Phosphite dehydrogenase mutants, biomaterials, screening methods, catalysts and uses

Abstract

The application discloses a phosphite dehydrogenase mutant, biomaterial, preparation method and application. Compared with wild-type phosphite dehydrogenase, the phosphite dehydrogenase mutant has one or more amino acid residue mutations in positions 29, 31, 59, 68, 185 and 275. The mutant effectively improves the regeneration efficiency of reduced coenzyme NADH, wherein the catalytic efficiency of the mutant N29T / Q185C / K275E is 1.7 times that of the catalytic efficiency of wild-type phosphite dehydrogenase. The mutant has mild reaction conditions and a wide range, the reaction temperature is 15-40 DEG C, the reaction pH is 4-10, the stability is improved compared with wild-type phosphite dehydrogenase, and has high application value.

Description

TECHNICAL FIELD

[0001] The present application relates to phosphite dehydrogenase, especially to a phosphite dehydrogenase mutant, biological material, screening method, catalyst and application. BACKGROUND

[0002] Phosphite dehydrogenase (PDH) is a kind of oxidoreductase, which can catalyze the oxidation of phosphite (HPO3 2- ) to phosphate (PO4 3- ), and convert oxidized coenzyme NAD + to reduced coenzyme NADH. Phosphite dehydrogenase was first discovered in gram-negative bacteria Pseudomonas stutzeri. In recent years, with the rapid development of genome mining and functional screening technology, different isozymes have been found in various microorganisms. These enzymes realize the conversion of phosphorus compounds in microbial cells by oxidizing trivalent phosphorus to pentavalent phosphorus, providing a new research basis for the application of phosphite dehydrogenase.

[0003] Phosphite dehydrogenase has broad application prospects and great potential in many fields:

[0004] In the field of industrial production, the coenzyme regeneration system composed of phosphite dehydrogenase and phosphite can efficiently convert oxidized coenzyme NAD + to reduced coenzyme NADH, realizing the recycling of coenzyme. At the same time, the byproduct phosphate is easy to remove, simplifying the product purification process and reducing production cost, so that phosphite dehydrogenase shows unique advantages;

[0005] In the field of environmental protection, the ability of phosphite dehydrogenase to catalyze the conversion of phosphite to phosphate can be applied to the treatment of phosphite pollutants in industrial wastewater. This efficient and controllable reaction is a green and environmentally friendly solution. In addition, the environmental pollution problem caused by excessive use of phosphorus fertilizer and herbicide containing phosphorus can also be treated and alleviated by phosphite dehydrogenase.

[0006] In the field of genetic engineering, by introducing phosphite dehydrogenase gene into plant genome, the plant can utilize soil phosphite, improving resource utilization. This genetic engineering modification not only helps to solve the problem of phosphorus fertilizer pollution, but also reduces the cost of agricultural production, which has important ecological and economic value.

[0007] Although phosphite dehydrogenase shows broad application potential, its low catalytic efficiency and poor stability are still the main challenges to its practical application. How to improve the catalytic efficiency and stability of phosphite dehydrogenase in coenzyme regeneration system is an important research direction to promote its industrialization and environmental governance application. SUMMARY

[0008] The application aims to provide a phosphite dehydrogenase mutant with high catalytic activity and good stability, a biological material and a screening method related to the mutant, and an application of the mutant in synthesis of reduced coenzyme NADH.

[0009] The phosphite dehydrogenase mutant comprises one or more mutations of amino acid residues at positions 29, 31, 59, 68, 185 and 275 based on the wild-type phosphite dehydrogenase amino acid sequence shown in SEQ ID NO: 1.

[0010] Preferably, the amino acid mutations are that the asparagine residue at position 29 is mutated into a threonine residue, the lysine residue at position 31 is mutated into a serine residue, the asparagine residue at position 59 is mutated into a serine residue, the glutamic acid residue at position 68 is mutated into a histidine residue, the glutamine residue at position 185 is mutated into a cysteine residue, and the lysine residue at position 275 is mutated into a glutamic acid residue.

[0011] The nucleotide sequence comprises a base mutation corresponding to the wild-type phosphite dehydrogenase nucleotide sequence shown in SEQ ID NO: 2, and encodes the amino acid sequence of the aforementioned phosphite dehydrogenase mutant.

[0012] The recombinant vector comprises the aforementioned nucleotide sequence.

[0013] The recombinant microorganism comprises the aforementioned nucleotide sequence or the aforementioned recombinant vector.

[0014] The screening method of the phosphite dehydrogenase mutant comprises the following steps:

[0015] (1) screening wild-type phosphite dehydrogenases from different sources to obtain a suitable wild-type phosphite dehydrogenase;

[0016] (2) performing visual analysis on the three-dimensional structure of the wild-type phosphite dehydrogenase obtained in step 1 as a template to screen key sites affecting enzyme activity and stereoselectivity;

[0017] (3) mutating the key sites obtained in step 2 to obtain a phosphite dehydrogenase mutant with one or more point mutations.

[0018] Preferably, the wild-type phosphite dehydrogenase in step 2 is from Planococcus maritimus.

[0019] The catalyst comprises the aforementioned phosphite dehydrogenase mutant.

[0020] The application of the phosphite dehydrogenase mutant or catalyst in synthesis of reduced coenzyme NADH.

[0021] Preferably, the reaction temperature of the application is 15-40℃, and the reaction pH is 4-10.

[0022] Advantages: Compared with the prior art, the application has the following remarkable advantages: 1. The obtained mutant can effectively improve the regeneration efficiency of reduced coenzyme NADH, and the catalytic efficiency of mutant N29T / Q185C / K275E is 1.7 times that of wild-type phosphite dehydrogenase; 2. The reaction conditions are mild and wide, the reaction temperature is 15-40℃, the reaction pH is 4-10, and the stability is improved compared with wild-type phosphite dehydrogenase. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 Figure 4 is a graph of the relative activity of wild-type phosphite dehydrogenase and mutant for synthesizing reduced coenzyme NADH;

[0024] Figure 2 Figure 6 is a graph of the relative activity of phosphite dehydrogenase mutant N29T / Q185C / K275E for synthesizing reduced coenzyme NADH at different temperatures;

[0025] Figure 3 Figure 8 is a graph of the relative activity of phosphite dehydrogenase mutant N29T / Q185C / K275E for synthesizing reduced coenzyme NADH at different pH values;

[0026] Figure 4 Figure 10 is a Michaelis rate curve of phosphite dehydrogenase mutant N29T / Q185C / K275E. DETAILED DESCRIPTION

[0027] The technical solutions of the application are described below.

[0028] Example 1: Construction, culture and preparation of crude enzyme solution of phosphite dehydrogenase mutant N29T

[0029] 1. Construction of phosphite dehydrogenase mutant plasmid

[0030] 1.1 Obtaining of pET22b-PDH

[0031] The wild-type gene of phosphite dehydrogenase from Planococcus maritimus was synthesized by Jinweizhi (Suzhou) Company and constructed on pET22b vector. The vector was transformed into E. coli DH5a strain, and the recombinant bacteria E. coli DH5a / pET22b-PDH were inoculated in a 5 mL test tube with culture medium and cultured at 37°C, 220 rpm for 12 h. After the end of the culture, the bacteria were centrifuged at 12000 rpm for 1 min and the cells were collected. The high-purity plasmid extraction kit was used to extract the plasmid from E. coli DH5a / pET22b-PDH as a template for iterative mutation, and the construction of the plasmid pET22b-PDH mutant was carried out.

[0032] 1.2 Construction of recombinant E. coli BL21 (DE3) / pET22b-PDH N29T mutant

[0033] The gene mutation was carried out by the method of whole plasmid PCR to obtain the target mutant gene. The primer for N29T mutation was designed as follows:

[0034] N29T upstream primer: gcaaccagaccgataaaccgctgacctac

[0035] N29T downstream primer: gtttatcggtctggttgctgatcacttcg

[0036] The PCR reaction system is shown in Table 1, and the reaction conditions are shown in Table 2.

[0037] Table 1 PCR reaction system

[0038]

[0039]

[0040] Table 2 PCR reaction conditions

[0041]

[0042] After the PCR amplification, the amplification product was detected by 0.9% agarose gel electrophoresis, and the results showed that the amplification product was a single band with a size of about 6000 bp. The amplification product was purified and recovered by DNA recovery and purification kit.

[0043] The purified gene fragment was digested with Dpn I to remove the template and then recombined with a recombination enzyme. The recombination product was transformed into E. coli DH5a competent cells, spread on the surface of LB solid medium containing 100 μg / mL ampicillin, incubated at 37°C for 12 h, and then inoculated into LB liquid culture. The positive transformants were identified by PCR and the correctness of the mutation site was verified by sequencing. After verification, a part was added with sterile glycerol at a final concentration of 25%, numbered, and stored at -80°C for future use. The other part was extracted with a plasmid extraction kit, and the recombinant plasmid was stored in a -20°C refrigerator.

[0044] The successfully sequenced recombinant expression plasmid pET22b was transformed into E. coli BL21(DE3) to construct the recombinant mutant expression strain E. coli BL21(DE3) / pET22b-PDH N29T.

[0045] 2. Culture of phosphite dehydrogenase mutant and preparation of crude enzyme solution

[0046] The successfully constructed recombinant mutant expression strain E. coli BL21(DE3) / pET22b-PDH was spread on a plate containing 100 μg / mL ampicillin, and a single colony was inoculated into 5 mL of LB medium containing the antibiotic at 37°C and 200 rpm for overnight culture. A 1% inoculum was transferred to 500 mL of LB medium containing the antibiotic, and the culture was incubated at 37°C and 200 rpm until the OD 600 When the OD reached about 0.6, IPTG was added at a final concentration of 0.5 mM, and the culture was induced at 18°C for 14 h.

[0047] After centrifugation, the bacterial cells were resuspended in buffer and sonicated in an ice bath (3 s on, 6 s off, 15 min). The cells were centrifuged at 12,000 rpm for 20 min at 4°C. The supernatant was collected and filtered through a 0.22 μm water filter to obtain the crude enzyme solution.

[0048] Example 2: Construction, culture, and preparation of crude enzyme solution of phosphite dehydrogenase mutant K31S

[0049] Based on Example 1, the primer was changed in step 1.2, and the remaining steps were unchanged. The primers are as follows:

[0050] K31S upstream primer: cagaacgatagcccgctgacctacgaaaaactg

[0051] K31S downstream primer: ggtcagcgggctatcgttctggttgctgatcac

[0052] Example 3: Construction, cultivation and preparation of crude enzyme solution of phosphite dehydrogenase mutant N59S

[0053] The N59S mutant was constructed based on Example 1, in step 1.2 the primer was changed, the rest of the steps were unchanged, the primer was as follows:

[0054] N59S upstream primer: cgataaaagcttcctggataacagcaaaaac

[0055] N59S downstream primer: tccaggaagcttttatcgatacggtccggcat

[0056] Example 4: Construction, cultivation and preparation of crude enzyme solution of phosphite dehydrogenase mutant K275E

[0057] The K275E mutant was constructed based on Example 1, in step 1.2 the primer was changed, the rest of the conditions were unchanged, the primer was as follows:

[0058] K275E upstream primer: ccgaaagaaatcaaccaggaactgctgaacc

[0059] K275E downstream primer: ctggttgatttctttcggacgatctttgatag

[0060] Example 5: Construction, cultivation and preparation of crude enzyme solution of phosphite dehydrogenase mutant N29T / E68H

[0061] The N29T / E68H mutant was constructed based on Example 1, using the plasmid obtained in Example 1 as the DNA template in step 1.2, changing the primer, the rest of the steps were unchanged, the primer was as follows:

[0062] N29T / E68H upstream primer: caaaacctgcacatcatcagcggcgcgctgc

[0063] N29T / E68H downstream primer: gatgatgtgcaggtttttgctgttatccagg

[0064] Example 6: Construction, cultivation and preparation of crude enzyme solution of phosphite dehydrogenase mutant N29T / K275E

[0065] The N29T / K275E mutant was constructed based on Example 1, using the plasmid obtained in Example 1 as the DNA template in step 1.2, changing the primer, the rest of the conditions were unchanged, the primer was as follows:

[0066] N29T / K275E upstream primer: ccgaaagaaatcaaccaggaactgctgaacc

[0067] N29T / K275E downstream primer: ctggttgatttctttcggacgatctttgatag

[0068] Example 7: Construction, cultivation and preparation of crude enzyme solution of phosphite dehydrogenase mutant N29T / Q185C / K275E

[0069] N29T / Q185C / K275E mutant was constructed based on Example 1, using the plasmid obtained in Example 6 as the DNA template in step 1.2, changing the primers, and the rest of the conditions were unchanged. The primers are as follows:

[0070] N29T / Q185C / K275E upstream primer: gacgaacagtgcctgaacaccaaatacctgg

[0071] N29T / Q185C / K275E downstream primer: gtgttcaggcactgttcgtcgatggagtccag

[0072] Example 8: Performance test of the obtained phosphite dehydrogenase mutant

[0073] 1. Wild-type phosphite dehydrogenase and its mutant catalyze the oxidation of coenzyme NAD + to reduced coenzyme NADH

[0074] The crude enzyme solution obtained by cultivating the corresponding engineered bacteria expressing phosphite dehydrogenase and its mutants according to Examples 1-7 was used as the catalyst.

[0075] The reaction system was: OD 600 = 20 of the crude enzyme solution, 2.5 mM oxidized coenzyme NAD + , 10 mM phosphite, and the reaction buffer was 50 mM phosphate buffer with pH = 7. The reaction temperature was controlled at 30°C by water bath, and the reaction was carried out for 5 min. The change in absorbance of the product NADH at 340 nm within 5 min was detected by an enzyme marker to compare the relative activity.

[0076] The test results are shown in Table 3 and Figure 1 .

[0077] Table 3 Wild-type phosphite dehydrogenase and mutant reduction to generate reduced coenzyme NADH

[0078] Strains Cell concentration Relative activity WT OD 600 = 20 100％ N29T OD 600 = 20 127％ N59S OD 600 = 20 157％ K31S OD 600 = 20 142％ K275E OD 600 = 20 130％ N29T / E68H OD 600 = 20 152％ N29T / K275E OD 600 = 20 156％ N29T / Q185C / K275E OD 600 = 20 170％

[0079] By Figure 1It can be seen that the catalytic conversion rate of all mutants is higher than that of wild-type phosphite dehydrogenase. In particular, the catalytic efficiency of mutant N29T / Q185T / K275E is 1.7 times that of wild-type phosphite dehydrogenase.

[0080] 2. The optimum temperature of phosphite dehydrogenase mutant (N29T / Q185C / K275E) catalyzing the oxidation of oxidized coenzyme NAD + to reduced coenzyme NADH

[0081] The corresponding expression of phosphite dehydrogenase engineering bacteria and its mutants were constructed and cultured according to Example 7, and the obtained crude enzyme solution was used as a catalyst.

[0082] The reaction system was: OD 600 = 20 of crude enzyme solution, 2.5 mM oxidized coenzyme NAD + , 10 mM phosphite, and the reaction buffer was 50 mM phosphate buffer with pH = 7. The reaction temperature was controlled by water bath at 15°C, 20°C, 25°C, 30°C, 35°C, and 40°C, the reaction was carried out for 5 min, and the absorbance change of product NADH at 340 nm within 5 min was detected by an enzyme marker instrument, which was used to compare the relative activity. The test results are shown in Figure 2 .

[0083] It can be seen from Figure 2 that the best catalytic effect is observed at 35°C, and the enzyme activity is good within the range of 15-40°C.

[0084] 3. The optimum pH of phosphite dehydrogenase mutant (N29T / Q185C / K275E) catalyzing the oxidation of oxidized coenzyme NAD + to reduced coenzyme NADH

[0085] The corresponding expression of phosphite dehydrogenase engineering bacteria and its mutants were constructed and cultured according to Example 7, and the obtained crude enzyme solution was used as a catalyst.

[0086] The reaction system was: OD 600 = 20 of crude enzyme solution, 2.5 mM oxidized coenzyme NAD +10 mM phosphite was used as the reaction buffer, which consisted of 50 mM citrate-phosphate buffer (pH=4), 50 mM citrate-phosphate buffer (pH=5), 50 mM potassium phosphate buffer (pH=6), 50 mM potassium phosphate buffer (pH=6.5), 50 mM potassium phosphate buffer (pH=7), 50 mM Tris-HCl buffer (pH=7.5), 50 mM Tris-HCl buffer (pH=8), 50 mM Gly-NaOH buffer (pH=9), 50 mM Gly-NaOH buffer (pH=9.5), and 50 mM Gly-NaOH buffer (pH=10). The reaction temperature was controlled at 35℃ using a water bath, and the reaction was carried out for 5 min. The absorbance of the NADH product at 340 nm was measured within 5 min using a microplate reader to compare the relative activities. The test results are shown in [link to results]. Figure 3 .

[0087] Depend on Figure 3 It can be seen that different pH values ​​have a significant impact on the catalytic activity of PDH. The best catalytic effect was observed at pH 7. In addition, the enzyme catalytic activity was relatively high in the pH range of 4-10.

[0088] 4. Phosphite dehydrogenase mutant (N29T / Q185C / K275E) catalyzes the oxidation of coenzyme NAD. + Kinetic parameters of reduction to reduced coenzyme NADH

[0089] With different concentrations of NAD + To determine the kinetic parameters of phosphorous dehydrogenase and its mutants, the experiment was conducted at pH 7, enzyme concentration of 0.005 mM, and reaction time of 5 min. The first-order reaction rate was plotted on the ordinate, and substrate concentration on the abscissa. Nonlinear fitting was used to obtain V0. max and K m The parameter values ​​are then calculated, and K is then determined. cat The results are shown in Table 4:

[0090] Table 4 Kinetic parameters of the phosphorylated dehydrogenase mutant N29T / Q185C / K275E

[0091]

Claims

1. A phosphorous acid dehydrogenase mutant, characterized in that, Based on the amino acid sequence of the wild-type phosphorylated dehydrogenase shown in SEQ ID NO: 1, the 29th asparagine residue is mutated to a threonine residue, or the 29th asparagine residue is mutated to a threonine residue, the 68th glutamate residue is mutated to a histidine residue, or the 29th asparagine residue is mutated to a threonine residue, the 275th lysine residue is mutated to a glutamate residue, or the 29th asparagine residue is mutated to a threonine residue, the 185th glutamine residue is mutated to a cysteine ​​residue, and the 275th lysine residue is mutated to a glutamate residue.

2. A nucleotide molecule, characterized in that, Based on the wild-type phosphorous dehydrogenase nucleotide sequence shown in SEQ ID NO: 2, containing the corresponding base mutation, the amino acid sequence encoding the phosphorous dehydrogenase mutant of claim 1 is included.

3. A recombinant vector, characterized in that, The recombinant vector comprises the nucleotide molecule of claim 2.

4. A recombinant microorganism, characterized in that, The recombinant microorganism comprises the nucleotide molecule of claim 2 or the recombinant vector of claim 3.

5. A catalyst, characterized in that, The catalyst comprises the phosphorous dehydrogenase mutant of claim 1.

6. The use of the phosphorous dehydrogenase mutant of claim 1 or the catalyst of claim 5 in the synthesis of reduced coenzyme NADH.

7. The application according to claim 6, characterized in that, The reaction temperature for this application is 15-40℃, and the reaction pH is 4-10.

Images