Poly (A) sequence for optimizing mRNA preparation and expression

Abstract

The invention provides a poly (A) sequence for optimizing mRNA preparation and expression. Specifically, a novel poly (A) tail sequence is developed, the length of the novel poly (A) tail sequence is 50-100 nt, 1-4 non-A nucleotides are introduced into the novel poly (A) tail sequence, and no more than 2 continuous non-A nucleotides are introduced into each non-A nucleotide. The stability and expression level of the mRNA carrier carrying the poly (A) tail are obviously improved, and the mRNA carrier can be used for preparing mRNA drugs, such as mRNA vaccines and the like.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to a poly(A) sequence for optimizing mRNA preparation and expression. Background Art

[0002] The messenger RNA (mRNA) of eukaryotic organisms consists of a 5' cap, a 5' untranslated region (5'UTR), a coding region, a 3' untranslated region (3'UTR), and a poly(A) tail. The poly(A) tail is polyadenylic acid, which plays a vital role in the translation efficiency and stability of mRNA. For mRNA vaccines, the design of poly(A) is related to the efficacy of the vaccine in the human body and the stability of the production process.

[0003] The industry generally believes that mRNA vaccines require a poly(A) tail consisting of at least 100 adenylic acids to prevent mRNA from being degraded in the body and ensure its translation efficiency. However, in the actual production process, it is first necessary to prepare a vector plasmid as a transcription template for mRNA. During plasmid amplification, unmodified, continuous A is prone to recombination, resulting in the shortening or even loss of poly(A) on the plasmid vector, which seriously affects production efficiency and endangers vaccine quality.

[0004] US10717982B2 discloses a mRNA COVID-19 vaccine poly(A) tail (30L70), which adopts the form of 30 A plus linker plus 70 A. Although the introduction of linker sequence can improve the stability of vector plasmid, the lack of adenosine number in the poly(A) tail will still be encountered in actual research and development and production, affecting the stability of plasmid and mRNA expression ability.

[0005] Therefore, there is an urgent need in the art to develop a poly(A) tail that can both improve the stability of the vector during mRNA preparation and ensure the expression capacity of the target gene. Summary of the invention

[0006] The purpose of the present invention is to provide a modified novel poly (A) sequence, which can improve the vector stability and target gene expression ability in the mRNA preparation process.

[0007] In a first aspect of the present invention, a poly(A) tail element is provided for constructing an mRNA transcription template to maintain high-level expression and stability of mRNA, wherein the sequence of the poly(A) tail element comprises the following features:

[0008] (1) The sequence length is L, 50nt≤L≤100nt;

[0009] (2) comprising n linkers, each of which is one or two non-A nucleotide sequences, 1≤n≤4; and

[0010] (3) Contains (n+1) poly(A) subsequences, wherein the length of the poly(A) subsequence near the 5' end, L5', is 10 to 50 nt, and the length of the poly(A) subsequence near the 3' end, L3', is 8 to 65 nt.

[0011] In another preferred embodiment, the sequence length L≤80nt.

[0012] In another preferred embodiment, the linker is one or two cytidines, i.e. -C- or -CC-.

[0013] In another preferred embodiment, the length L5' of the 5'-end poly(A) subsequence is 20 to 50 nt.

[0014] In another preferred embodiment, the length of the 5'-end poly(A) subsequence L5' is 30-45 nt.

[0015] In another preferred embodiment, the length of the 3'-end poly(A) subsequence L3' is 9 to 50 nt.

[0016] In another preferred embodiment, the length of the 3'-end poly(A) subsequence L3' is 20 to 40 nt.

[0017] In another preferred embodiment, when n is 2, 3 or 4, the length of the 3'-end poly(A) subsequence L3' is 20-40 nt.

[0018] In another preferred embodiment, L5'+L3'≤98nt, preferably ≤80nt.

[0019] In another preferred embodiment, when n is 2, 3 or 4, L5'+L3'≤70 nt.

[0020] In another preferred embodiment, the length of the poly(A) subsequence between any two adjacent linkers is independently 2-40 nt, preferably 8-40 nt, and more preferably 10-30 nt.

[0021] In another preferred embodiment, the sequence of the poly(A) tail element is selected from any one of SEQ ID NOs: 1 to 10.

[0022] In another preferred embodiment, the sequence of the poly(A) tail element is selected from the following group:

[0023] (a) the nucleotide sequence shown in SEQ ID NO: 1;

[0024] (b) the nucleotide sequence shown in SEQ ID NO: 2;

[0025] (c) The nucleotide sequence shown in SEQ ID NO: 3.

[0026] In another preferred embodiment, the sequence of the poly(A) tail element is as shown in SEQ ID NO:1.

[0027] In another preferred embodiment, the sequence of the poly(A) tail element is as shown in SEQ ID NO:2.

[0028] In another preferred embodiment, the sequence of the poly(A) tail element is shown in SEQ ID NO:3.

[0029] In the second aspect of the present invention, an mRNA transcription template construct is provided, wherein the construct has a structure of formula I:

[0030] Z1-Z2-Z3-Z4-Z5-Z6-Z7(I)

[0031] In the formula,

[0032] Z1 and Z7 are each independently no or restriction site;

[0033] Z2 is none or a promoter element or an internal ribosome entry site (IRES);

[0034] Z3 is the 5′-UTR element;

[0035] Z4 is the coding sequence of the target polypeptide (GOI, gene of interest);

[0036] Z5 is the 3′-UTR element;

[0037] Z6 is the poly(A) tail element or its coding sequence as described in the first aspect of the present invention.

[0038] In another preferred embodiment, the Z4 is a nucleotide sequence encoding a protein or a polypeptide.

[0039] In another preferred embodiment, the protein or polypeptide includes cytokine, antibody fragment, polypeptide hormone, T cell receptor, chimeric antigen receptor, recombinant protein.

[0040] In another preferred embodiment, the Z4 is a nucleotide sequence encoding an antigen or an antigen fragment.

[0041] In another preferred embodiment, the antigens include pathogen antigens, tumor antigens, and tumor-associated antigens.

[0042] In another preferred embodiment, the pathogen is selected from the group consisting of viruses, bacteria, chlamydia, mycoplasma, or a combination thereof.

[0043] In another preferred embodiment, the antigen is respiratory syncytial virus fusion protein.

[0044] In another preferred embodiment, the construct is linear or circular.

[0045] In another preferred embodiment, the construct is DNA or RNA.

[0046] In another preferred embodiment, the construct is DNA.

[0047] In the third aspect of the present invention, a vector is provided, wherein the vector contains the mRNA transcription template construct as described in the second aspect of the present invention.

[0048] In another preferred embodiment, the vector is selected from the following group: DNA, RNA, viral vector, plasmid, transposon, other gene transfer systems, or a combination thereof.

[0049] In another preferred embodiment, the vector is a plasmid.

[0050] In the fourth aspect of the present invention, a host cell is provided, wherein the host cell contains the vector according to the third aspect of the present invention.

[0051] In another preferred embodiment, the host cell includes a prokaryotic cell or a eukaryotic cell.

[0052] In another preferred embodiment, the host cell is selected from the following group: Escherichia coli, yeast cells, and mammalian cells.

[0053] In the fifth aspect of the present invention, an artificially constructed mRNA is provided, having the structure shown in Formula II:

[0054] M1-M2-M3-M4-M5-M6(II)

[0055] In the formula,

[0056] M1 is the 5' end cap element;

[0057] M2 is none or internal ribosome entry site (IRES);

[0058] M3 is the 5′-UTR element;

[0059] M4 is the coding sequence of the target polypeptide (GOI, gene of interest);

[0060] M5 is the 3′-UTR element;

[0061] M6 is the poly(A) tail element as described in the first aspect of the present invention.

[0062] In another preferred embodiment, the sequence of M6 is selected from the following group:

[0063] (a) the nucleotide sequence shown in SEQ ID NO: 1;

[0064] (b) the nucleotide sequence shown in SEQ ID NO: 2;

[0065] (c) The nucleotide sequence shown in SEQ ID NO:3.

[0066] In another preferred embodiment, the nucleotides of the mRNA may be chemically modified.

[0067] In a sixth aspect of the present invention, a pharmaceutical composition is provided, comprising:

[0068] (c1) the mRNA transcription template construct as described in the second aspect of the present invention, or the mRNA as described in the fifth aspect of the present invention as an active ingredient; and

[0069] (c2) a pharmaceutically acceptable carrier.

[0070] In another preferred embodiment, the pharmaceutical composition is a vaccine composition.

[0071] In another preferred embodiment, the dosage form of the pharmaceutical composition is selected from the following group: injection, lyophilized agent, nebulized inhalation agent, and smearable agent.

[0072] In another preferred embodiment, the pharmaceutical composition is administered by injection, i.e., intravenous, intramuscular, intradermal, subcutaneous, intrathecal, intraduodenal or intraperitoneal injection.

[0073] In another preferred embodiment, the pharmaceutical composition is administered by inhalation, such as intranasal administration.

[0074] In another preferred embodiment, the pharmaceutical composition is administered transdermally, such as by transdermal application or electrode introduction.

[0075] In the seventh aspect of the present invention, there is provided a use of the poly(A) tail element as described in the first aspect of the present invention for constructing an mRNA transcription template, thereby maintaining efficient translation and high stability of the mRNA obtained from the mRNA transcription template.

[0076] In the eighth aspect of the present invention, there is provided an mRNA transcription template construct as described in the second aspect of the present invention, or use of the mRNA as described in the fifth aspect of the present invention in preparing an mRNA drug.

[0077] In another preferred embodiment, the mRNA drug is an mRNA vaccine.

[0078] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0079] Figure 1 The sequence design of the reporter gene mRNA is shown. From 5' to 3', it is the cap (5'Cap), 5' untranslated region (5'UTR), coding region (encoding green fluorescent protein-T2A peptide-firefly luciferase, GFP-T2A-Fluc), 3' untranslated region (3'UTR) and polyadenylic acid poly (A).

[0080] Figure 2 The results of the first round of plasmid linearization for mRNA expression detection are shown. 40 μg of circular plasmid was digested with 8 μL BsaI overnight, and the digestion products were detected by 1% agarose gel electrophoresis. M represents DNA marker.

[0081] Figure 3 The results of the first round of mRNA integrity test are shown. The mRNA was subjected to smear analysis by Qsep1 capillary electrophoresis, and the percentage of peaks that matched the target fragment length was the integrity of the mRNA.

[0082] Figure 4 The results of the first round of mRNA GFP expression detection are shown. HEK293T cells were transfected with 100ng mRNA. The blank control Mock represents the case of no transfection. Cells were imaged under a fluorescence microscope 16h after transfection. BF: bright field, LED light; GFP: blue light 100%, exposure 499.977ms, gain 1.9. Objective 10x.

[0083] Figure 5 The results of the first round of mRNA luciferase expression detection are shown. HEK293T cells were transfected with 100ng mRNA. The blank control Mock represents the case of no transfection. After 16h of transfection, the cells were lysed and the chemiluminescence value of the catalytic substrate was measured. Three replicate wells were made for each sample, and the statistical analysis was performed by GraphPad Prism 8.0.2 One-Way ANOVA, with significant differences **P<0.01, ***P<0.001

[0084] Figure 6 The second round of mRNA expression detection plasmid linearization results are shown. 40μg circular plasmid was digested with 8μL BsaI overnight. The digestion products were detected by 1% agarose gel electrophoresis. M represents DNA marker.

[0085] Figure 7 The second round of mRNA integrity test results are shown. The mRNA was subjected to smear analysis by Qsep1 capillary electrophoresis, and the percentage of peaks that matched the target fragment length was the integrity of the mRNA.

[0086] Figure 8 The second round of mRNA GFP expression flow cytometry results are shown. HEK293T cells were transfected with 100 ng mRNA. The blank control Mock represents the case of no transfection. Flow cytometry was performed 16h and 40h after transfection. FITC channel, gain 300, cell number 10 4 .

[0087] Fig. 9 The results of the second round of mRNA luciferase assay are shown. HEK293T cells were transfected with 100 ng mRNA. The blank control Mock represents the case without transfection. Cells were lysed 16h and 40h after transfection to measure the chemiluminescence value of the catalytic substrate.

[0088] Fig.10 The effect of different poly(A) on the level of double-stranded RNA (dsRNA) is shown. The mRNA sample contained 0.8 μg of total RNA, and the relative content of dsRNA in the mRNA sample was calculated based on the average gray value of each point.

[0089] Fig.11 The antigen mRNA sequence design is shown. From 5' to 3', it is the cap (5'Cap), 5' untranslated region (5'UTR), coding region (encoding respiratory syncytial virus fusion protein, RSV-F), 3' untranslated region (3'UTR) and polyadenylic acid poly (A). RSV-F is the pre-fusion conformation.

[0090] Fig.12 The effect of poly(A) on the distribution of supercoiled plasmids is shown. After the plasmids were transformed into E. coli for 3 generations, 10 colonies were randomly selected for a small sample and the percentage of supercoiled plasmids in the total was analyzed based on the agarose gel electrophoresis results. The average and standard deviation are shown.

[0091] Fig.13 The results of antigen mRNA integrity test are shown. The mRNA is subjected to smear analysis by Qsep1 capillary electrophoresis. The peak ratio that matches the target fragment length is the integrity of the mRNA. The arrow in the figure points to the short fragment of the byproduct.

[0092] Fig.14The effect of poly(A) on antigen expression level is shown. 125ng mRNA was transfected into HEK293T cells, and the expression of RSV-F antigen was detected by western blot 24 hours later, with internal reference protein GAPDH. DETAILED DESCRIPTION

[0093] After extensive and in-depth research and a large number of screenings, the inventors have developed multiple mRNA poly (A) tail sequences. The poly (A) tail of the present invention is ≤100 nt in length, wherein 1 to 4 non-A nucleotides are introduced, with no more than 2 consecutive non-A nucleotides at each location. Experimental verification shows that the stability and expression level of the mRNA vector carrying the poly (A) tail of the present invention are significantly improved. The mRNA containing the poly (A) tail element of the present invention can be used to prepare mRNA drugs, such as mRNA vaccines, etc. The present invention was completed on this basis.

[0094] the term

[0095] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0096] The term "about" can refer to a value or composition that is within an acceptable error range for the particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined.

[0097] As used herein, the term "comprising" or "including (comprising)" may be open, semi-closed and closed. In other words, the term also includes "consisting essentially of" or "consisting of".

[0098] poly(A) tail

[0099] As used herein, the term "poly(A)" refers to polyadenylic acid, which is usually located at the 3' tail of mRNA. A classic mRNA structure includes a 5' cap structure, 5'UTR, coding regions (CDS), 3'UTR, and a poly(A) tail. The poly(A) tail plays an important role in the translation efficiency and stability of mRNA.

[0100] As used herein, the terms "poly(A) tail of the present invention", "poly(A) sequence of the present invention" and "poly(A) tail element of the present invention" are used interchangeably and refer to a poly(A) tail of the present invention comprising the following features:

[0101] (1) The sequence length is L, 50nt≤L≤100nt;

[0102] (2) comprising n linkers, each of which is one or two non-A nucleotide sequences, 1≤n≤4; and

[0103] (3) Contains (n+1) poly(A) subsequences, wherein the length of the poly(A) subsequence near the 5' end, L5', is 10 to 50 nt, and the length of the poly(A) subsequence near the 3' end, L3', is 8 to 65 nt.

[0104] In another preferred embodiment, the sequence of the poly(A) tail element is selected from any of the sequences shown in SEQ ID NOs: 1 to 10, and the sequence, length and structure information thereof are shown in the following table:

[0105]

[0106]

[0107] *The underlined part is a linker.

[0108] **The values ​​indicate the length of the poly(A) subsequence, and the rest are linkers.

[0109] In another preferred embodiment, the sequence of the poly(A) tail element is selected from any one of the sequences shown in SEQ ID NOs: 1 to 3.

[0110] In another preferred embodiment, the sequence of the poly(A) tail element is as shown in SEQ ID NO:1.

[0111] In another preferred embodiment, the sequence of the poly(A) tail element is as shown in SEQ ID NO:2.

[0112] In another preferred embodiment, the sequence of the poly(A) tail element is shown in SEQ ID NO:3.

[0113] mRNA transcription template construct

[0114] As used herein, the terms "mRNA transcription template" and "mRNA transcript" are used interchangeably.

[0115] In another aspect of the present invention, an mRNA transcription template construct is provided, wherein the construct has a structure of Formula I:

[0116] Z1-Z2-Z3-Z4-Z5-Z6-Z7(I)

[0117] In the formula,

[0118] Z1 and Z7 are each independently no or restriction site;

[0119] Z2 is none or a promoter element or an internal ribosome entry site (IRES);

[0120] Z3 is the 5′-UTR element;

[0121] Z4 is the coding sequence of the target polypeptide;

[0122] Z5 is the 3′-UTR element;

[0123] Z6 is a poly(A) tail element according to the present invention.

[0124] As used herein, the term "promoter" or "promoter region (domain)" refers to a nucleic acid sequence that accurately and effectively initiates gene transcription function, guides the transcription of the gene nucleic acid sequence into RNA, and is usually present upstream (5' end) of the target gene coding sequence. Generally, the promoter or promoter region provides recognition sites for RNA polymerase and other factors necessary for the correct initiation of transcription.

[0125] The promoter of the present invention can be operably linked to an exogenous gene, which can be foreign (heterologous) relative to the promoter. The exogenous gene (also called target gene) is not particularly limited, and representative examples include (but are not limited to): screening marker genes, resistance genes, antigen protein genes, and biological agent genes.

[0126] In a preferred embodiment, the mRNA transcription template construct has a structure of formula I, wherein Z1 and Z7 are each independently free or restriction site, Z2 is a promoter element or an internal ribosome entry site (IRES), Z3 is a 5'-UTR sequence, Z4 is a replaceable coding region, Z5 is a 3'-UTR element, and Z6 is a poly (A) tail element as described in the first aspect of the present invention.

[0127] In a preferred embodiment, Z2 is a promoter element.

[0128] In a preferred embodiment, Z2 is a T7 promoter.

[0129] In a preferred embodiment, the nucleotide sequence of Z6 is as shown in any one of SEQ ID NOs: 1-3.

[0130] In a preferred embodiment, the nucleotide sequence of Z6 is as shown in SEQ ID NO:1.

[0131] In a preferred embodiment, the nucleotide sequence of Z6 is as shown in SEQ ID NO:2.

[0132] In a preferred embodiment, the nucleotide sequence of Z6 is as shown in SEQ ID NO:3.

[0133] The pharmaceutical composition of the present invention and its application

[0134] In one aspect of the present invention, a pharmaceutical composition is also provided. In one embodiment of the present invention, the pharmaceutical composition is an mRNA vaccine composition. The pharmaceutical composition of the present invention comprises an active ingredient and a pharmaceutically acceptable carrier thereof.

[0135] mRNA vaccines are divided into self-amplifying RNA (saRNA) and non-replicating RNA (non-replicating mRNA). The classic non-amplifying RNA vaccine includes a cap, 5'-UTR, open reading frame (ORF) (i.e., coding region), 3'-UTR, and poly(A) tail.

[0136] The "active ingredient" in the pharmaceutical composition of the present invention refers to the mRNA transcription template construct or mRNA of the present invention. The "active ingredient", preparation and / or composition of the present invention can be used to prevent and / or treat infectious diseases, rare genetic diseases, neurodegenerative diseases, retinopathy, cancer or tumors and other diseases or conditions. "Pharmaceutically acceptable carrier" refers to: one or more compatible solid or liquid fillers or gel substances, which are suitable for human use and must have sufficient purity and sufficiently low toxicity.

[0137] The pharmaceutical composition may be a liquid or a solid, such as a powder, a gel or a paste. Preferably, the composition is a liquid, preferably an injectable liquid.

[0138] Examples of pharmaceutically acceptable carriers include cellulose and its derivatives (such as sodium carboxymethyl cellulose, sodium ethyl cellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (such as stearic acid, magnesium stearate), calcium sulfate, vegetable oils (such as soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (such as propylene glycol, glycerol, mannitol, sorbitol, etc.), emulsifiers (such as ), wetting agents (such as sodium lauryl sulfate), colorants, flavoring agents, stabilizers, antioxidants, preservatives, pyrogen-free water, etc.

[0139] Pharmaceutical compositions may include physiologically acceptable sterile aqueous or anhydrous solutions, dispersions, suspensions or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Suitable aqueous and non-aqueous carriers, diluents, solvents or excipients include water, ethanol, polyols and suitable mixtures thereof.

[0140] The pharmaceutical composition of the present invention can be prepared into dosage forms such as injection, lyophilized agent, aerosol inhalation, smear-type medicament. The pharmaceutical composition of the present invention can be delivered (administered) by any suitable means, including oral, parenteral and topical methods. The pharmaceutical composition of the present invention can also be administered by injection, i.e. intravenous, intramuscular, intradermal, subcutaneous, intraduodenal, intrathecal, or intraperitoneal injection. In addition, the pharmaceutical composition of the present invention can be administered by inhalation, such as intranasal administration. In addition, the pharmaceutical composition of the present invention can be administered transdermally. The transdermal administration method by the local route can be formulated into a coating stick, solution, suspension, emulsion, gel, cream, ointment, paste, gel, paint, powder and aerosol. In addition, the pharmaceutical composition of the present invention can be actively administered to the positions such as intradermal, subcutaneous, muscle, tumor, tissue organ, central nervous system by electrode / electric field / potential difference.

[0141] The pharmaceutical composition of the present invention can be co-administered with another activating agent. Co-administration includes administering the compound of the present invention and the activating agent within 0.5, 1, 2, 4, 6, 8, 10, 12, 16, 20 or 24 hours of each other. Co-administration also includes administering the compound of the present invention and the activating agent simultaneously, approximately simultaneously (e.g., within about 1, 5, 10, 15, 20 or 30 minutes of each other) or sequentially in any order. In some embodiments, co-administration can be completed by co-preparation, i.e., preparing a single pharmaceutical composition comprising the active ingredient of the present invention (mRNA transcription template construct of the present invention or optimized mRNA) and the activating agent. In other embodiments, the active ingredient of the present invention and the activating agent can be separately prepared.

[0142] The present invention also provides the use of the pharmaceutical composition for preparing a drug for preventing and / or treating diseases, including (but not limited to) infectious diseases, rare genetic diseases, neurodegenerative diseases, retinal diseases, cancer or tumors.

[0143] The main advantages of the present invention include:

[0144] (1) The poly(A) tail element of the present invention makes mRNA more stable, and unstable factors such as A deletion and supercoil destruction are less likely to occur in the production of mRNA plasmid vectors.

[0145] (2) The poly(A) tail element of the present invention increases the expression level of mRNA.

[0146] (3) The length of the partial sequence of mRNA containing the poly(A) tail element of the present invention is shorter, which is conducive to industrial production.

[0147] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are weight percentages and weight parts.

[0148] Materials and Methods

[0149] 1. Target sequence design

[0150] In Examples 1-4, genes encoding GFP and luciferase were selected as reporter genes, and different poly(A) sequences were constructed at the tail end of the mRNA sequence containing the reporter gene. When other elements were completely consistent, the effects of different poly(A) sequences on mRNA translation and vector plasmid stability were compared.

[0151] In Example 5, the above-mentioned reporter gene was replaced by the human respiratory syncytial virus fusion protein (RSV-F) gene, and different poly (A) sequences were constructed at the tail end of the mRNA sequence containing the RSV-F gene to compare the effects of different poly (A) sequences on the antigen expression level and the stability of the mRNA vector plasmid.

[0152] 2. Plasmid transformation and extraction

[0153] The circular plasmid with the target mRNA sequence was synthesized by GenScript. 40ng was transformed into stable competent cells, plated on LB agar plates containing kanamycin resistance, and cultured at 30°C overnight. The single clone was amplified in 20mL LB liquid culture, cultured at 30°C, 220rpm overnight, and transferred to 37°C, 220rpm for further culture for 2h. According to the instructions of the kit, the plasmid was extracted with Tiangen or Axygen small extraction kit, the concentration was measured with Nanodrop and detected by 1% agarose gel electrophoresis. The electrophoresis results were imaged and the supercoil ratio was analyzed using the 4600SF gel image analysis system. Plasmid poly (A) first generation sequencing was completed by Plasmid.

[0154] 3. Plasmid Linearization

[0155] Add 8 μL BsaI and 40 μL reaction buffer to 40 μg circular plasmid, add enzyme-free water to 400 μL, and digest overnight at 37°C and 150 rpm. SV Gel and PCR Clean-Up System Instructions (clean-up step) Purify the linearized plasmid. Add an equal volume of membrane binding solution and the digested product, mix well and apply to the column, incubate at room temperature for 1 minute, centrifuge at 14000rpm for 1 minute, and discard the filtrate. Add 700μL of cleaning solution diluted with anhydrous ethanol, centrifuge at 14000rpm for 1 minute, and discard the filtrate. Add 500μL of cleaning solution diluted with anhydrous ethanol, centrifuge at 14000rpm for 5 minutes, and discard the filtrate. Transfer the column to a 1.5mL EP tube, add 40μL of enzyme-free water to elute the DNA, incubate at room temperature for 1 minute, centrifuge at 14000rpm for 1 minute, collect the filtrate, measure the concentration with Nanodrop and detect by 1% agarose gel electrophoresis.

[0156] 4. In vitro co-transcriptional capping

[0157] Add each reagent to the EP tube in the order in Table 1, mix well and place at 37℃ for 3 hours. After the reaction is completed, add DNase I to the reaction system to digest the remaining plasmid template, mix well and place at 37℃ for 30 minutes. After the reaction is completed, add 1.5 times the volume of 7.5M LiCl precipitation solution to the reaction system, mix well and place at -20℃ for 30 minutes, and centrifuge to obtain a precipitate (12,000rpm, 4℃, 15min). The RNA precipitate was washed three times with 70% ethanol (12,000rpm, 4℃, 5min), re-dissolved with 50μL enzyme-free water, and the concentration was measured with Nanodrop. Store in a -80℃ refrigerator.

[0158] Table 1. In vitro co-transcriptional capping system

[0159]

[0160] 5. Capillary electrophoresis to detect mRNA integrity

[0161] The percentage of target mRNA product in the total transcription product was detected by capillary electrophoresis. RNA was diluted to 50-60 ng / μL with 1×DilutionBuffer, heated in a 70℃ metal bath for 2 min, quickly transferred to ice for 5 min, and detected using the Qsep1 fully automatic nucleic acid protein analysis system with R1 card clamp. The sample molecular weight was determined based on the electrophoresis results of the RNA6000 molecular weight standard. The proportion of the main peak consistent with the expected mRNA molecular weight was determined by Smear analysis to obtain mRNA integrity data.

[0162] 6. Dot blot detection of double-stranded RNA (dsRNA)

[0163] Take a positively charged nylon membrane and place it on top of the filter paper. Pass the RNA sample to be tested through the silica gel 96-well pad and spot 1μL on the membrane. After spotting, place the membrane at room temperature for 10 minutes to ensure that the water in the sample is completely absorbed by the filter paper. At room temperature, block the membrane in blocking solution (5% milk-TBST) for 1 hour. Incubate with mouse J2 anti-dsRNA antibody (1:5000, diluted with 1% milk-TBST) at room temperature for one hour, and place it on a shaker to shake slowly. Discard the antibody, wash the membrane 3 times with TBST cleaning solution, 5 minutes each time, and place it on a shaker to shake quickly. Incubate with donkey anti-mouse IgG secondary antibody (1:10000, diluted with 1% milk-TBST) at room temperature for one hour, and place it on a shaker to shake slowly. Discard the antibody, wash the membrane 5 times with TBST, 5 minutes each time, and place it on a shaker to shake quickly. Drain TBST, mix the ECL chemiluminescent substrate 1:1 and drop it on the membrane, and react for 5 minutes. The substrate was drained and photographed and analyzed using a chemiluminescent image analysis system.

[0164] 7. Cell Transfection

[0165] Reporter gene mRNA transfection: HEK-293T cells grown in a dense monolayer were obtained by trypsin digestion and cell suspension was obtained. 3×10 5 The cells were inoculated in a 24-well plate at a density of 1.5 μL / well. The cell culture medium was 500 μL / well of high-glucose DMEM liquid culture medium containing 10% fetal bovine serum, 1% penicillin-streptomycin, 1% non-essential amino acids and 1% sodium pyruvate. The next day, 400 ng of mRNA and 1.2 μL MessengerMAX TM Add 50 μL to each of the two tubes Reduced Serum Medium, let stand for 10 minutes. Mix the two to get 100 μL transfection solution, incubate at room temperature for 5 minutes. Replace the old medium in the 24-well plate with fresh complete medium, then slowly add the transfection solution containing the required amount of mRNA along the well wall and mix thoroughly. Cell culture conditions are 37°C, 5% CO2.

[0166] Antigen mRNA transfection: HEK-293T cells were transfected at 3×10 5 The cells were inoculated into 6-well plates at a density of 100 μL, with each well containing 2 mL of the above complete medium. The next day, 250 ng of mRNA and 0.9 μL MessengerMAX TM Add 25 μL to each of the two tubes Reduced Serum Medium, let stand for 10 minutes. Mix the two to get 50 μL transfection solution, incubate at room temperature for 5 minutes. Replace the old medium in the 6-well plate with fresh complete medium, then slowly add the transfection solution containing the required amount of mRNA along the well wall and mix thoroughly. The culture conditions are the same as above.

[0167] 8. Observation of GFP under Fluorescence Microscopy

[0168] 16 hours after cell transfection, bright field and GFP images were taken under a CKX53 fluorescence microscope (Olympus). Bright field conditions: LED light source, automatic exposure; GFP conditions: blue light (intensity 100%), exposure time 499.977ms; 10x objective lens.

[0169] 9. Detection of GFP by Flow Cytometry

[0170] After rinsing the cells in the 24-well plate with PBS, add 200μL Versene to dissociate the cells, incubate at 37℃ for 10min, add 200μL culture medium to neutralize, transfer to EP tube, centrifuge at 1000rpm for 5 minutes, and discard the supernatant. Add 200μL PBS to resuspend the cells, count and take 2*10^5 cells to a new 1.5mL EP tube, and collect on Novo Cyte2000R flow cytometer. Collection conditions: FITC channel, 10,000 cells collected, volume 50μL, sample flow rate is medium speed. The remaining cells are used to prepare luciferase samples.

[0171] 10. Luciferase expression detection

[0172] Add 100 μL of Glo Lysis Buffer to each tube of the remaining cells in the 24-well plate and place on a shaker for 10 minutes. Collect the lysate into a 1.5 mL EP tube at 12,000 rpm and centrifuge for 1 minute to precipitate cell debris. Take 50 μL of the lysate supernatant to a 96-well plate (#3917), add 30 μL of the reaction solution to each well, quickly place the plate in an ELISA reader, and measure the chemiluminescence value.

[0173] 11. Western blot detection of antigen expression

[0174] After the cells in the 6-well plate were rinsed with PBS, 1 mL of PBS was added and the cells were collected with a cell scraper into a 1.5 mL EP tube. The cells were centrifuged at 4000 rpm and 4°C for 5 minutes, and the precipitate was collected. 100 μL of lysis buffer (RIPA with 1x protease inhibitor and 1% nuclease) was added and the precipitate was lysed on ice for 15 minutes. Centrifuge at 13200 rpm and 4°C for 5 minutes and the supernatant was collected. 25 μL of 5xSDS protein loading buffer was added to each tube of 100 μL of cell lysis buffer and heated in a metal bath at 100°C for 5 minutes. Take 4-12% SurePAGE TMProtein precast gel, load 10μL for electrophoresis, 160V, 30min, then 400mA, 30min for transfer. The membrane was placed in blocking solution (5% milk-TBST) and blocked at room temperature for 1h. The blocking solution was discarded, and the RSV-F Antibody primary antibody (Sino Biological, 1:200 dilution in blocking solution) was incubated at room temperature for 2h. The primary antibody was discarded, and the membrane was washed 3 times with TBST, 5min each time, and incubated with HRP-conjugated Affinipure Goat Anti-Rabbit IgG (H+L) (Proteintech, 1:5000 dilution in blocking solution) at room temperature for 1h. The secondary antibody was discarded, and the membrane was washed 5 times with TBST, 5min each time. The ultrasensitive ECL chemiluminescent substrate was mixed 1:1 and dropped on the membrane for reaction for 1 minute. The membrane was placed in the 4600SF chemiluminescent image analysis system for imaging.

[0175] Example 1: Sequence Design

[0176] In order to detect the effects of different poly(A) on mRNA, poly(A) was designed to be constructed at the tail end of mRNA expressing reporter gene. Reporter gene is a gene encoding GFP and luciferase. The mRNA carrying reporter gene is named Fluc-1~Fluc-8. Except for the poly(A) tail sequence, the other element sequences are completely the same. See the sequence design diagram for details. Figure 1 .

[0177] In order to detect the effect of different poly(A) on antigen mRNA, poly(A) was designed to be constructed at the tail end of mRNA expressing human respiratory syncytial virus fusion protein (RSV-F). The mRNAs carrying the coding gene of RSV-F were named RSV-1 to RSV-4. Except for the poly(A) tail sequence, the other element sequences were completely consistent.

[0178] In addition to the poly(A) sequence, the other element sequences of the constructed mRNA are as follows:

[0179] The 5'-UTR sequence (SEQ ID NO: 15) is:

[0180] AAUAAACUAGUAUUCUUCUGGUCCCCACAGACUCAGAGAGAACCCGCCACC;

[0181] The 3'-UTR sequence (SEQ ID NO: 16) is:

[0182] CUCGAGCUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCUCCCCCGACCUCGGGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCCAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACCCUGGAGCUAGC;

[0183] The sequence of the coding region of the reporter gene (SEQ ID NO: 17) is as follows:

[0184]

[0185] The poly(A) sequences carried by each mRNA are shown in the following table (underlined are linkers):

[0186]

[0187]

[0188] SEQ ID NO: 1-12 are novel poly (A) sequences developed by the present invention; SEQ ID NO: 13-14 are reference poly (A) sequences, wherein the sequence of SEQ ID NO: 13 is the poly (A) sequence (30L70) disclosed in US10717982B2; and the sequence of SEQ ID NO: 14 is a sequence of 100 consecutive A's.

[0189] Example 2: Stability of different poly(A) in plasmids

[0190] In the industrial production of mRNA vaccines, plasmids are usually selected as vectors. Plasmids can be amplified in large quantities in E. coli and used as templates for in vitro transcription of mRNA after linearization. In order to detect the stability of different poly(A) in plasmids, plasmids carrying reporter genes and different poly(A) sequences were transformed into E. coli cells, and 10 monoclonal colonies were selected for plasmid extraction and poly(A) sequencing to analyze whether the number of poly(A) adenylate in the plasmid is complete and whether a bottom peak appears in the poly(A) region in the sequencing peak graph. Clones without bottom peaks and A deletions are considered to have qualified sequence integrity.

[0191] The structures are shown in Table 2. Among the sequences carrying the new poly(A), Fluc-3, Fluc-5 and Fluc-7 showed signs of sequence integrity loss, including A deletion and bottom peaks as reflected in the sequencing results, suggesting that these sequences were unstable during plasmid amplification and that gene recombination may have occurred, resulting in shortening of all or part of the cloned poly(A) tails.

[0192] Table 2. First round of poly(A) stability testing

[0193]

[0194]

[0195] The results in Table 2 show that when the total length of the poly(A) element is too long, such as the poly(A) element with a length greater than 105 nt used in Fluc-3 (SEQ ID No: 11), the sequence integrity is reduced and poly(A) bottom peaks and A deletions are likely to occur.

[0196] According to the results of the first round of stability test, Fluc-3 and Fluc-7 with A deletion were excluded, and 4 colonies were selected for the remaining sequences, extracted with the Axygen kit, analyzed the integrity of the poly(A) sequence by sequencing, and the supercoiling ratio of the plasmid was calculated under agarose gel electrophoresis (Table 3). Plasmids with a low supercoiling ratio may affect the quality and expression capacity of the mRNA transcribed from them.

[0197] The results are shown in Table 3. In this round of testing, Fluc-1 carrying the control poly (A) showed 3 poly (A) bottom peaks, and Fluc-4 and Fluc-6 carrying the novel poly (A) of the present invention showed 1-2 bottom peaks, and no A deletion occurred in all test sequences. In this round of testing, the supercoiling ratio of the plasmid of each clone was calculated. Fluc-4 and Fluc-5 each had 1-2 cases of reduced supercoiling ratio, resulting in a decrease in the average value. Among all sequences, the supercoiling ratio of the Fluc-2 plasmid is higher and more stable.

[0198] Table 3. Second round of poly(A) stability testing

[0199]

[0200] Based on the results of the first two rounds of stability tests, the Fluc-2 and Fluc-8 sequences with better performance were selected to test the stability of poly(A) in subsequent generations. That is, the clones with complete poly(A) were continuously subcultured on agar plates for three generations, and four colonies were selected from each culture, extracted using the Axygen kit, and analyzed for sequence integrity and supercoiling ratio (Table 4).

[0201] The results are shown in Table 4. In this round of testing, one case of complete unwinding of the supercoil occurred in the Fluc-1 plasmid containing the control poly(A) sequence. In comparison, the supercoil ratio and stability of the novel poly(A) sequence of the present invention were higher.

[0202] Table 4. The third round of poly(A) stability test

[0203]

[0204] * A supercoil ratio of 0% means that at least one mRNA supercoil was completely unwound.

[0205] Example 3: Effects of different poly(A) on reporter gene mRNA cell expression

[0206] 3.1 First round of mRNA expression detection

[0207] In the first round of expression detection, the plasmid was extracted using the Tiangen kit and linearized by restriction endonuclease treatment to serve as a transcription template. Agarose gel electrophoresis showed that the plasmid was completely digested, but the supercoil of the Fluc-6 circular plasmid was completely unwound in this round of experiments. The results are shown in Figure 2 In addition, this round of samples excluded Fluc-3 and Fluc-7, which performed poorly in the stability test.

[0208] The linearized plasmid was used as a template and capped mRNA was obtained by in vitro co-transcription. Its integrity was tested by capillary electrophoresis ( Figure 3 ). The integrity of the samples in this round was greater than or equal to 80%.

[0209] 100 ng mRNA was transfected into HEK293T cells, and the GFP expression level was observed under a fluorescence microscope 16 hours later ( Figure 4 ), it can be seen that the GFP expression levels of mRNA Fluc-2, Fluc-4, Fluc-5, Fluc-6 and Fluc-8 containing the new poly(A) are close to that of the control Fluc-1. The luciferase assay results show that ( Figure 5 ), the expression levels of Fluc-2, Fluc-4, Fluc-5 and Fluc-8 were significantly higher than those of Fluc-1, while that of Fluc-6 was lower than that of Fluc-1, which may be related to the unwinding of supercoil of their plasmids.

[0210] 3.2 Second round of mRNA expression detection

[0211] In the second round of expression detection, the same method was used for plasmid extraction and linearization. Agarose gel electrophoresis showed that the plasmid was completely digested and the supercoiling ratio of Fluc-6 circular plasmid was normal ( Figure 6 ). This round of samples excluded Fluc-5, which performed poorly in the stability test.

[0212] The linearized plasmid was used as a template and capped mRNA was obtained by in vitro co-transcription. Its integrity was tested by capillary electrophoresis ( Figure 7 ). The integrity of the samples in this round was close to 90%.

[0213] In this round of experiments, flow cytometry was used to detect the expression of GFP in cells transfected with mRNA carrying different poly(A). After 16 hours of transfection, the mean fluorescence intensity (MFI) of GFP-positive cells in each group was 1x10 5 , after 40 hours of transfection, it dropped to about half of the level at 16 hours ( Figure 8 At both time points, the GFP expression intensity of the mRNA sample carrying the new poly(A) was higher than that of the control sequence Fluc-1 ( Figure 8At the same time point, the luciferase expression level of the mRNA sample carrying the new poly(A) was also higher than that of Fluc-1( Fig. 9 ).

[0214] Example 4: Effects of different poly(A) on dsRNA levels

[0215] Double-stranded RNA (dsRNA) is a common byproduct in the process of in vitro transcription to prepare mRNA. dsRNA in vaccine products can easily activate multiple natural immune pathways, affecting the safety and effectiveness of vaccines. In order to explore the effect of different poly (A) on the content of dsRNA produced during co-transcriptional capping, the dot blot method was used to detect the content of dsRNA in mRNA using specific antibodies ( Fig.10 ). The dsRNA content of mRNA carrying each poly(A) is relatively close, and the dsRNA content carrying the new poly(A) is not higher than that of the control Fluc-1. Therefore, compared with the control poly(A), the new poly(A) does not increase the dsRNA content during the co-transcriptional capping process.

[0216] Example 5: Effect of novel poly(A) on antigen expression levels

[0217] 5.1 Antigen mRNA molecule design

[0218] To verify that the new poly(A) can be used in mRNA vaccines, the poly(A) of Fluc-2 and Fluc-8, which performed better in the reporter gene screening experiment, were used in the design of mRNA expressing human respiratory syncytial virus fusion protein (RSV-F), and the corresponding numbers are RSV-3 and RSV-4, respectively. Fig.11 .

[0219] 5.2 Effect of novel poly(A) on the stability of antigen mRNA vector

[0220] In order to compare the effect of the new poly(A) on the stability of the antigen mRNA vector plasmid, this round of experiments set up the same control (RSV-1) as the poly(A) of Fluc-1 in the previous round of experiments, whose 100 A was divided into two segments of 30 and 70, connected by a 10nt linker. In addition, this round of experiments also introduced an additional continuous 100A as a control of the poly(A) tail (RSV-2). The plasmid was transferred into E. coli, and after three generations, the poly(A) integrity was compared by sequencing, and the supercoiling ratio of the plasmid was analyzed.

[0221] The results showed that the stability of the new poly(A) plasmid was similar to that of the control sequence RSV-1 and significantly better than that of RSV-2 (Table 5). In addition, both RSV-1 and RSV-2 showed complete unwinding of supercoils, while the new poly(A) plasmid had a relatively stable supercoil ratio distribution (see Fig.12 ).

[0222] Table 5. Stability test of novel poly(A) antigen mRNA vector

[0223]

[0224] 5.3 Detection of RSV-F antigen mRNA expression

[0225] The plasmid was extracted using the Tiangen kit and linearized by restriction endonuclease treatment. The mRNA was capped by in vitro co-transcription and used as a transcription template. The integrity of the mRNA was detected by capillary electrophoresis. The integrity of RSV-1, RSV-3 and RSV-4 in this round of samples was greater than or equal to 80%, while RSV-2 with continuous 100A had obvious short fragments, resulting in the target mRNA integrity of only about 70% ( Fig.13 ). Since sequencing has been performed before transcription to fully prove that the transcription template used this time does not have A deletion or bottom peak, it means that the poly (A) will be unstable during the transcription process, thus affecting the quality of the transcription product.

[0226] 125 ng of the above mRNA was transfected into HEK293T cells, and the expression of RSV-F antigen was detected by western blot 24 hours later.

[0227] The results showed that the expression of RSV-2 was slightly higher than that of RSV-1, and the expression of RSV-3 and RSV-4 containing novel poly(A) sequences was slightly higher than that of RSV-2 and significantly higher than that of RSV-1.

[0228] Combining the plasmid stability and mRNA expression results, it can be seen that the control sequence RSV-1 has improved the stability of the plasmid through poly(A) sequence modification, but its expressed antigen level is slightly lower than RSV-2. RSV-3 and RSV-4 carrying the new poly(A) sequence of the present invention have excellent performance in plasmid stability and expression level, and are not inferior to RSV-1 in terms of plasmid stability, and are better than RSV-2 in terms of expression level.

[0229] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A poly(A) tail element for constructing an mRNA transcription template to maintain high-level expression and stability of mRNA, wherein the sequence of the poly(A) tail element comprises the following features: (1) The sequence length is L, 50nt≤L≤100nt; (2) comprising n linkers, each of which is one or two non-A nucleotide sequences, 1≤n≤4; and (3) Contains (n+1) poly(A) subsequences, wherein the length of the poly(A) subsequence near the 5' end, L5', is 10 to 50 nt, and the length of the poly(A) subsequence near the 3' end, L3', is 8 to 65 nt.

2. The poly(A) tail element according to claim 1, wherein The sequence of the poly(A) tail element is selected from any one of SEQ ID NOs: 1 to 10.

3. The poly(A) tail element according to claim 1, wherein The sequence of the poly(A) tail element is selected from the group consisting of: (a) the nucleotide sequence shown in SEQ ID NO: 1; (b) the nucleotide sequence shown in SEQ ID NO: 2; (c) The nucleotide sequence shown in SEQ ID NO:

3.

4. An mRNA transcription template construct, characterized in that: The construct has the structure of Formula I: Z1-Z2-Z3-Z4-Z5-Z6-Z7(I) In the formula, Z1 and Z7 are each independently no or restriction site; Z2 is none or a promoter element or an internal ribosome entry site (IRES); Z3 is the 5′-UTR element; Z4 is the coding sequence of the target polypeptide (GOI, gene of interest); Z5 is the 3′-UTR element; Z6 is the poly(A) tail element or its coding sequence as described in claim 1.

5. A carrier, characterized in that The vector contains the mRNA transcription template construct as claimed in claim 4.

6. A host cell, characterized in that The host cell contains the vector according to claim 5.

7. An artificially constructed mRNA, characterized in that: It has the structure shown in formula II: M1-M2-M3-M4-M5-M6(II) In the formula, M1 is the 5' end cap element; M2 is none or internal ribosome entry site (IRES); M3 is the 5′-UTR element; M4 is the coding sequence of the target polypeptide (GOI, gene of interest); M5 is the 3′-UTR element; M6 is the poly(A) tail element as described in claim 1.

8. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises: (c1) the mRNA transcription template construct according to claim 4, or the mRNA according to claim 7 as an active ingredient; and (c2) a pharmaceutically acceptable carrier.

9. Use of the poly(A) tail element as claimed in claim 1 for constructing an mRNA transcription template, thereby maintaining efficient translation and high stability of the mRNA obtained from the mRNA transcription template.

10. Use of the mRNA transcription template construct according to claim 4, or the mRNA according to claim 7 in the preparation of an mRNA drug.

Images