eubacterium mucosum El1405 on the pathological changes of colonic tissue in DSS-induced colitis model mice. In the PBS model group, ulcers were widely observed in the colonic tissue, a small amount of lymphocytes, granulocytes and necrotic cell fragments were observed in the intestinal cavity, the mucosal epithelium and intestinal gland structure disappeared, goblet cells disappeared, a large amount of connective tissue proliferated, scattered lymphocytes, granulocytes and macrophages infiltration were widely observed, edema was widely observed in the submucosal layer, the connective tissue was loosely arranged, the blood vessels were dilated, and a large number of scattered lymphocytes, granulocytes and macrophages infiltrated; compared with the PBS model group, the El1405 intervention group showed milder pathological symptoms, and pathological phenomena such as crypt damage and abscesses, connective tissue hyperplasia, goblet cell disappearance and intestinal mucosal structure destruction were alleviated, and the inflammatory response was mild. The above results show that Eubacterium mucosum El1405 can alleviate the pathological changes of colonic tissue.

[0088] The results are shown in Table 13. Fig. 9 As shown, compared with those in the NC group, the levels of inflammatory factors in the serum of the mice in the PBS group, such as tumor necrosis factor-α (TNF-α, P<0.01), serum interleukin-1β (IL-1β, P<0.01), serum interleukin-17 (IL-17, P<0.0001), interleukin-6 (IL-6, P<0.001), and lipopolysaccharide (LPS, P<0001), were significantly increased; compared with those in the PBS group, the levels of TNF-α (P<0.001), IL-1β (P<0.05), IL-17 (P<0.001), LPS (P<0.001), and IL-6 (P<0.001) in the serum and ileum of the mice in the El1405 group were significantly decreased; Compared with the NC group, the levels of anti-inflammatory factors such as interleukin-10 (IL-10) in the serum and ileum of mice in the PBS group were significantly reduced (P<0.05); compared with the PBS group, the levels of IL-10 in the serum and ileum of mice in the El1405 group were significantly increased (P<0.05). The above results indicate that Eubacterium mucosum El1405 has the effect of reducing the levels of inflammatory factors in the serum of colitis mice and increasing the levels of serum anti-inflammatory factors.

[0089] Table 13 Concentrations of inflammatory factors in serum of colitis mice (pg / mL)

[0090] Note: Compared with the PBS group, *, P<0.05; **, P<0.01; ***, P<0.001****, P<0.0001.

[0091] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A mucoid bacterium ( Eubacterium limosum ) E11405, characterized in that The deposit number of the Eubacterium mucilaginosum E11405 is CGMCC No.31231.

2. A bacterial agent, characterized in that The method comprises the Eubacterium mucilaginosum E11405 or a fermentation product thereof as described in claim 1.

3. The bacterial agent according to claim 2, characterized in that The bacterial agent is a solid bacterial agent, a liquid bacterial agent or a microbial bacterial agent, and the total viable count of the Eubacterium mucilaginosum El1405 in the bacterial agent is 1×10 7-10 CFU / mL.

4. The method for preparing the bacterial agent according to claim 2 or 3, characterized in that: include: Eubacterium mucilaginosum E11405 was inoculated into the culture medium for fermentation.

5. The preparation method according to claim 4, characterized in that: The culture medium is a reinforced Clostridium culture medium, and the fermentation culture conditions include: culturing at 35-40° C. and under anaerobic conditions for 36-60 hours.

6. A product, characterized in that The product comprises the Eubacterium mucilaginosum E11405 as described in claim 1, or the bacterial agent as described in claim 2 or 3, or is prepared by the preparation method as described in claim 4 or 5; the product is preferably an antibacterial agent or a drug.

7. Use of the Eubacterium mucosum E11405 described in claim 1, or the bacterial agent described in claim 2 or 3 in inhibiting microorganisms; the microorganisms include one or more of Listeria monocytogenes, Staphylococcus aureus, Salmonella typhimurium or Escherichia coli.

8. Use of the Eubacterium mucilaginosum E11405 according to claim 1, or the bacterial agent according to claim 2 or 3, in the preparation of a product for any of the following applications: i) inhibiting salmonella infection, ii) anti-inflammatory, iii) Prevention and treatment of inflammatory bowel disease, iv) Resist intestinal mucosal damage.

9. The use according to claim 8, characterized in that: The inflammatory bowel disease is ulcerative colitis or Crohn's disease.

10. The use according to claim 8, characterized in that: The inhibition of Salmonella infection includes: inhibiting weight loss, reducing the load of Salmonella, reducing the level of inflammatory factors or increasing the level of anti-inflammatory factors.

Images