Low-toxicity condition-dependent reverse neural circuit traced recombinant pseudorabies virus as well as preparation method and application thereof

Abstract

The invention discloses a low-toxicity condition-dependent recombinant pseudorabies virus traced by a reverse neural circuit as well as a preparation method and application of the low-toxicity condition-dependent recombinant pseudorabies virus. The recombinant pseudorabies virus is obtained by packaging a polygene expression module containing a pseudorabies virus PRV Bartha homologous arm, a Ubc promoter and a 2A peptide sequence and a carrier plasmid of an expression cassette for expressing blue fluorescent protein; the 2A peptide sequence is a combination of P2A, F2A and T2A sequences. The recombinant pseudorabies virus PRV911 disclosed by the invention has remarkable low toxicity and can be used for efficiently tracing for a long time (more than 10 days). Besides, the PRV911 can realize accurate neuron type selective marking through conditional start (Cre-loxP system), so that an upstream input neural circuit is accurately tracked, the specificity and accuracy of neural circuit tracing are greatly improved, and a brand-new tool is provided for research of neural functions and disease mechanisms.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a low-toxic condition-dependent reverse neural circuit tracing recombinant pseudorabies virus and a preparation method and application thereof. Background Art

[0002] The complexity of the human brain makes the study of brain structure and function one of the core challenges in the scientific field. The precise connection of brain neural networks is the basis for achieving advanced cognitive functions, such as memory formation, emotion regulation and decision making. However, when the connection or function of neural networks is abnormal, it often leads to a series of neurological diseases, such as autism spectrum disorder, epilepsy and schizophrenia. Despite great progress in molecular biology and imaging technology, the understanding of the specific connection mode and function of neural networks is still limited. This knowledge gap seriously hinders the development of new diagnostic and therapeutic methods. In order to further explore the functional characteristics of neural circuits, scientists have gradually adopted tools such as genetic labeling, optogenetics and viral tracing to try to draw a detailed brain functional connection map. However, these methods still have problems such as insufficient labeling specificity, limited resolution and greater interference with experimental animals. Therefore, the development of a neural circuit tracing tool that is both efficient and specific, especially a tool that can accurately track specific neuronal types, will greatly promote the progress of brain science research.

[0003] In recent years, the focus of neuroscience research has gradually shifted from the functional study of single neurons to the analysis of more complex hierarchical connections of neural networks. In order to explore how neural networks coordinate to achieve advanced brain functions, scientists have widely used viral tools to track the connections between neurons. Pseudorabies virus (PRV), as a viral tool with neural affinity, is widely used in the tracing study of neural circuits because of its ability to spread across synapses. Studies have found that PRV has a high neural affinity and does not infect humans, giving it significant advantages in terms of safety and effectiveness. However, the PRV tracing tools currently used still have deficiencies in selectively labeling specific neuronal types and controlling toxicity, which may cause unnecessary damage to the traced neurons, thereby affecting the accuracy of the experimental results. Therefore, the development of a new PRV tool with low toxicity, high specificity, and the ability to achieve precise tracing through conditional activation is an important direction in the field of neural network research, providing strong technical support for the comprehensive analysis of brain functional connections and the mechanisms of neurological diseases. Summary of the invention

[0004] In view of the defects in the prior art, the present invention proposes a preparation method and application of a low-toxic, conditionally-dependent, reverse neural circuit tracing recombinant pseudorabies virus.

[0005] The present invention discloses a low-toxic condition-dependent recombinant pseudorabies virus for reverse neural circuit tracing, wherein the recombinant pseudorabies virus is obtained by packaging a multi-gene expression module containing a pseudorabies virus PRV Bartha homology arm, a Ubc promoter, a 2A peptide sequence, and a vector plasmid for expressing an expression frame for a blue fluorescent protein;

[0006] The 2A peptide sequence is a combination of P2A, F2A and T2A sequences.

[0007] In some embodiments, the multi-gene expression module of the 2A peptide sequence repeatedly expresses mNeonGreen fluorescent protein.

[0008] In some embodiments, the backbone of the vector plasmid is an adeno-associated viral vector, and the adeno-associated viral vector comprises a Cre-loxP system.

[0009] The present invention also provides a method for preparing the recombinant pseudorabies virus, comprising the following steps:

[0010] S1: insert the left homology arm of PRV Bartha, Ubc promoter, multi-gene expression module of 2A peptide sequence, expression frame of blue fluorescent protein and the right homology arm of PRV Bartha into the vector plasmid in sequence to obtain a recombinant plasmid;

[0011] S2: The recombinant plasmid obtained in S1 is transfected into BHK21 cells, which are then infected with pseudorabies virus PRV Bartha, and the supernatant of the cell culture medium is collected and purified to obtain the recombinant pseudorabies virus.

[0012] In some embodiments, the vector plasmid is an adeno-associated viral vector, and the adeno-associated viral vector is AAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA.

[0013] In some implementations, the step S1 is specifically:

[0014] S1-1: The vector plasmid was treated with MluI and MfeI enzymes, and the nucleotide sequence of the left homologous arm of PRV Bartha was inserted into the vector by homologous recombination to obtain the first clone;

[0015] S1-2: The first clone was treated with MluI and KpnI double restriction enzymes, and the nucleotide sequence of the Ubc promoter was inserted into the vector by homologous recombination to obtain a second clone;

[0016] S1-3: The second clone was treated with double restriction enzymes BstEII and RsrII, and the nucleotide sequence of the right homologous arm of pseudorabies virus PRV Bartha was inserted into the vector by homologous recombination to obtain the third clone;

[0017] S1-4: The third clone was treated with double restriction enzymes BstEII and RsrII, and the nucleotide sequence of the expression frame expressing the blue fluorescent protein was inserted into the vector by homologous recombination to obtain the fourth clone;

[0018] S1-4: The fourth clone was treated with MfeI and EcoRI double enzyme digestion, and the nucleotide sequence of the multi-gene expression module of the 2A peptide sequence was inserted into the vector by homologous recombination to obtain a recombinant plasmid.

[0019] In some embodiments, the nucleotide sequence of the left homology arm of the pseudorabies virus PRV Bartha is shown as SEQ ID NO.3;

[0020] The nucleotide sequence of the Ubc promoter is shown in SEQ ID NO.6;

[0021] The nucleotide sequence of the right homology arm of the pseudorabies virus PRV Bartha is shown in SEQ ID NO.9;

[0022] The nucleotide sequence of the expression frame for expressing blue fluorescent protein is shown in SEQ ID NO.12;

[0023] The nucleotide sequence of the multi-gene expression module of the 2A peptide sequence is shown in SEQ ID NO.15.

[0024] The present invention also provides the use of the recombinant pseudorabies virus in any of the following:

[0025] (1) preparing pseudorabies virus vaccine;

[0026] (2) Preparation and regulation of pseudorabies virus inhibition products.

[0027] The present invention also provides the use of the recombinant pseudorabies virus in any of the following:

[0028] (1) Application in tracing brain neural circuits in mammals;

[0029] (2) Application in studying the mechanism of drug inhibition of pseudorabies virus;

[0030] (3) Application in the development of pseudorabies virus vaccines;

[0031] (4) Application in establishing animal models of pseudorabies virus infection;

[0032] (5) Application in analyzing the replication and pathogenic mechanism of pseudorabies virus;

[0033] (6) Application in establishing a drug screening platform for pseudorabies virus.

[0034] In summary, compared with the prior art, the present invention achieves the following technical effects:

[0035] 1. Compared with the traditional pseudorabies viruses PRV531 and PRV532, the recombinant pseudorabies virus PRV911 of the present invention has significantly lower toxicity and can be efficiently traced for a long time (more than 10 days) without damaging the target neurons. It has high application value in neural circuit research, especially in the study of complex neural networks, and can effectively reduce the interference with neurons. In addition, PRV911 can achieve accurate selective labeling of neuron types through conditional activation (Cre-loxP system), thereby accurately tracking upstream input neural circuits, greatly improving the specificity and accuracy of neural circuit tracing, and providing a new technical tool for the study of neural function and disease mechanisms.

[0036] 2. The present invention has important practical significance and broad application value for conducting basic research (such as pathogenic mechanism, replication mechanism, etc.) and applied research (such as neural circuit labeling, drug screening, antigen epitope analysis, new vaccines and diagnostic reagents, etc.) on pseudorabies virus.

[0037] 3. Analyzing the structure of neural circuits is the basis for conducting brain science research. Good tools for labeling neural circuits are of great significance for analyzing the structure of neural circuits. The low-toxic conditionally dependent recombinant pseudorabies virus of the present invention can infect the nerve cells of animals such as mice and can be used as a neural circuit labeling tool. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0039] Figure 1 Schematic diagram of the construction of the recombinant pseudorabies virus of the present invention; wherein A is a schematic diagram of the recombinant pseudorabies virus with low toxicity and conditional dependence; B is a schematic diagram of the working of the recombinant pseudorabies virus with low toxicity and conditional dependence;

[0040] Figure 2Schematic diagram of fluorescence expression of the recombinant pseudorabies virus of the present invention; wherein A is a cell infected with the virus expressing blue fluorescence; B is a cell infected with the recombinant pseudorabies virus without Cre (-Cre) and with Cre (+Cre) expressing fluorescent protein;

[0041] Figure 3 The results of animal survival after infection with the recombinant pseudorabies virus of the present invention; analysis of survival time after virus injection into C57BL / 6J mice and DAT-Cre mice;

[0042] Figure 4 The figure is a schematic diagram of the recombinant pseudorabies virus of the present invention analyzing the neural circuit of the mouse brain; wherein A is a schematic diagram of the VTA region of C57BL / 6J mice marked by the recombinant pseudorabies virus; B is a schematic diagram of the ventral tegmental area (VTA) and piriform cortex (PIR) of DAT-Cre mice marked by the recombinant pseudorabies virus. DETAILED DESCRIPTION

[0043] In order to enable those skilled in the art to better understand the scheme of the present invention, the technical scheme in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only embodiments of a part of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work should fall within the scope of protection of the present invention.

[0044] The present invention discloses a low-toxic condition-dependent reverse neural circuit tracing recombinant pseudorabies virus, which can infect nerve cells of animals such as mice and can be used as a neural circuit marking tool. The application objects are not limited to mice, but can also be used for neural circuit marking of animals such as pigs; the green fluorescent protein gene used in the present invention is only used as a paradigm, therefore, other exogenous genes can also be used to replace the green fluorescent protein gene of the present invention.

[0045] Example 1 Preparation of low-toxic recombinant pseudorabies virus for reverse neural circuit tracing

[0046] (1) Construction of clones:

[0047] Using the recombinant pseudorabies virus PRV Bartha strain (Jia F et al., Front Neuroanat. 2019, 13: 63.) as a template, PCR amplified the left and right homologous arms required for virus recombination (sequences are shown in SEQ ID NO.3 and SEQ ID NO.9). At the same time, PCR amplified the broad-spectrum promoter Ubc (SEQ ID NO.6), the expression frame CMV-nlsmtagBFP-bGHpA (SEQ ID NO.12) expressing blue fluorescent protein, and the mNeonGreen-P2A-mNeonGreen-F2A-mNeonGreen-T2A-modTK (SEQ ID NO.15) fragment, and used enzyme digestion and recombination to obtain the fragments. Figure 1 The above genes were spliced ​​sequentially using the vector AAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA (Addgene, 20298#).

[0048] The primers for PCR amplification are as follows:

[0049] The primers for the left homology arm of the DNA fragment are: SEQ ID NO.1 and SEQ ID NO.2, and the template is the genome of PRV Bartha; the primers for the Ubc promoter of the DNA fragment are: SEQ ID NO.4 and SEQ ID NO.5, and the template is pUC57-Ubc, and the template comes from the pUC57 plasmid containing the Ubc promoter (the plasmid is a synthetic Ubc sequence inserted into the pUC57 vector); the primers for the right homology arm of the DNA fragment are: SEQ ID NO.7 and SEQ ID NO.8, and the template is the genome of PRV Bartha; the primers for the CMV-nlsmtagBFP-bGHpA of the DNA fragment are: SEQ ID NO.10 and SEQ ID NO.11, the template is pUC57-CMV-nlsmtagBFP-bGHpA (this plasmid is the synthetic CMV-nlsmtagBFP-bGHpA sequence inserted into the pUC57 vector); primers of DNA fragment mNeonGreen-P2A-mNeonGreen-F2A-mNeonGreen-T2A-modTK: SEQ ID NO.13 and SEQ ID NO.14, the template is pUC57-PEST (this plasmid is the synthetic mNeonGreen-P2A-mNeonGreen-F2A-mNeonGreen-T2A-modTK sequence inserted into the pUC57 vector).

[0050] Then the following steps were performed: 1) the constructed vector was treated with MluI and MfeI double digestion, and the nucleotide sequence shown in SEQ ID NO.2 was inserted into the vector by homologous recombination to obtain the first clone; 2) the first clone was treated with MluI and KpnI double digestion, and the nucleotide sequence shown in SEQ ID NO.6 was inserted into the vector by homologous recombination to obtain the second clone; 3) the second clone was treated with BstEII and RsrII double digestion, and the nucleotide sequence shown in SEQID NO.9 was inserted into the vector by homologous recombination to obtain the third clone; 4) the third clone was treated with BstEII and RsrII double digestion, and the nucleotide sequence shown in SEQ ID NO.12 was inserted into the vector by homologous recombination to obtain the fourth clone; 5) the fourth clone was treated with MfeI and EcoRI double digestion, and the nucleotide sequence shown in SEQ ID NO.15 was inserted into the vector by homologous recombination to obtain the fifth clone PS911. All the constructed clones were sequenced and verified in the company.

[0051] (2) Construction of recombinant pseudorabies virus:

[0052] (a) Virus recombination: The plasmid PS911 constructed above was transfected into BHK21 cells by liposome transfection. After 4 hours, DMEM containing 2% FBS was replaced and pseudorabies virus PRV Bartha (Jia F et al., Front Neuroanat. 2019, 13: 63.) was added. The fluorescence expression and cell pathological changes were observed at different times. The culture supernatant (containing virus liquid) was collected 2 days after infection. The virus was named PRV911;

[0053] (b) Virus purification: Using the double-layer plaque assay method, combined with the corresponding characteristics of the plaques (blue) and light-colored spots produced by the fluorescence microscope, pick the light-colored empty plaques containing blue fluorescent spots and add them to freshly cultured BHK21 cells (DMEM containing 2% FBS), and culture them in a 37°C, 5% (v / v) CO2 incubator. After infection, observe the expression of fluorescence and the pathological changes produced by the cells. When the cell pathological changes are obvious and there is visible blue fluorescence, place the culture plate containing the cells at -80°C, thaw at 37°C after 30 minutes, and repeat this process 3 times; repeat the above process until all the fluorescent spots and light-colored empty plaques are completely consistent, indicating that the virus has been purified;

[0054] (c) Virus expansion and concentration: The culture supernatant was collected 2 days after the virus infected BH2K1 cells, centrifuged at 400 g for 10 min, and then filtered through a 0.45 μm filter membrane. The titer of each recombinant virus was detected by the double plaque method. The virus was concentrated by high-speed centrifugation (50,000 g, centrifugation for 2.5 hours). (The virus titer before centrifugation was 5.1×10 6 PFU / mL, the virus titer after centrifugation was 2.7×10 9 PFU / mL) to meet the requirements of animal experiments.

[0055] Example 2 Analysis of Conditional Dependence of Recombinant Pseudorabies Virus

[0056] In order to show that the recombinant pseudorabies virus prepared in Example 1 has conditional dependence of Cre expression, this example will analyze the conditional dependence:

[0057] On the one hand, 5 μL of the recombinant pseudorabies virus PRV911 prepared in Example 1 (the virus titer is 5.1×10 6 PFU / mL) was used to infect BHK21 cells; on the other hand, pNrl-Cre (which can express Cre, 13780#, addgene) was transfected into BHK21 cells, and 5 μL of the recombinant pseudorabies virus PRV911 prepared in Example 1 (the virus titer was 5.1×10 6 PFU / mL) were infected with BHK21 cells expressing Cre and cultured in a 37°C, 5% (v / v) CO2 incubator. The same exposure parameters were used to observe the fluorescence expression after infection.

[0058] The results are as follows Figure 2 As shown, the recombinant virus expressed blue fluorescence after infecting BHK21 cells. After infecting cells expressing Cre (+Cre) and cells without Cre (-Cre), the +Cre group showed green fluorescence, indicating that the recombinant pseudorabies virus PRV911 has conditional dependence on Cre expression.

[0059] Example 3 Toxicity Analysis of Recombinant Pseudorabies Virus PRV911

[0060] In order to show that the toxicity of the present invention is significantly superior to that of the existing system, this example will be analyzed in terms of toxicity:

[0061] Take 0.1 μL of the recombinant pseudorabies virus PRV911 (virus titer is 2.7×10 9 PFU / mL) were injected into the ventral tegmentum (VTA) region of the brains of C57BL / 6J mice and DAT-Cre mice, and the animals were observed after injection.

[0062] The results are as follows Figure 3 As shown, the survival rate of C57BL / 6J mice was not affected after injection of recombinant pseudorabies virus PRV911, but began to drop sharply about 10 days after injection into DAT-Cre mice, becoming lethal and much less toxic than pseudorabies virus PRV531 (Jia F et al., Front Neuroanat. 2019, 13: 63.).

[0063] Example 4 Application of recombinant pseudorabies virus PRV911 in analyzing brain neural circuits

[0064] Take 0.1 μL of the low-toxic condition-dependent recombinant pseudorabies virus PRV911 prepared in Example 1 (the virus titer is 2.7×10 9 PFU / mL) were injected into the VTA region of the brain of C57BL / 6J mice and DAT-Cre mice, respectively. Seven days after infection, the animals were anesthetized and perfused with 0.9% (V / V) normal saline, then fixed with 4% (V / V) paraformaldehyde, the brain tissue was taken out and immersed in 4% (V / V) paraformaldehyde solution, and then placed in 20% (V / V) sucrose solution for 1 day, and then placed in 30% (V / V) sucrose solution for 2 days; the bottom of the brain tissue was cut flat, placed on a base, embedded and frozen for 1 hour, and then sliced; brain slices were picked out and observed using a fluorescence microscope.

[0065] The results are as follows Figure 4 As shown, after the recombinant virus was injected into the brain of C57BL / 6J mice, no green fluorescent protein signal was observed, indicating that the recombinant virus has conditional dependence on Cre expression. After the recombinant virus was injected into the brain of DAT-Cre mice, green fluorescent protein signals were observed, indicating that the recombinant virus can produce virus in the mouse brain and can spread across synapses. At the same time, the virus has the ability to express green fluorescent protein. As shown in VTA ( Figure 4 Middle B) and Piriform cortex (PIR, Figure 4 (B) Both of them expressed green fluorescent protein, indicating that the recombinant virus can be transported in the neural network and has the ability to mark brain neural circuits.

[0066] In summary, the present invention discloses a low-toxic conditionally dependent recombinant pseudorabies virus for reverse neural circuit tracing, and a preparation method and application thereof. The recombinant pseudorabies virus PRV911 of the present invention can perform long-term and efficient tracing without damaging the target neurons, avoiding the toxic side effects that occur when using traditional methods for tracing for a long time, and at the same time, through the conditional activation of the Cre-loxP system, accurate neuron type selective labeling is achieved, which greatly improves the specificity and accuracy of neural circuit tracing. The low-toxic conditionally dependent recombinant pseudorabies virus for reverse neural circuit tracing of the present invention has a wide range of application values ​​in neural circuit labeling, the establishment of a drug screening platform, the mechanism of drug inhibition of virus action, the development of viral vaccines and diagnostic reagents, the establishment of animal models, and the analysis of viral replication and pathogenic mechanisms.

[0067] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

[0068] Sequence Listing

[0069] SEQ ID NO.1

[0070] GGTTCCTGCGGCCGCATGCAGCTCCAGCGCCACCAGGC

[0071] SEQ ID NO.2

[0072] CTCTAGGCACCGGTTCAATTGACGCGTATGCGCATCCCGGCGCGCTTC

[0073] SEQ ID NO.3

[0074]

[0075] AGCGGATCCCCGCCCGGAAGCGCGCCGGGATGCGCAT

[0076] SEQ ID NO.4

[0077] CGCCGGGATGCGCATACGCGTGCGCCGGGTTTTGGCGCCTCC

[0078] SEQ ID NO.5

[0079] GACTCTAGAGGATCCGGTACCTCACGACACCAATTGTCTAACAAAAAAGCCAAAAA

[0080] SEQ ID NO.6

[0081]

[0082] SEQ ID NO.7

[0083] CCTTCTGATTTTGTAGGTAACCACGTGGCGATCGCCCCTCGCCCCTCCCACCCGCG

[0084] SEQ ID NO.8

[0085] GTTCCTGCGGCCGCTCGGTCATCAGGGCCTTGACGTCGCCG

[0086] SEQ ID NO.9

[0087]

[0088] SEQ ID NO.10

[0089] CCTTCTGATTTTGTAGGTAACCGTTGACATTGATTATTGACTA

[0090] SEQ ID NO.11

[0091] TGGGAGGGGCGAGGGGCGATCGCCCATAGAGCCCACCGCATCC

[0092] SEQ ID NO.12

[0093] <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0094] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.13<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0095] <h2 style=";text-align:left;direction:ltr"> GGCTTTTTGTTAGACAATTGGGTGTCGTGAGGTACC<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0096] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.14<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0097] <h2 style=";text-align:left;direction:ltr"> GATAAGCTTGATATCGAATTC<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0098] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.15<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0099]

Claims

1. A low-toxic, conditionally dependent, reverse neural circuit tracing recombinant pseudorabies virus, characterized in that: The recombinant pseudorabies virus is obtained by packaging a vector plasmid containing a pseudorabies virus PRV Bartha homology arm, a Ubc promoter, a 2A peptide sequence multi-gene expression module, and an expression frame for expressing a blue fluorescent protein; The 2A peptide sequence is a combination of P2A, F2A and T2A sequences.

2. The recombinant pseudorabies virus according to claim 1, characterized in that The multi-gene expression module of the 2A peptide sequence repeatedly expresses the mNeonGreen fluorescent protein.

3. The recombinant pseudorabies virus according to claim 1, characterized in that The backbone of the vector plasmid is an adeno-associated virus vector, and the adeno-associated virus vector comprises a Cre-loxP system.

4. The method for preparing the recombinant pseudorabies virus according to any one of claims 1 to 3, characterized in that: The steps include: S1: The left homology arm of PRV Bartha, Ubc promoter, multi-gene expression module of 2A peptide sequence, expression frame of blue fluorescent protein and the right homology arm of PRV Bartha were sequentially inserted into the vector plasmid to obtain a recombinant plasmid; S2: The recombinant plasmid obtained in S1 is transfected into BHK21 cells, which are then infected with pseudorabies virus PRV Bartha, and the supernatant of the cell culture medium is collected and purified to obtain the recombinant pseudorabies virus.

5. The preparation method according to claim 4, characterized in that: The vector plasmid is an adeno-associated virus vector, and the adeno-associated virus vector is AAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA.

6. The preparation method according to claim 4, characterized in that: The step S1 is specifically as follows: S1-1: The vector plasmid was treated with MluI and MfeI enzymes, and the nucleotide sequence of the left homologous arm of pseudorabies virus PRVBartha was inserted into the vector by homologous recombination to obtain the first clone; S1-2: The first clone was treated with MluI and KpnI double restriction enzymes, and the nucleotide sequence of the Ubc promoter was inserted into the vector by homologous recombination to obtain a second clone; S1-3: The second clone was treated with double restriction enzymes BstEII and RsrII, and the nucleotide sequence of the right homologous arm of pseudorabies virus PRV Bartha was inserted into the vector by homologous recombination to obtain the third clone; S1-4: The third clone was treated with double restriction enzymes BstEII and RsrII, and the nucleotide sequence of the expression frame expressing the blue fluorescent protein was inserted into the vector by homologous recombination to obtain the fourth clone; S1-4: The fourth clone was treated with MfeI and EcoRI double enzyme digestion, and the nucleotide sequence of the multi-gene expression module of the 2A peptide sequence was inserted into the vector by homologous recombination to obtain a recombinant plasmid.

7. The preparation method according to claim 4, characterized in that: The nucleotide sequence of the left homology arm of the pseudorabies virus PRV Bartha is shown in SEQ ID NO.3; The nucleotide sequence of the Ubc promoter is shown in SEQ ID NO.6; The nucleotide sequence of the right homology arm of the pseudorabies virus PRV Bartha is shown in SEQ ID NO.9; The nucleotide sequence of the expression frame for expressing blue fluorescent protein is shown in SEQ ID NO.12; The nucleotide sequence of the multi-gene expression module of the 2A peptide sequence is shown in SEQ ID NO.

15.

8. Use of the recombinant pseudorabies virus according to any one of claims 1 to 3 in any of the following: (1) preparing pseudorabies virus vaccine; (2) Preparation and regulation of pseudorabies virus inhibition products.

9. Use of the recombinant pseudorabies virus according to any one of claims 1 to 3 in any of the following: (1) Application in tracing brain neural circuits in mammals; (2) Application in studying the mechanism of drug inhibition of pseudorabies virus; (3) Application in the development of pseudorabies virus vaccines; (4) Application in establishing animal models of pseudorabies virus infection; (5) Application in analyzing the replication and pathogenic mechanism of pseudorabies virus; (6) Application in establishing a drug screening platform for pseudorabies virus.

Images