Time sequence promoter and application thereof

Abstract

The invention relates to a time sequence promoter and application thereof. The time sequence promoter comprises a first conserved region and a second conserved region, the nucleotide sequence of the first conserved region comprises HDTTCTR, the nucleotide sequence of the second conserved region comprises NNBAVNCHV, each H independently represents A, C or T basic groups, D represents A, G or T basic groups, R represents A or G basic groups, each N independently represents A, G, C or T basic groups, B represents C, G or T basic groups, and each V independently represents A, G or C basic groups. The promoter does not need to be added with additives, the expression intensity in the later fermentation period is enhanced, decoupling of cell growth and production in fermentation production can be achieved, and the yield of hyaluronic acid can be increased.

Description

Technical Field

[0001] The present application relates to the field of biotechnology, and in particular to a temporal promoter and its application. Background Art

[0002] Corynebacterium glutamicum does not produce endotoxin, has no spores, and is non-pathogenic. It is a GRAS (generally regarded as safe) strain recognized by the U.S. Food and Drug Administration. Corynebacterium glutamicum is one of the most commonly used chassis strains for industrial production and has been widely used in the synthesis of various amino acids, polysaccharides, and organic acids. In recombinant Corynebacterium glutamicum, there is often a competitive relationship between the product synthesis pathway and the metabolism of the host itself, and overexpression of product synthesis-related genes is likely to inhibit cell growth, resulting in a decrease in yield and even the inability of the bacterium to grow normally. Therefore, it is necessary to adopt a suitable strategy to turn on the target gene after the bacterium grows to a certain stage, realize the decoupling of growth and production, optimize the allocation of resources in the cell growth and target product synthesis stages, and realize the efficient and stable synthesis of products.

[0003] The use of chemical-inducible promoters to control the activation of genes related to product synthesis is currently the most common way to allocate cellular resources. On the one hand, the expression of genes at a specific time can be regulated by the addition time of chemical inducers, and on the other hand, the expression intensity of genes can be regulated by controlling the addition amount of chemical inducers. Although inducible promoters are currently widely used, the use of chemical-inducible promoters to activate target genes not only increases the complexity of the fermentation process, but also increases production costs. There are also problems such as poor stability and inducer toxicity to cells. Therefore, the development of an efficient, green and environmentally friendly promoter that does not rely on chemical inducers is of great importance to biomanufacturing.

[0004] As an important glycosaminoglycan, hyaluronic acid has broad application prospects in the fields of daily chemicals, medical beauty, food, etc. At present, microbial fermentation has become the mainstream method for hyaluronic acid production, but the natural synthetic strain, Streptococcus zooepidemicus, has potential pathogenicity. Therefore, it is particularly important to use synthetic biology technology to construct hyaluronic acid recombinant strains based on biosafety chassis strains. Researchers have achieved heterologous synthesis of hyaluronic acid in Corynebacterium glutamicum by optimizing the types of hyaluronic acid synthases, changing the composition of operon genes, and knocking out the competitive pathways for hyaluronic acid synthesis, but the synthesis process still relies on chemical inducers, which is costly. Summary of the invention

[0005] Based on this, one embodiment of the present application provides a timing promoter and a library including the timing promoter. The promoter, without the need for external additives, has enhanced expression intensity in the later stage of fermentation, can achieve decoupling of cell growth and production in fermentation production, and contribute to the increase of hyaluronic acid production.

[0006] The technical solution includes:

[0007] A sequential promoter, comprising a first conserved region and a second conserved region;

[0008] The nucleotide sequence of the first conserved region includes HDTTTCTR, and the nucleotide sequence of the second conserved region includes NNBAVNCHV, wherein each H independently represents an A, C or T base, D represents an A, G or T base, R represents an A or G base, each N independently represents an A, G, C or T base, B represents a C, G or T base, and each V independently represents an A, G or C base.

[0009] In one embodiment, the nucleotide sequence of the temporal promoter comprises a nucleotide sequence of the following structural formula:

[0010] (N) n HDTTTCTR(N) p NNBAVNCHV(N) q Formula I, or

[0011] (N) n NNBAVNCHV(N) p HDTTTCTR(N) q Formula II,

[0012] Wherein, n, p and q represent the number of random bases, and n, p and q are each independently selected from any integer in the range of 1-400.

[0013] In one embodiment, the temporal promoter comprises a promoter having a nucleotide sequence as shown in one or more of SEQ ID NO.1-SEQ ID NO.35.

[0014] A temporal promoter library, wherein the temporal promoter library comprises the temporal promoter.

[0015] An expression cassette comprising the temporal promoter.

[0016] Optionally, the expression cassette further comprises a target gene.

[0017] Optionally, the target gene is located 0-50 bp downstream of the promoter sequence.

[0018] Optionally, the expression cassette is located on a plasmid or integrated into the genome.

[0019] A recombinant expression vector, wherein the recombinant expression vector comprises the temporal promoter or the expression cassette.

[0020] Optionally, the vector comprises a plasmid.

[0021] Optionally, the plasmid is pEC-XK99E, pXMJ19, pXZ10145, pZL071 or pXT01.

[0022] A recombinant host cell, wherein the recombinant host cell comprises the temporal promoter, the expression cassette, or the recombinant expression vector.

[0023] Optionally, the host bacteria includes Corynebacterium glutamicum.

[0024] Optionally, the Corynebacterium glutamicum includes any one of the following strains or their derivative strains: Corynebacterium glutamicum ATCC13032, Corynebacterium glutamicum ATCC31831, Corynebacterium glutamicum R127, Cg-△ldh(1) / AB bacteria, Cg-△ldh(2) / AB bacteria, C.glu-glmS-cgl2229h bacteria, C.glu-glmS-glt1 bacteria, C.glu-Δldh / A-PdapB-B bacteria, C.glu-Δldh / A-PdapB-B bacteria, C.glu-Δldh / A-PdapB-B-aF bacteria and C.glu-Δldh-aEG / A-PdapB-B-aF-aE bacteria.

[0025] The use of the sequential promoter, the sequential promoter library, the expression cassette, the recombinant expression vector or the recombinant host cell in regulating gene transcription and / or expression.

[0026] Optionally, the method for regulating gene transcription and / or expression comprises the step of operably linking the temporal promoter to the target gene.

[0027] Optionally, the method for regulating gene transcription and / or expression further comprises the step of integrating the obtained ligation product into the genome of a host cell.

[0028] Optionally, the target gene is a protein-coding gene.

[0029] Optionally, the target gene includes at least one of a gene encoding a protein related to the synthesis of the target compound, a gene encoding a gene expression regulatory protein, and a gene encoding a membrane protein.

[0030] Optionally, the target genes include one or more of the β-galactosidase gene lacZ, the red fluorescent protein gene rfp, the green fluorescent protein gene gfp, the cell division protein gene ftsZ, the hyaluronan synthase gene hasA, the UDP-glucose dehydrogenase gene hasB, the uridyl transferase gene hasC, the glycerol-3-phosphate dehydrogenase gene gpdh, the diphosphate nucleoside kinase gene ndk, the glutamine-fructose-6-phosphate aminotransferase gene glmS, the acetyltransferase gene glmU, the phosphoglucosamine mutase gene glmM, the glutamine synthetase gene gln-syn and the Vitreoscilla hemoglobin gene vgb.

[0031] Optionally, the target compound comprises hyaluronic acid.

[0032] The use of the sequential promoter, the sequential promoter library, the expression cassette, the recombinant expression vector or the recombinant host cell in preparing a target protein.

[0033] Optionally, the target protein includes one or more of a protein related to the synthesis of the target compound, a gene expression regulatory protein and a membrane protein.

[0034] Optionally, the target protein includes one or more of β-galactosidase, red fluorescent protein, β-galactosidase, red fluorescent protein, green fluorescent protein, cell division protein, hyaluronan synthase, UDP-glucose dehydrogenase, uridyl transferase, glycerol-3-phosphate dehydrogenase, diphosphate nucleoside kinase, glutamine-fructose-6-phosphate aminotransferase, acetyl transferase, phosphoglucosamine mutase, glutamine synthetase and Vitreoscilla hemoglobin.

[0035] The use of the sequential promoter, the sequential promoter library, the expression cassette, the recombinant expression vector or the recombinant host cell in the production of hyaluronic acid.

[0036] Compared with the traditional technology, this application has the following beneficial effects:

[0037] The present application provides a set of sequential promoters and libraries thereof, the transcription intensity of the promoters in the library is significantly enhanced during a specific fermentation period (24-36h), and can be used to control the expression of multiple genes including those in Corynebacterium glutamicum. On the one hand, since the promoters in the library are all constitutive promoters, no additional inducer is required, the operation is simple, and the application range is wide; on the other hand, the promoter expression intensity is enhanced in the late fermentation period, and the decoupling of cell growth and production in fermentation production can be achieved, which is conducive to the improvement of hyaluronic acid production. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] In order to more clearly illustrate the technical solutions in the embodiments of the present application and to more completely understand the present application and its beneficial effects, the following is a brief introduction to the drawings required for the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present application, and those skilled in the art can obtain other drawings based on these drawings without creative work.

[0039] Figure 1 Reporter plasmid maps for promoter strength characterization.

[0040] Figure 2 Figure B is a partial enlargement of Figure A at a vertical coordinate of 0-15000.

[0041] Figure 3 is the production of hyaluronic acid.

[0042] Figure 4 The scanning electron microscope morphology test project of the late self-enlargement strain P3-ftsZ; Figures (a) and (c) are wild bacteria, and Figures (b) and (d) are P3-ftsZ engineered bacteria.

[0043] Figure 5 This is the real-time fluorescence quantitative PCR (qPCR) detection result of ftsZ gene in strain P3-ftsZ.

[0044] Figure 6 This is the real-time fluorescence quantitative PCR (qPCR) detection result of the glnsyn gene in the engineered strain.

[0045] Figure 7 This is the real-time fluorescence quantitative PCR (qPCR) detection result of ndk gene in the engineered strain. DETAILED DESCRIPTION

[0046] In order to make the above-mentioned purposes, features and advantages of the present application more obvious and easy to understand, the specific implementation methods of the present application are described in detail below. In the following description, many specific details are set forth to facilitate a full understanding of the present application. However, the present application can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without violating the connotation of the present application, so the present application is not limited by the specific embodiments disclosed below.

[0047] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which this application belongs. The terms used herein in the specification of this application are only for the purpose of describing specific embodiments and are not intended to limit this application.

[0048] As used herein, the term "and / or" includes any and all combinations of one or more of the associated listed items.

[0049] As used herein, unless otherwise specified, “one or more” or “one or more” means any one of the listed items or any combination of the listed items.

[0050] In this article, when referring to a numerical interval (i.e., a numerical range), unless otherwise specified, the distribution of optional numerical values ​​within the numerical interval is deemed to be continuous and includes the two numerical endpoints of the numerical interval (i.e., the minimum value and the maximum value), and every numerical value, integer, percentage, etc. between the two numerical endpoints.

[0051] Herein, the term "sequential promoter" refers to a promoter that does not require exogenous addition of inducers during the fermentation culture process, automatically and strongly transcribes in the middle and late stages of fermentation, and achieves high expression of the target gene.

[0052] The present application discovered that Corynebacterium glutamicum itself possesses a rich variety of endogenous promoters, including some sequential promoters that are activated at specific times during bacterial growth, which can activate the expression of downstream genes without inducers.

[0053] The present application has excavated a series of endogenous promoters in Corynebacterium glutamicum that start transcription at a specific period of fermentation, and based on this, has developed a gene expression regulation strategy that can be widely used in Corynebacterium glutamicum, using only one promoter element to simultaneously complete the two tasks of sensing cell growth and gene enhancement regulation, so as to achieve the expression of target genes at a specific time of fermentation. That is, for some key enzymes on the synthesis path, their expression is enhanced at a specific time, so that the cells grow normally in the early stage of fermentation, and the production is enhanced in the later stage, so as to achieve the goal of decoupling growth and production.

[0054] One embodiment of the present application provides a temporal promoter, wherein the temporal promoter comprises a first conserved region and a second conserved region;

[0055] Among them, the nucleotide sequence of the first conserved region includes HDTTTCTR, and the nucleotide sequence of the second conserved region includes NNBAVNCHV, wherein each H represents A, C or T base, D represents A, G or T base, R represents A or G base, each N independently represents A, G, C or T base, B represents C, G or T base, and each V independently represents A, G or C base.

[0056] In a specific example, the nucleotide sequence of the promoter includes a nucleotide sequence of the following structural formula:

[0057] (N) n HDTTTCTR(N) p NNBAVNCHV(N) q Formula I, or

[0058] (N)n NNBAVNCHV(N) p HDTTTCTR(N) q Formula II,

[0059] Wherein, n, p and q represent the number of random bases (N), and n, p and q are each independently selected from any integer in the range of 1-400, and optionally, n, p and q are each independently selected from any integer in the range of 1-300, and optionally, n, p and q are each independently selected from any integer in the range of 1-200. Alternatively, n, p and q are each independently selected from any integer in the range of 1-150. Alternatively, n, p and q are each independently selected from any integer in the range of 1-100. Alternatively, n, p and q are each independently selected from any integer in the range of 1-60.

[0060] In a specific example, the temporal promoter includes a promoter whose nucleotide sequence is shown in one or more of SEQ ID NO.1-SEQ ID NO.35.

[0061] In one embodiment, the temporal promoter comprises a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity with the nucleotide sequence shown above and has promoter activity.

[0062] In one embodiment, the temporal promoter includes a nucleotide sequence obtained by substitution, deletion or addition of one or several nucleotides in the nucleotide sequence shown above, and has promoter activity.

[0063] In one embodiment, the temporal promoter comprises a promoter having a nucleotide sequence as shown in one or more of SEQ ID NO.1-SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.14, SEQ ID NO.24 and SEQ ID NO.27.

[0064] One embodiment of the present application further provides a temporal promoter library, which includes the above-mentioned promoter.

[0065] One embodiment of the present application further provides an expression cassette, which includes the above-mentioned sequential promoter.

[0066] In one specific example, the expression cassette further includes a gene of interest.

[0067] In a specific example, the expression cassette can be inserted into a plasmid or integrated into the genome of a host cell to achieve the purpose of regulating gene transcription and / or expression, or to achieve the purpose of increasing the production of a target protein or target compound.

[0068] In one specific example, a temporal promoter is operably linked to a gene of interest.

[0069] Herein, the target gene is "operably linked" to the promoter, which means that the promoter is functionally linked to the target gene to initiate and mediate the transcription of the target gene. The operably linked method can be any method described by those skilled in the art.

[0070] In a specific example, the target gene is located at 0-50 bp downstream of the promoter sequence, which can be selected as 0bp-10bp, 10bp-20bp, 20bp-30bp, 30bp-40bp or 40bp-50bp downstream.

[0071] Herein, the "target gene" refers to any gene that is linked to the promoter herein so as to regulate its transcription level.

[0072] In one specific example, the target gene is a protein-coding gene.

[0073] In a specific example, the target gene includes at least one of a gene encoding a protein related to the synthesis of the target compound, a gene encoding a gene expression regulatory protein, and a gene encoding a membrane protein.

[0074] In a specific example, the target genes include one or more of the β-galactosidase gene lacZ, the red fluorescent protein gene rfp, the green fluorescent protein gene gfp, the cell division protein gene ftsZ, the hyaluronan synthase gene hasA, the UDP-glucose dehydrogenase gene hasB, the uridyl transferase gene hasC, the glycerol-3-phosphate dehydrogenase gene gpdh, the diphosphate nucleoside kinase gene ndk, the glutamine-fructose-6-phosphate aminotransferase gene glmS, the acetyltransferase gene glmU, the phosphoglucosamine mutase gene glmM, the glutamine synthetase gene gln-syn and the Vitreoscilla hemoglobin gene vgb.

[0075] One embodiment of the present application further provides a recombinant expression vector, which includes the above-mentioned sequential promoter or the above-mentioned expression cassette.

[0076] In one specific example, the vector includes a plasmid.

[0077] As used herein, "vector" refers to a DNA construct containing a DNA sequence operably linked to an appropriate control sequence to express a target gene in a suitable host. "Recombinant expression vector" refers to a DNA structure used to express, for example, a polynucleotide encoding a desired polypeptide. A recombinant expression vector may include, for example, a collection of genetic elements that regulate gene expression, such as promoters and enhancers; ii) a structural or coding sequence that is transcribed into mRNA and translated into protein; and iii) a transcriptional subunit that is appropriate for transcription and translation start and stop sequences. Recombinant expression vectors are constructed in any suitable manner. Any vector may be used, including plasmids, viruses, bacteriophages, and transposons.

[0078] In a specific example, the plasmid includes, but is not limited to, pEC-XK99E, pXMJ19, pXZ10145, pZL071, or pXT01.

[0079] One embodiment of the present application further provides a recombinant host cell, which comprises the above-mentioned temporal promoter, the above-mentioned expression cassette, or the above-mentioned recombinant expression vector.

[0080] Herein, "host cell" refers to any cell type that is susceptible to transformation, transfection, transduction, etc. with transcription initiation elements or expression vectors containing promoters. "Recombinant host cell" encompasses host cells that are different from parental cells after the introduction of transcription initiation elements or recombinant expression vectors.

[0081] Herein, the host cell may be a prokaryotic cell or a eukaryotic cell, as long as the promoter of the present application can be introduced into the cell.

[0082] In one embodiment, the host cell includes a host bacterium.

[0083] In one specific example, the host bacteria includes Corynebacterium glutamicum.

[0084] In a specific example, Corynebacterium glutamicum includes any one of the following strains or their derivative strains: Corynebacterium glutamicum ATCC13032, Corynebacterium glutamicum ATCC31831, Corynebacterium glutamicum R127, Cg-△ldh(1) / AB and Cg-△ldh(2) / AB in patent CN107354119A, C.glu-glmS-cgl2229 and C.glu-glmS-glt1 in patent CN114107148A, C.glu-Δldh / A-PdapB-B, C.glu-Δldh / A-PdapB-B-aF and C.glu-Δldh-aEG / A-PdapB-B-aF-aE in patent CN110305827A.

[0085] One embodiment of the present application also provides the use of the temporal promoter library, the promoter, the expression cassette, the recombinant expression vector or the recombinant host cell in regulating gene transcription and / or expression.

[0086] In one specific example, the gene includes a gene in a microorganism.

[0087] In one specific example, the gene includes the target gene described above.

[0088] In one specific example, the microorganism includes but is not limited to Corynebacterium glutamicum.

[0089] One embodiment of the present application also provides a method for regulating gene transcription and / or expression, which comprises the step of operably linking a promoter in the temporal promoter library to a target gene.

[0090] Optionally, the method further comprises the step of integrating the obtained ligation product into the genome of the host cell;

[0091] In a specific example, the target gene is the same as the target gene described above.

[0092] In one specific example, the compound of interest includes hyaluronic acid.

[0093] One embodiment of the present application further provides the use of the temporal promoter library, the promoter, the expression cassette, the recombinant expression vector or the recombinant host cell in preparing a target protein.

[0094] One embodiment of the present application also provides a method for preparing a target protein, which comprises the step of expressing the target protein using the expression cassette, the recombinant expression vector or the recombinant host cell.

[0095] In a specific example, the method further includes a step of isolating or purifying the target protein.

[0096] In a specific example, the target protein includes one or more of a protein related to the synthesis of the target compound, a gene expression regulatory protein, and a membrane protein.

[0097] In one specific example, the compound of interest includes hyaluronic acid.

[0098] In a specific example, the target protein includes one or more of β-galactosidase, red fluorescent protein, β-galactosidase, red fluorescent protein, green fluorescent protein, cell division protein, hyaluronan synthase, UDP-glucose dehydrogenase, uridyl transferase, glycerol-3-phosphate dehydrogenase, diphosphate nucleoside kinase, glutamine-fructose-6-phosphate aminotransferase, acetyl transferase, phosphoglucosamine mutase, glutamine synthetase and Vitreoscilla hemoglobin.

[0099] One embodiment of the present application also provides the use of the temporal promoter library, the promoter, the expression cassette, the recombinant expression vector or the recombinant host cell in producing a target compound.

[0100] One embodiment of the present application also provides a method for producing a target compound, the method comprising using the expression cassette, the recombinant expression vector, or the recombinant host cell to express a protein, a gene expression regulatory protein, or a membrane protein related to the synthesis of the target compound, and producing the target compound in an environment where the protein, gene expression regulatory protein, or membrane protein related to the synthesis of the target compound exists. In a specific example, the target compound includes hyaluronic acid.

[0101] The present application utilizes the endogenous sequential promoter of Corynebacterium glutamicum to regulate key genes in the hyaluronic acid synthesis process, successfully realizes the phased allocation of cell resources, and further improves the production performance of existing hyaluronic acid synthesis strains.

[0102] In one specific example, the method includes:

[0103] The promoter is operably linked to a protein encoding gene related to the synthesis of the target compound or a gene encoding a gene for a gene expression regulating protein or a gene encoding a membrane protein to prepare a recombinant expression vector;

[0104] Transforming host cells with the recombinant expression vector to obtain recombinant host cells;

[0105] The recombinant host cells are fermented and cultured, and the target compound is collected from the culture fluid of the recombinant host cells.

[0106] In one specific example, the method includes:

[0107] Operably linking the promoter to a protein encoding gene related to the synthesis of the target compound or a gene encoding a gene for a gene expression regulating protein or a gene encoding a membrane protein, and integrating the resulting connection product into the genome of a host cell to obtain a recombinant host cell;

[0108] The recombinant host cells are fermented and cultured, and the target compound is collected from the culture fluid of the recombinant host cells.

[0109] In recombinant host cells, the use of promoters in the temporal promoter library of the present application can increase the transcriptional activity of protein-coding genes or gene expression regulatory protein-coding genes or membrane protein-coding genes related to the synthesis of target compounds, increase their protein expression levels, and thereby increase the yield of target compounds.

[0110] In a specific example, the fermentation medium contains: 30-40 g / L glucose, 20-30 g / L ammonium sulfate, 10-20 g / L corn steep liquor, 0.5-1 g / L potassium dihydrogen phosphate, 0.1-0.5 g / L dipotassium hydrogen phosphate, 0.005-0.01 g / L manganese sulfate, 0.005-0.01 g / L ferrous sulfate heptahydrate, 1-5 g / L magnesium sulfate heptahydrate, and 0.5-1.5 g / L glutamine.

[0111] In a specific example, the fermentation conditions include at least one of the following conditions: an inoculation amount of 4-8% (v / v), a temperature of 22-30° C., a rotation speed of 150-200 rpm, and a time of 12-96 h.

[0112] In a specific example, the protein associated with the synthesis of the target compound includes an enzyme associated with the synthesis of the target compound.

[0113] In one embodiment, collecting includes the step of isolating or purifying the target compound.

[0114] The promoter in the promoter library of this application is used to express the cell division protein gene ftsZ, which realizes the automatic increase of the cell size in the later stage, so that more membrane proteins related to the synthesis of the target compound are embedded, and the target compound yield is increased. The promoter in the promoter library of this application is used to control the hyaluronic acid synthesis-related genes, which can achieve a 10-19% increase in hyaluronic acid production, reaching 11-15g / L.

[0115] The embodiments of the present application will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present application and are not intended to limit the scope of the present application. The experimental methods for which specific conditions are not specified in the following examples are preferably referred to the guidance provided in the present application, and can also be based on the experimental manual or normal conditions in this area, can also be based on the conditions recommended by the manufacturer, or refer to experimental methods known in the art.

[0116] In the following specific embodiments, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument test accuracy or operation accuracy are allowed.

[0117] The present application provides an endogenous temporal promoter P1-P35 of Corynebacterium glutamicum with high expression intensity. The sequence is as follows. The underlined and bolded parts in the sequence are two conserved regions MOTIF, wherein the italic part is MOTIF1 and the non-italic part is MOTIF2.

[0118] P1 (SEQ ID NO. 1):

[0119] P2 (SEQ ID NO. 2):

[0120]

[0121] P3 (SEQ ID NO.3):

[0122]

[0123] P4 (SEQ ID NO.4):

[0124]

[0125] P5 (SEQ ID NO.5):

[0126]

[0127] P6 (SEQ ID NO.6):

[0128]

[0129] P7 (SEQ ID NO.7):

[0130]

[0131] P8 (SEQ ID NO.8):

[0132]

[0133] P9 (SEQ ID NO.9):

[0134]

[0135] P10 (SEQ ID NO.10):

[0136]

[0137]

[0138] P11 (SEQ ID NO.11):

[0139] P12(SEQ ID NO.12):

[0140] P13(SEQ ID NO.13):

[0141] P14(SEQ ID NO.14):

[0142] P15(SEQ ID NO.15):

[0143] P16(SEQ ID NO.16):

[0144] P17(SEQ ID NO.17):

[0145] P18(SEQ ID NO.18):

[0146] P19(SEQ ID NO.19):

[0147] P20(SEQ ID NO.20):

[0148] P21(SEQ ID NO.21):

[0149] P22(SEQ ID NO.22):

[0150] P23(SEQ ID NO.23):

[0151] P24(SEQ ID NO.24):

[0152] P25(SEQ ID NO.25):

[0153] P26 (SEQ ID NO. 26):

[0154] P27 (SEQ ID NO. 27):

[0155] P28 (SEQ ID NO. 28):

[0156] P29 (SEQ ID NO. 29):

[0157] P30 (SEQ ID NO. 30):

[0158] P31 (SEQ ID NO.31):

[0159] P32 (SEQ ID NO.32):

[0160] P33 (SEQ ID NO.33):

[0161]

[0162] P34 (SEQ ID NO.34):

[0163]

[0164] P35 (SEQ ID NO.35):

[0165]

[0166] Example 1: Expression of Red Fluorescent Protein Gene by Sequential Promoter

[0167] Eight promoter sequences, P1, P2, P3, P4, P5, P7, P14 and P24, were connected to the coding gene of the red fluorescent protein mCherry and transferred into the Corynebacterium glutamicum host to characterize the sequential expression effect of the sequential promoter.

[0168] (1) Obtaining the target sequence: Using the genome of Corynebacterium glutamicum as a template, the corresponding promoter sequences P1, P2, P3, P4, P5, P7, P14, and P24 were amplified using the designed primers. The primer sequences (5'-3') used are as follows:

[0169] P1:

[0170] P1-F: GCGCGAAGGCGAAGCGGCATGCATAAATTTGAAAAAGAAACGAAGG (SEQ ID NO. 36);

[0171] P1-R: CCTCGCCCTTGCTCACCATTGAGGAACGTTTTTCCCAC (SEQ ID NO. 37).

[0172] P2:

[0173] P2-F: GCGCGCGAAGGCGAAGCGGCATGCATGGCGATAATCCTATCCC (SEQ ID NO. 38);

[0174] P2-R: CTCGCCCTTGCTCACCATTTCTTGCTCCATTCGTG (SEQ ID NO. 39).

[0175] P3:

[0176] P3-F: CGCGCGAAGGCGAAGCGGCATGCATTGAAACGACCCTCTAGAAGC (SEQ ID NO. 40);

[0177] P3-R: TTGCTCACCATAGCGGTATTGCCAAGTAATTTC (SEQ ID NO. 41).

[0178] P4:

[0179] P4-F: GCGCGCGAAGGCGAAGCGGCATGCATTTTCCTGATTTTGTGCAGG (SEQ ID NO. 42);

[0180] P4-R: TTGCTCACCATGTGGTTCTCCTTTTCTTTC (SEQ ID NO. 43).

[0181] P5:

[0182] P5-F: CGCGCGAAGGCGAAGCGGCATGCATAGGTTGGAAGCGCCGGGTC (SEQ ID NO. 44);

[0183] P5-R: TTGCTCACCATCTTTCAACGCCCTTTCTTTG (SEQ ID NO. 45).

[0184] P7:

[0185] P7-F: CCGGAAGCGAAGCGGCATGCATGACACCTGTGAGTTTCAAAC (SEQ ID NO. 46);

[0186] P7-R: TTGCTCACCATTGGCCTTTCTCGAATTGGGTATC (SEQ ID NO. 47).

[0187] P14:

[0188] P14-F: CCGGAAGCGAAGCGGCATGCATACTTTTGCCGTAATTACGGTGC (SEQ ID NO. 48);

[0189] P14-R: CTTGCTCACCATGTTCGGTTTCCTTCGGCAAC (SEQ ID NO. 49).

[0190] P24:

[0191] P24-F: CCGGAAGCGAAGCGGCATGCATAGCTTTTCTTTTCTAAAAC (SEQ ID NO. 50);

[0192] P24-R: GCCCTTGCTCACCATGATCCCTGCCTTTCGTGG (SEQ ID NO. 51).

[0193] Using the strain preserved in the laboratory as a template, the red fluorescent protein mCherry gene sequence corresponding to the corresponding promoter was amplified according to the designed primers (SEQ ID NO.52):

[0194] ATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGTGA(SEQ ID NO.52).

[0195] The primers used (5'-3') are as follows:

[0196] Amplify the mCherry gene linked to P1:

[0197] mcherry-P1-F: GTTCCTCAATGGTGAGCAAGGGCGAGGAGG, SEQ ID NO.53;

[0198] mcherry-R: TCCCCGGGTACCGAGCTCGAATTCTCACTTGTACAGCTCGTCC, SEQ ID NO.54.

[0199] Amplify the mCherry gene linked to P2:

[0200] mcherry-P2-F: GAGCAAGAAATGGTGAGCAAGGGCGAGGAG, SEQ ID NO.55;

[0201] mcherry-R:TCCCCGGGTACCGAGCTCGAATTCTCACTTGTACAGCTCGTCC, SEQ ID NO. 54.

[0202] Amplify the mCherry gene linked to P3:

[0203] mcherry-P3-F: GGCAATACCGCTATGGTGAGCAAGGGCGAGG, SEQ ID NO.56;

[0204] mcherry-R:TCCCCGGGTACCGAGCTCGAATTCTCACTTGTACAGCTCGTCC, SEQ ID NO. 54.

[0205] Amplify the mCherry gene linked to P4:

[0206] mcherry-P4-F: AAAGGAGAACCACATGGTGAGCAAGGGCGAGGAGG, SEQ ID NO.57;

[0207] mcherry-R:TCCCCGGGTACCGAGCTCGAATTCTCACTTGTACAGCTCGTCC, SEQ ID NO. 54.

[0208] Amplify the mCherry gene linked to P5:

[0209] mcherry-P5-F: AGGGCGTTGAAAGATGGTGAGCAAGGGCGAGGAGG, SEQ ID NO.58;

[0210] mcherry-R:TCCCCGGGTACCGAGCTCGAATTCTCACTTGTACAGCTCGTCC, SEQ ID NO. 54.

[0211] Amplify the mCherry gene linked to P7:

[0212] mcherry-P7-F: TCGAGAAAGGCCAATGGTGAGCAAGGGCGAGGAGG, SEQ ID NO.59;

[0213] mcherry-R:TCCCCGGGTACCGAGCTCGAATTCTCACTTGTACAGCTCGTCC, SEQ ID NO. 54.

[0214] Amplify the mCherry gene linked to P14:

[0215] mcherry-P14-F: AAGGAAACCGAACATGGTGAGCAAGGGCGAGGAGG, SEQ ID NO.60;

[0216] mcherry-R:TCCCCGGGTACCGAGCTCGAATTCTCACTTGTACAGCTCGTCC, SEQ ID NO. 54.

[0217] Amplify the mCherry gene linked to P24:

[0218] mcherry-P24-F:AAAGGCAGGGATCATGGTGAGCAAGGGCGAGGAGG, SEQ ID NO.61;

[0219] mcherry-R:TCCCCGGGTACCGAGCTCGAATTCTCACTTGTACAGCTCGTCC, SEQ ID NO. 54.

[0220] (2) Plasmid backbone linearization: Double digest the basic backbone pEC-XK99E with restriction enzymes NisI and EcoRI, and recover and purify the digestion products. Incubate at 37°C for 15-60 minutes.

[0221] The reaction system is shown in Table 1:

[0222] Table 1

[0223]

[0224] (3) Ligation of target sequence and plasmid: The cut plasmid backbone pEC-XK99E, promoter gene fragment and red fluorescent protein gene fragment rfp were connected using Gibson kit (Vazyme). The reaction temperature was 50°C and the reaction time was 15-60 min. Figure 1 The plasmid map.

[0225] (4) Transformation of E. coli by ligation system: The recombinant plasmid was transformed into the competent E. coli Trans10 cells by chemical transformation. The specific operation is as follows: First, mix 10 μL of the recombinant plasmid with 100 μL of competent cells and place on ice for 30 minutes. Heat shock in a metal bath at 42°C for 1 minute and 30 seconds, then place on ice for 2 minutes, and add 900 μL of LB liquid culture medium. Place at 37°C and shake at 200 rpm for 45 minutes to recover. Take 100 μL of the liquid and spread it on the LB solid plate culture medium containing 50 μg / mL kanamycin.

[0226] The components of LB medium are as follows: peptone 10 g / L, yeast powder 5 g / L, sodium chloride 10 g / L. The solid plate medium needs to add 1.5%-2% agar.

[0227] (5) Colony PCR verification: Randomly select a single colony after overnight culture for PCR verification. The verification primer sequences used are as follows:

[0228] promoter-test-F: GCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGT, SEQ ID NO.62;

[0229] promoter-test-R: CCCCACACTACCATCGGCGCTACGGCGTTTCACTTC, SEQ ID NO. 63.

[0230] Example 2 Characterization of promoter expression strength

[0231] (1) Transformation of Corynebacterium glutamicum with reporter plasmid: The reporter plasmid (recombinant plasmid) in Example 1 was transformed into competent cells of Corynebacterium glutamicum ATCC13032 by electroporation. The specific operation is as follows:

[0232] Add 10 μl of plasmid to 100 μl of Corynebacterium glutamicum competent cells and place on ice for 10 min; transfer the plasmid and competent cell mixture into an electroporation cup, and quickly add 900 μL of LB liquid after 1.8 kV electric shock; place in a 46°C water bath for 6 min; resuscitate in a shaker at 30°C and 200 rpm for 2 h; centrifuge at 12000 rpm at room temperature for 1 min, remove 800 μL of supernatant and resuspend; spread on an LB plate containing 25 μg / mL kanamycin.

[0233] (2) Colony PCR verification: After 48 hours of culture, a single colony can be obtained. Pick a single colony for PCR verification. The verification primer sequence is as follows:

[0234] promoter-test-F: GCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGT, SEQ ID NO.62;

[0235] promoter-test-R: CCCCACACTACCATCGGCGCTACGGCGTTTCACTTC, SEQ ID NO. 63.

[0236] (3) Strain fermentation: After obtaining a positive clone, use a toothpick to streak the colony onto an LB plate containing 25 μg / mL kanamycin and culture overnight. Use an inoculation loop to take a loop of bacterial moss and add it to 10 mL of LBG medium containing 25 μg / mL kanamycin. Culture overnight to obtain a fermentation seed liquid. Inoculate the culture medium with a 5% inoculum of Corynebacterium glutamicum, culture at 30°C and 200 rpm for 48 h, and take 500 μL of the fermentation liquid at 12 h, 24 h, 36 h, and 48 h to measure the OD 600 And fluorescence intensity. Test results are shown in Figure 2 .

[0237] The specific determination method is as follows:

[0238] (1) Washing of cells: Take 1 mL of fermentation broth, centrifuge at 13000 rpm and 4°C for 10 min, remove the supernatant, add 1 mL of 0.02 M PBS buffer (pH = 7.2-7.4), and resuspend the cells; repeat the above centrifugation and resuspension process, and finally resuspend the cells in 1 mL of PBS buffer and measure the OD 600 ;

[0239] (2) Dilute the resuspension to OD 600 About 1;

[0240] (3) Determine the OD of the fermentation broth using an ELISA reader 600 Exact numerical value;

[0241] (4) using an ELISA reader to measure the fluorescence intensity of the fermentation broth, wherein the excitation wavelength is 560 nm and the emission wavelength is 607 nm;

[0242] (5) The relative fluorescence intensity of the fermentation broth is obtained by the calculation formula: relative fluorescence intensity = fluorescence intensity / OD 600

[0243] The components of LBG medium are as follows: peptone 10 g / L, yeast powder 5 g / L, sodium chloride 10 g / L, and glucose 5 g / L.

[0244] The components of the Corynebacterium glutamicum fermentation medium are as follows: 40 g / L glucose, 30 g / L ammonium sulfate, 20 g / L corn steep liquor, 1 g / L potassium dihydrogen phosphate, 0.5 g / L dipotassium hydrogen phosphate, 0.01 g / L manganese sulfate, 0.01 g / L ferrous sulfate heptahydrate, 5 g / L magnesium sulfate heptahydrate, and 1.5 g / L glutamine.

[0245] Example 3: Temporal promoter expression of cell division protein gene ftsZ regulates cell morphology

[0246] (1) Obtaining the target sequence: The genome of Corynebacterium glutamicum ATCC13032 was used as a template and the P3 gene fragment was amplified using the designed primers. The primer sequences used are as follows:

[0247] P3-F: CGCGCGAAGGCGAAGCGGCATGCATTGAAACGACCCTCTAGAAGC, SEQ ID NO.40;

[0248] P3-ftsZ-R:TCCTCCTTTAGCGGTATTGCCAAGTAATTTCCG, SEQ ID NO. 64.

[0249] Using the genome of Corynebacterium glutamicum as a template, the designed primers were used to amplify the morphological regulatory gene ftsz gene fragment. The primer sequences used are as follows:

[0250] ftsZ-P3-F:

[0251] ATTACTTGGCAATAACCGCTAAAGGAGGACACATATGACCTCACCGAACAAC, SEQ ID NO.65;

[0252] ftsZ-R: ATCCCCGGGTACCGAGCTCGAATTCTTACTGGAGGAAGCTGGG, SEQ ID NO. 66.

[0253] (2) Plasmid vector linearization: The plasmid pXMJ19-AB (specific construction method see Chinese invention patent application CN103937734A) with HA synthesis pathway was double-digested with restriction enzymes SacI and EcoRI, and recovered and purified.

[0254] (3) Insertion of target sequence into plasmid vector: The linearized plasmid backbone, P3 promoter gene fragment and morphological regulatory gene ftsZ were connected using Gibson kit (Vazyme) to construct the recombinant plasmid pXMJ19-AB-P3-ftsZ. The specific reaction conditions refer to Example 2.

[0255] (4) Chemical transformation of E. coli: The recombinant plasmid was transformed into competent E. coli by chemical transformation. The specific operation method is as shown in Example 2 (chloramphenicol was used for resistance screening, 5 μg / mL). PCR verification was performed, and the verification primer sequences were as follows:

[0256] ftsZ-test-F: TTTCACTTCTGAGTTCGGC, SEQ ID NO.67;

[0257] ftsZ-test-R: TGGTATGGCTGTGCAGGTCG, SEQ ID NO. 68.

[0258] (5) Electrotransformation of Corynebacterium glutamicum: The recombinant plasmid pXMJ19-AB-P3-ftsZ was transformed into Corynebacterium glutamicum ATCC13032 competent cells by electrochemical transformation and cultured for 24 h before PCR verification. The verification primers were the same as those in step (4). For specific operation methods, refer to Example 1.

[0259] Example 4 Fermentation of hyaluronic acid using engineered strain P3-ftsZ

[0260] (1) Strain activation: Streak the positive clones in Example 3 onto LB plates containing 5 μg / mL chloramphenicol and culture for 24 h;

[0261] (2) Seed culture: Use an inoculation loop to take a loop of bacterial moss and place it in 10 mL of LBG medium. Cultivate at 30°C and 200 rpm for 24 h.

[0262] (3) Fermentation culture: The culture medium was inoculated with 5% of the inoculum, and after culturing for 3 h, an inducer IPTG with a final concentration of 0.3 mM was added. The culture was fermented for 48 h to obtain a fermentation liquid containing hyaluronic acid.

[0263] The control was wild strain Corynebacterium glutamicum ATCC13032 transformed with pXMJ19-AB plasmid.

[0264] The method for determining the yield of hyaluronic acid is as follows: take 1 mL of fermentation liquid, add 3 mL of anhydrous ethanol, and let it stand at 4°C for 2 hours. Then centrifuge at 10,000 rpm for 3 minutes, remove the supernatant, retain the precipitate, and invert it at room temperature for 1 hour to completely dry the precipitate. Finally, add 1 mL of deionized water to the precipitate, fully resuspend the precipitate, and centrifuge at 10,000 rpm for 1 minute. The supernatant is the preliminarily purified HA product.

[0265] The yield of the product HA was determined by the CTAB turbidity method. The test system included 0.3 mL of the test solution, 0.7 mL of acetic acid buffer, and 2 mL of CTAB solution (2.5 g / L), and the reaction time was 5 min. The components of the acetic acid buffer were as follows: sodium chloride (0.15 mol / L), sodium acetate (0.2 mol / L), and the final pH of the buffer was adjusted to 6.0 with acetic acid. The yield results are shown in Figure 3 .

[0266] Example 5 Transmission electron microscopy test of the morphology of the engineered strain P3-ftsZ

[0267] (1) Take 1 mL of the fermentation broth of Example 5 and centrifuge at 13000 rpm at room temperature for 2 min to obtain bacterial cells;

[0268] (2) Wash the cells twice with deionized water, add 1 mL of fixative (2.5% glutaraldehyde), and place in a shaker at 30°C and 200 rpm for 1-2 h;

[0269] (3) Centrifuge at 13000 rpm at room temperature for 3 min, remove the supernatant, and obtain the bacterial cells;

[0270] (4) freeze-drying the bacteria to completely remove moisture from the bacteria to obtain dry bacterial powder;

[0271] (5) Attach an appropriate amount of bacterial dry powder to the conductive glue and spray gold on the surface for 60 seconds;

[0272] (6) Cell morphology was observed using an environmental scanning electron microscope (QuanTa 200). The results are shown in Figure 4 .

[0273] Example 6 Real-time fluorescence quantitative PCR (qPCR) detection of ftsZ gene in engineered strain P3-ftsZ

[0274] The fermentation broth at 12 h, 24 h, 36 h and 48 h in Example 4 was taken to extract RNA. The specific operation method is as follows:

[0275] (1) Take 500 μL of bacterial solution, centrifuge at 10,000 rpm for 1 min at 4°C, remove the supernatant and retain the bacterial cells;

[0276] (2) Add 250 μL of TE buffer containing 15 mg / mL lysozyme to the bacteria and resuspend them;

[0277] (3) Incubate at 37°C in a metal bath shaker at 1000 rpm for 30 min to fully disrupt the cells;

[0278] (4) Take 100 μL of the initially disrupted bacterial solution and place it in a 1.5 mL sterile enzyme-free centrifuge tube, add 25-40 mg of glass beads and 350 μL of RL1 Buffer supplemented with β-mercaptoethanol, and mix on a vortex at maximum speed for 5 min;

[0279] (5) Centrifuge at 13,000 rpm, 4°C for 5 min;

[0280] (6) Take 400 μL of supernatant and add it to gDNA-Filter Columns. Centrifuge at 12000 rpm and 4°C for 2 min.

[0281] (7) Add Buffer RL2 (1.6 times the volume of the supernatant) to the collection tube (add anhydrous ethanol in advance), and the liquid becomes turbid;

[0282] (8) Transfer the turbid liquid to the RNA pure column, centrifuge at 12000 rpm, 4°C for 1 min, and discard the waste liquid;

[0283] (9) Add 500 μL of Buffer RW1 to the column, centrifuge at 12,000 rpm, 4°C for 1 min, and discard the waste liquid;

[0284] (10) Add 700 μL of Buffer RW2 (anhydrous ethanol was added in advance) to the column, centrifuge at 12,000 rpm, 4°C for 1 min, and discard the waste liquid;

[0285] (11) Repeat step (10);

[0286] (12) Centrifuge at 12000 rpm, 4°C for 2 min to completely remove residual ethanol;

[0287] (13) Transfer the column to a new sterile, enzyme-free 1.5 mL centrifuge tube and add 50-100 μL RNase-free ddHO 2 O, after being placed at room temperature for 2 minutes, centrifuged at 12000 rpm for 1 minute at room temperature. The obtained sample is the RNA extraction sample;

[0288] (14) Store at -70°C.

[0289] The cDNA library was constructed using reverse transcriptase (Takara). The specific steps are as follows:

[0290] (1) Take 500 ng RNA sample, add 1 μL random primers (50 μM) and dNTPs (10 mM each), and add sterile enzyme-free water to a total volume of 10 μL;

[0291] (2) Incubate in a 65°C metal bath for 5 min, then in an ice bath for 5 min, add 4 μL of 5× buffer, 0.5 μL of RNase inhibitor and 0.5 μL of reverse transcriptase to the mixture in step (1), and add sterile enzyme-free water to a total volume of 20 μL.

[0292] (3) Incubate the sample from step (2) in a PCR instrument at 30°C for 10 min, then at 42°C for 1 h, and finally at 70°C for 15 min.

[0293] The qPCR reaction system was configured using a kit from Vazyme. The reaction system is shown in Table 2:

[0294] Table 2

[0295]

[0296] Place the reaction solution in a flat-top transparent eight-tube tube dedicated to qRT-PCR and start the reaction in a qRT-PCR instrument. The reaction procedure is as follows: (1) 95°C, 30 s; (2) 95°C, 10 s; (3) 60°C, 30 s; the above steps (2)-(3) are cycled 40 times; (4) 95°C, 15 s; (5) 60oC, 60 s; (7) 95°C, 15 s.

[0297] qPCR result reference Figure 5 .

[0298] Example 7 Sequential promoter expression of glutamine synthetase gene glnsyn for enhancing hyaluronic acid synthesis

[0299] (1) Target sequence acquisition:

[0300] The P2 and P27 promoter fragments were obtained by amplifying the genome of Corynebacterium glutamicum ATCC13032 using the designed primers. The primer sequences used are as follows:

[0301] P2-gynsyn-F: CGCGCGAAGGCGAAGCGGCATGCATGGCGATAATCCTATCCC, SEQ ID NO.38;

[0302] P2-gynsyn-R: ATATGTGTCCTCCTTTTTCTTGCTCCATTCGTGTG, SEQ ID NO. 69.

[0303] P27-gynsyn-F: CGCGCGAAGGCGAAGCGGCATGCATGATCACGTCGTGCTCACC, SEQ IDNO.70;

[0304] P27-gynsyn-R: CATATGTGTCCTCCTTTCCCAGTCCATGCCTTTC, SEQ ID NO. 71.

[0305] Using the genome of Corynebacterium glutamicum as a template, the designed primers were used to amplify the glutamine synthetase gene glnsyn gene fragment connected to the P2 promoter and the P27 promoter. The primer sequences used are as follows:

[0306] glnsyn-P2-F: AGAAAAAGGAGGACACATATGAACAGCGAACAGGAATTTG, SEQ ID NO.72;

[0307] glnsyn-R: CAAGCTTGCATGCCTGCAGGTCGACCTAGTAATCAAGATTGTTTC, SEQ ID NO. 73.

[0308] glnsyn-P27-F: GGGAAAGGAGGACACATATGAACAGCGAACAGGAATTTG, SEQ ID NO.74;

[0309] glnsyn-R: CAAGCTTGCATGCCTGCAGGTCGACCTAGTAATCAAGATTGTTTC, SEQ ID NO. 73.

[0310] (2) Plasmid vector linearization: The commercial plasmid pEC-XK99E was double-digested with restriction enzymes NsiI and SalI, and recovered and purified;

[0311] (3) Insertion of target sequence into plasmid vector: The linearized plasmid backbone, promoter fragment and glutamine synthetase gene were connected using Gibson kit (Vazyme) to construct recombinant plasmids P2-glnsyn and P27-glnsyn, respectively. The specific reaction conditions refer to Example 1;

[0312] (4) Chemical transformation of E. coli: The two recombinant plasmids were transformed into competent E. coli by chemical transformation. The specific operation method is as in Example 1. PCR verification was performed, and the plasmids were extracted after amplification of positive colonies.

[0313] Primers for verification:

[0314] pEC-test-F: GCTTGTCTGCTCCCGGCATC, SEQ ID NO.75;

[0315] pEC-test-R: ACTACCATCGGCGCTACGGCG, SEQ ID NO. 76.

[0316] (5) Electrotransformation of Corynebacterium glutamicum: The recombinant plasmid and pXMJ19-AB (for the specific construction method, see Chinese invention patent application CN103937734A) were transformed into Corynebacterium glutamicum ATCC13032 competent cells by electrochemical transformation to construct recombinant strains P2-Glnsyn and P27-Glnsyn. PCR verification was performed after 24 h of culture.

[0317] The primers for verifying pXMJ19-AB are the same as those for ftsZ-test-F / R, and the primers for verifying pEC plasmid are the same as those for step (4) of this embodiment. Select positive colonies for activation, bacterial preservation and fermentation culture. During the fermentation process, four time points, 12h, 24h, 36h and 48h, were selected to measure the transcription amount of the glnsyn gene (the determination method is the same as that of Example 6), and the hyaluronic acid production at 48h was determined according to the method of Example 4. The control bacteria were the Corynebacterium glutamicum ATCC13032 strain into which only the pXMJ19-AB plasmid was transferred. The yield determination results showed that the yield of P27-Glnsyn was 7% higher than that of the control bacteria.

[0318] Glnsyn gene transcription Figure 6 .

[0319] Example 8 Sequential promoter expression of nucleoside diphosphate kinase gene ndk for enhancing hyaluronic acid synthesis

[0320] (1) Target sequence acquisition:

[0321] The genome of Corynebacterium glutamicum ATCC13032 was used as a template and the designed primers were used to amplify the P2 and P27 promoter fragments. The primer sequences used were the same as those in Example 7.

[0322] Using the genome of Corynebacterium glutamicum as a template, the designed primers were used to amplify the ndk fragment of the nucleoside diphosphate kinase gene connected to the P2 promoter. The primer sequences used are as follows:

[0323] ndk-P2-F: AGAAAAAGGAGGACACATATGACTGAACGTACTCTC, SEQ ID NO.77;

[0324] ndk-R: CCAAGCTTGCATGCCTGCAGGTCGACTTACAGGTTAGGGAACCAGATG, SEQ ID NO. 78.

[0325] (2) Plasmid vector linearization: The commercial plasmid pEX-XK99E was double-digested with restriction enzymes NsiI and SalI, and recovered and purified;

[0326] (3) Insertion of target sequence into plasmid vector: The linearized plasmid backbone, promoter fragment and glutamine synthetase gene were connected using Gibson kit (Vazyme) to construct recombinant plasmid P2-ndk. The specific reaction conditions refer to Example 1;

[0327] (4) Chemical transformation of Escherichia coli and electro-transformation of Corynebacterium glutamicum are exactly the same as in Example 7. Recombinant strain P2-Ndk was constructed. Colony PCR verification was performed after 24 h of culture, and the verification primers were the same as in Example 7. Positive colonies were selected for activation, bacterium preservation and fermentation culture. During the fermentation process, the transcription amount of the ndk gene was determined at four time points of 12 h, 24 h, 36 h and 48 h (the determination method was the same as in Example 6), and the hyaluronic acid production at 24 h and 48 h was determined according to the method of Example 4. The control bacteria was the Corynebacterium glutamicum ATCC13032 strain into which only the pXMJ19-AB plasmid was transferred. The yield determination results showed that the HA production of P2-Ndk increased at 48 h, which was 10% higher than that of the control bacteria, reaching 13.1 g / L.

[0328] The transcription level of ndk gene is shown in Figure 7 .

[0329] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0330] The above-mentioned embodiments only express several implementation methods of the present application, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present application, and these all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the attached claims, and the description may be used to interpret the content of the claims.

Claims

1. A sequential promoter, characterized in that The temporal promoter includes a first conserved region and a second conserved region; The nucleotide sequence of the first conserved region includes HDTTTCTR, and the nucleotide sequence of the second conserved region includes NNBAVNCHV, wherein each H independently represents an A, C or T base, D represents an A, G or T base, R represents an A or G base, each N independently represents an A, G, C or T base, B represents a C, G or T base, and each V independently represents an A, G or C base.

2. The sequential promoter according to claim 1, characterized in that The nucleotide sequence of the temporal promoter includes a nucleotide sequence of the following structural formula: (N) n HDTTTCTR(N) p NNBAVNCHV(N) q Formula I, or (N) n NNBAVNCHV(N) p HDTTTCTR(N) q Formula II Wherein, n, p and q represent the number of random bases, and n, p and q are each independently selected from any integer in the range of 1-400.

3. The sequential promoter according to claim 2, characterized in that The temporal promoter includes a promoter whose nucleotide sequence is shown in one or more of SEQ ID NO.1-SEQ ID NO.

35.

4. A temporal promoter library, characterized in that The temporal promoter library comprises the temporal promoter according to any one of claims 1 to 3.

5. An expression cassette, characterized in that The expression cassette comprises the temporal promoter described in any one of claims 1 to 3; Optionally, the expression cassette further comprises a target gene; Optionally, the target gene is located 0-50 bp downstream of the promoter sequence; Optionally, the expression cassette is located on a plasmid or integrated into the genome.

6. A recombinant expression vector, characterized in that: The recombinant expression vector comprises the temporal promoter described in any one of 1 to 3, or the expression cassette described in claim 5; Optionally, the vector comprises a plasmid; Optionally, the plasmid is pEC-XK99E, pXMJ19, pXZ10145, pZL071 or pXT01.

7. A recombinant host cell, characterized in that The recombinant host cell comprises the temporal promoter according to any one of claims 1 to 3, the expression cassette according to claim 5, or the recombinant expression vector according to claim 6; Optionally, the host cell comprises Corynebacterium glutamicum; Optionally, the Corynebacterium glutamicum includes any one of the following strains or their derivative strains: Corynebacterium glutamicum ATCC13032, Corynebacterium glutamicum ATCC31831, Corynebacterium glutamicum R127, Cg-△ldh(1) / AB bacteria, Cg-△ldh(2) / AB bacteria, C.glu-glmS-cgl2229h bacteria, C.glu-glmS-glt1 bacteria, C.glu-Δldh / A-PdapB-B bacteria, C.glu-Δldh / A-PdapB-B bacteria, C.glu-Δldh / A-PdapB-B-aF bacteria and C.glu-Δldh-aEG / A-PdapB-B-aF-aE bacteria.

8. Use of the temporal promoter according to any one of claims 1 to 3, the temporal promoter library according to claim 4, the expression cassette according to claim 5, the recombinant expression vector according to claim 6 or the recombinant host cell according to claim 7 in regulating gene transcription and / or expression; Optionally, the method for regulating gene transcription and / or expression comprises the step of operably linking the temporal promoter of any one of claims 1 to 3 to a target gene; Optionally, the method further comprises the step of integrating the obtained ligation product into the genome of the host cell; Optionally, the target gene is a protein-coding gene; Optionally, the target gene includes at least one of a gene encoding a protein related to the synthesis of the target compound, a gene encoding a gene expression regulatory protein, and a gene encoding a membrane protein; Optionally, the target gene includes one or more of β-galactosidase gene lacZ, red fluorescent protein gene rfp, green fluorescent protein gene gfp, cell division protein gene ftsZ, hyaluronan synthase gene hasA, UDP-glucose dehydrogenase gene hasB, uridyl transferase gene hasC, glycerol-3-phosphate dehydrogenase gene gpdh, diphosphate nucleoside kinase gene ndk, glutamine-fructose-6-phosphate aminotransferase gene glmS, acetyltransferase gene glmU, phosphoglucosamine mutase gene glmM, glutamine synthetase gene gln-syn and Vitreoscilla hemoglobin gene vgb; Optionally, the target compound comprises hyaluronic acid.

9. Use of the sequential promoter according to any one of claims 1 to 3, the sequential promoter library according to claim 4, the expression cassette according to claim 5, the recombinant expression vector according to claim 6 or the recombinant host cell according to claim 7 in preparing a target protein; Optionally, the target protein includes one or more of a protein related to the synthesis of the target compound, a gene expression regulatory protein, and a membrane protein; Optionally, the target protein includes one or more of β-galactosidase, red fluorescent protein, β-galactosidase, red fluorescent protein, green fluorescent protein, cell division protein, hyaluronan synthase, UDP-glucose dehydrogenase, uridyl transferase, glycerol-3-phosphate dehydrogenase, diphosphate nucleoside kinase, glutamine-fructose-6-phosphate aminotransferase, acetyl transferase, phosphoglucosamine mutase, glutamine synthetase and Vitreoscilla hemoglobin.

10. Use of the temporal promoter according to any one of claims 1 to 3, the temporal promoter library according to claim 4, the expression cassette according to claim 5, the recombinant expression vector according to claim 6 or the recombinant host cell according to claim 7 in producing hyaluronic acid.

Images