SiRNA for targeted regulation of HBV gene expression and application thereof

Abstract

The invention provides siRNA for targeted regulation and control of HBV gene expression and application of the siRNA. The double-stranded RNAi agent comprises an antisense strand and a sense strand complementary to the antisense strand forming a double-stranded region, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO: 13, or the nucleotide sequence of the antisense strand is a modified sequence of the sequence as shown in SEQ ID NO: 13. Cell and animal experiment results show that the double-stranded RNAi agent provided by the invention can significantly reduce the expression of one or more HBV genes and block the life cycle of viruses, and can be used for developing drugs for treating HBV gene expression related diseases.

Description

Technical Field

[0001] The present disclosure relates to the field of nucleic acid modification technology, and in particular, to siRNA for targeted regulation of HBV gene expression and applications thereof. Background Art

[0002] Nucleic acid drugs, especially oligonucleotide drugs, are widely used due to their simple synthesis and high activity. Oligonucleotide drugs usually include antisense oligonucleotides (ASO), small interfering RNA (siRNA), micro RNA (miRNA) and nucleic acid aptamers.

[0003] Oligonucleotides are a class of short DNA or RNA molecules, oligomers, that readily bind to their respective complementary oligonucleotides, DNA or RNA in a sequence-specific manner to form duplexes, or less commonly, hybrids. This fundamental property makes oligonucleotides widely used in genetic testing, research, and medicine. In nature, oligonucleotides are usually small RNA molecules that play a role in regulating gene expression, or intermediates derived from the degradation of larger nucleic acid molecules.

[0004] RNA interference (RNAi) is a natural defense mechanism against foreign genes. siRNA can downregulate target genes by recognizing specific sequences and breaking down target mRNA.

[0005] The effective molecules of classical RNAi are composed of the iconic 19 + 2 nucleotide polymer structure (a double helix consisting of a 21-nucleotide RNA molecule and a 19-nucleotide nucleotide molecule corresponding to the nucleobase, including a 2-nucleotide 3' end overhang). One strand of the siRNA (the guide strand or antisense strand) is complementary to the target gene transcript mRNA, and the other strand is labeled as the passenger strand (or sense strand). siRNAs (antisense strand) guide Arguin (AGO2) to complement the target transcript and become part of the RNA-guided silencing complex (RISC). The complete complementarity between the siRNA (antisense strand) and the target leads to the breakage of the target transcript at the corresponding position of the guide strand (antisense strand) 10-11 under the catalysis of the AGO2 protein.

[0006] siRNA has a natural advantage over small molecules and antibody drugs because siRNA performs its function by completing Watson–Crick base pairing on mRNA, while small molecules and monoclonal antibody drugs need to recognize the complex spatial structure of specific proteins. Therefore, many diseases cannot be treated by small molecules and monoclonal antibodies because their target molecules are highly active and cannot recognize molecular structures with affinity and binding specificity. The mechanism of action of siRNA drugs enables them to regulate the expression of target proteins at the genetic level, and has targeting specificity compared to small molecules or antibody drugs. Its mechanism based on the principle of complementary base pairing also makes siRNA's treatment range wider, the design simpler, and the research and development cycle shorter.

[0007] The nucleotides in natural oligonucleotides are connected by phosphodiester bonds. Under physiological conditions, they are particularly sensitive to nucleases. Therefore, natural, unmodified, and unmodified oligonucleotide drugs are easily degraded by nucleases in vivo, have low activity, and poor drugability. Chemical modification of the oligonucleotide structure is an effective way to improve its activity, which can improve its stability to nucleases, its affinity to RNA, and better promote cellular endocytosis and tissue targeting, thereby effectively regulating the expression of the target gene.

[0008] Based on the basic structure of oligonucleotides, bases, sugar rings, phosphate backbones and ends, chemical modifications can be performed in four parts:

[0009] 1) Base modification: mainly divided into three forms: purine modification, pyrimidine modification and base substitution. Purine modification includes N6-methyladenosine, N1-methyladenosine, 7-methylguanylate modification; pyrimidine modification includes 3-methyluridine, 5-methyluridine, 5-methylcytosine, N4-acetylcytidine, pseudouridine, thiouridine, propyne uridine and dihydrouridine.

[0010] 2) Sugar ring modification: mainly divided into sugar ring modification and replacement. Sugar ring modification includes 2'-modification, 4'-modification, 5'-modification, isomeric modification, and combination of these modifications. The most common 2'-modifications of siRNA are 2'-OMe (2'-methoxy) and 2'-F (2'-fluoro) modifications. Compared with natural siRNA, siRNA modified with 2'-OMe and 2'-F has a higher Tm value, stronger serum stability and better activity.

[0011] 3) Modification of the phosphate backbone: mainly modification of thiophosphates; modification by methyl phosphate, selenophosphate, methylborylphosphate, dithiophosphate, and replacement of the bridging oxygen atom in the phosphodiester bond connection region with a sulfur atom; replacing the entire phosphate group between nucleosides with a group that does not contain a phosphorus atom, such as replacing the P atom with a C, S, and N atom to form a guanidine group, S-methylthiourea, etc.

[0012] 4) Terminal modification: covalent conjugation of special groups at the 5' end and / or 3' end of the sense chain and phosphorylation modification of the 5' end of the antisense chain.

[0013] Hepatitis B virus (HBV) is a double-stranded hepatotropic virus that infects only humans and non-human primates. It replicates mainly in the liver and can be transmitted from mother to child, through blood (including minor skin and mucous membrane trauma) and sexual contact. HBV infection remains a major health problem worldwide, and chronic HBV infection has a high probability of developing liver fibrosis, cirrhosis and liver cancer.

[0014] The current standard of care for chronic HBV infection is treatment with oral nucleoside (acid) analogs (NA) and interferon alpha injections. NA inhibits HBV replication by inhibiting HBV DNA synthesis. Most patients require long-term treatment, and the rate of virological relapse is high after discontinuation of the drug. Interferon alpha plays a dual role of immunoregulation and antiviral by enhancing immune cell function, promoting cytokine expression, and inducing interferon signals to encode multiple antiviral proteins. Interferon alone is only effective in some patients and has relatively poor tolerance. The 2022 edition of the "Guidelines for the Prevention and Treatment of Chronic Hepatitis B" recommends entecavir, tenofovir disoproxil fumarate, tenofovir alafenamide fumarate, and amitenofovir, and the recommended alpha interferon is pegylated alpha interferon.

[0015] Currently, the treatment goal of chronic HBV infection is to achieve functional cure, that is, HBV DNA and HBV surface antigen (HBsAg) remain undetectable after drug withdrawal, with or without HBsAg serological conversion. Among them, the continuous reduction of HBsAg and serological conversion are very important for achieving functional cure, which is expected to alleviate liver inflammation, improve liver tissue pathology, reduce the incidence of end-stage liver disease, and prolong patient survival. At present, it is difficult to achieve functional cure or the functional cure rate is extremely low through clinical medication, so it is necessary to further develop drugs that downregulate HBsAg expression to achieve functional cure. Summary of the invention

[0016] In order to solve the technical problem of the lack of a drug that can more effectively inhibit HBV gene expression in the prior art, the present disclosure provides siRNA and its application for targeting and regulating HBV gene expression. The present disclosure designs a series of unique siRNA sequences by targeting the HBV genome sequence and performs specific template modification on them.

[0017] Typically, siRNA uses 2'-methoxy (2'-OMe) and 2'-fluoro (2'-F) to modify the monomer. However, even if only the above two monomer modifications are considered, for siRNA, the sense strand and antisense strand have a total of 44 bases, that is, there are 2 44 Moreover, with different terminal thiolation configurations, the number of possible modification schemes becomes even larger.

[0018] The same siRNA sequence has very different activities when modified in different ways. Different siRNAs have very different activities when modified in the same way. Although there are some modification principles for siRNA modification design, existing studies have shown that its activity cannot be accurately inferred based on the modification method, that is, there is no definite relationship between the modification method and activity. Therefore, it is very difficult to screen out a modification scheme with high activity from countless possible modification combinations.

[0019] The present invention screens out some special modified sequences that have a significant inhibitory effect on HBV gene expression by chemically modifying the designed siRNA sequences.

[0020] In one aspect, the present disclosure provides a double-stranded RNAi agent, comprising an antisense strand and a sense strand complementary to the antisense strand forming a double-stranded region, wherein the nucleotide sequence of the antisense strand is as shown in SEQ ID NO: 13, or the nucleotide sequence of the antisense strand is a modified sequence of the sequence shown in SEQ ID NO: 13.

[0021] In another aspect, the present disclosure also provides a conjugate comprising the double-stranded RNAi agent and a ligand conjugated to the double-stranded RNAi agent.

[0022] In another aspect, the present disclosure also provides a pharmaceutical composition comprising the double-stranded RNAi agent or conjugate, and a pharmaceutically acceptable carrier.

[0023] In another aspect, the present disclosure further provides a kit of parts, comprising kit A, wherein kit A includes one or more of the double-stranded RNAi agent, the conjugate, or the pharmaceutical composition.

[0024] In another aspect, the present disclosure also provides use of the aforementioned double-stranded RNAi agent, conjugate or pharmaceutical composition in the preparation of a drug for preventing and / or treating diseases related to HBV gene expression.

[0025] On the other hand, the present disclosure also provides a method for reducing HBV gene expression or inhibiting HBV replication for non-preventive and / or therapeutic purposes, the method comprising administering one or more of the double-stranded RNAi agent, the conjugate, the pharmaceutical composition and the kit to a sample.

[0026] On the basis of being in accordance with the common sense in the art, the above-mentioned preferred conditions can be arbitrarily combined to obtain the preferred embodiments of the present disclosure.

[0027] The reagents and raw materials used in the present disclosure are commercially available.

[0028] The positive and progressive effects of this disclosure are:

[0029] (1) The modified sequences, including the basic sequence B418S, all had significant inhibitory effects on HBsAg, significantly superior to the Yangshen sequence.

[0030] (2) The modified sequence is conjugated with the GalNAc compound and can be efficiently delivered to the animal liver, significantly inhibiting HBV gene expression and significantly reducing the levels of HBsAg, HBeAg and HBV DNA in serum.

[0031] (3) The sequences modified by the modification template disclosed in the present invention have significantly improved HBV inhibitory activity compared with the similar sequences disclosed in the prior art.

[0032] (4) The present disclosure found that siRNAs with similar sequences have very different activities.

[0033] (5) The present disclosure also found that different sequences have different sensitivities to various modification templates, and it is uncertain which modification template will be used to modify the siRNA sequence to have high activity. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1A The serum HBsAg level of AAV-HBV model mice at the candidate siRNA sequence level of 3 mg / kg.

[0035] Figure 1B The serum HBV DNA level of AAV-HBV model mice at the candidate siRNA sequence level of 3 mg / kg.

[0036] Figure 1C The serum HBeAg level of AAV-HBV model mice at the candidate siRNA sequence level of 3 mg / kg.

[0037] Figure 1D The serum HBsAb level of AAV-HBV model mice at the candidate siRNA sequence level of 3 mg / kg.

[0038] Figure 1E The serum ALT level of AAV-HBV model mice at the candidate siRNA sequence level of 3 mg / kg.

[0039] Figure 1F The figure shows the body weight changes of AAV-HBV model mice at the candidate siRNA sequence level of 3 mg / kg.

[0040] Figure 2A This is the serum HBsAg level of mice after the second challenge.

[0041] Figure 2B It is the serum HBV DNA level of mice after the second challenge.

[0042] Figure 2C is the serum HBeAg level of mice after the second challenge.

[0043] Figure 2D This is the serum HBbAg level of mice after the second challenge.

[0044] Figure 2E is the serum ALT level of mice after the second challenge.

[0045] Figure 2F The weight changes of mice after the second challenge.

[0046] Figure 3A HBsAg level in AAV-HBV model mice at 0.5 mg / kg level of candidate siRNA sequence.

[0047] Figure 3B The HBV DNA level in AAV-HBV model mice at 0.5 mg / kg level of candidate siRNA sequence.

[0048] Figure 3C The HBeAg level in AAV-HBV model mice at 0.5 mg / kg level of candidate siRNA sequence.

[0049] Figure 3D HBsAb level in AAV-HBV model mice at 0.5 mg / kg level of candidate siRNA sequence.

[0050] Figure 3E ALT level in AAV-HBV model mice at 0.5 mg / kg level of candidate siRNA sequence.

[0051] Figure 3FThe body weight changes of AAV-HBV model mice at the candidate siRNA sequence level of 0.5 mg / kg.

[0052] Figure 4A HBsAg levels in AAV-HBV model mice with candidate siRNA sequences conjugated with different GalNAc.

[0053] Figure 4B HBV DNA levels in AAV-HBV model mice with candidate siRNA sequences conjugated with different GalNAc.

[0054] Figure 4C HBeAg levels in AAV-HBV model mice with candidate siRNA sequences conjugated with different GalNAc.

[0055] Figure 4D ALT levels in AAV-HBV model mice with candidate siRNA sequences conjugated with different GalNAc.

[0056] Figure 4E Body weight changes in AAV-HBV model mice with candidate siRNA sequences coupled with different GalNAc. DETAILED DESCRIPTION

[0057] In order to make the present disclosure more easily understood, some terms are first defined. In addition, it should be noted that whenever a value or a range of values ​​for a parameter is listed, it is intended to indicate that the intermediate values ​​and ranges of these cited values ​​are also part of the present disclosure.

[0058] As used herein, the articles "a" and "an" refer to one or more than one (ie, at least one) of the grammatical object of the article. By way of example, "an element" refers to one element or more than one element, such as a plurality of elements.

[0059] The term "including" is used herein to mean, and is used interchangeably with, the phrase "including, but not limited to."

[0060] The term "or" is used herein to mean, and is used interchangeably with, the term "and / or," unless the context clearly dictates otherwise.

[0061] As used herein, the term "approximately" or "approximately" as applied to one or more target values ​​refers to a value similar to the reference value. In certain embodiments, unless otherwise specified or in addition apparent from the context, the term "approximately" or "approximately" refers to a range of values ​​falling into 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less of the reference value in either direction (greater than or less than) (unless such numerals will exceed 100% of possible values).

[0062] As used herein, "HBV" refers to hepatitis B virus, including hepatitis B virus of genotypes A, B, C, D, E, F, G, H, I, J and subtypes thereof, and is not limited to a certain genotype.

[0063] "G", "C", "A" and "U" each generally represent nucleotides comprising guanine, cytosine, adenine and uracil as bases, respectively. "T" and "dT" are used interchangeably herein and refer to deoxyribonucleotides in which the nucleobase is thymine, such as deoxyribothymine, 2'-deoxythymidine or thymidine. However, it should be understood that the term "ribonucleotide" or "nucleotide" or "deoxyribonucleotide" may also refer to a modified nucleotide (as further described below) or an alternative replacement moiety. The skilled artisan will be well aware that guanine, cytosine, adenine and uracil may be replaced by other moieties without substantially changing the base pairing properties of an oligonucleotide (including a nucleotide having such a replacement moiety). For example, without limitation, a nucleotide comprising inosine as its base may base pair with a nucleotide containing adenine, cytosine or uracil. Thus, a nucleotide comprising uracil, guanine or adenine may be replaced in the nucleotide sequences of the present disclosure by a nucleotide comprising, for example, inosine. Sequences comprising such replacement moieties are embodiments of the present disclosure.

[0064] The terms "RNAi agent", "RNA interference agent" are used interchangeably herein and refer to RNA agents as defined herein and mediate targeted cleavage of RNA transcripts through the RNA induced silencing complex (RISC) pathway. RNAi agents direct sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). RNAi agents regulate, for example, inhibit, the expression of HBV in cells such as cells in a subject (such as a mammalian subject). RNAi molecules include single-stranded RNAi molecules and double-stranded siRNAs, as well as short hairpin RNAs (shRNAs).

[0065] The term "small interfering RNA" or "siRNA" refers to a small interfering RNA RNAi molecule. It is a class of double-stranded RNA molecules, also known in the art as short interfering RNA or silencing RNA. siRNAs typically comprise a sense strand (also known as a passenger strand) and an antisense strand (also known as a leading strand), wherein each strand is 17 to 30 nucleotides in length, typically 19 to 25 nucleosides in length, wherein the antisense strand is complementary to the target nucleic acid (such as at least 95% complementary, such as fully complementary) (suitably a mature mRNA sequence), and the sense strand is complementary to the antisense strand, such that the sense strand and the antisense strand form a duplex or duplex region. The siRNA strand may form a blunt-ended duplex, or preferably, the 3' ends of the sense and antisense strands may form 3' overhangs, such as 1, 2 or 3 nucleosides, similar to the products produced by Dicer, which may form RISC substrates in vivo. Effectively extended forms of Dicer substrates have been described in US 8349809 and US8513207, which are incorporated herein by reference. In some embodiments, both the sense and antisense strands have a 3' overhang of 2 nucleotides.Thus, the duplex region may be, for example, 17 to 25 nucleotides in length, such as 21 to 23 nucleotides in length.

[0066] The term "antisense strand" refers to a strand of RNAi (e.g., dsRNA) that includes a region that is substantially complementary to a target sequence. As used herein, the term "region of complementarity" refers to a region on the antisense strand that is substantially complementary to a sequence (e.g., a target sequence) as defined herein. When the region of complementarity is not completely complementary to the target sequence, mispairing can be in the interior or terminal regions of the molecule. Typically, the most tolerated mispairing is in the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides at the 5' and / or 3' ends.

[0067] The term "sense strand" as used herein refers to the strand of a RNAi that includes a region that is substantially complementary to a region of the antisense strand (as that term is defined herein).

[0068] As used herein, the term "inhibit" may be used interchangeably with "reduce," "silence," "downregulate," "suppress," and other similar terms, and includes any level of inhibition.

[0069] As used herein, the phrase "inhibiting the gene expression of HBV" includes inhibiting the expression of HBV DNA, HBV mRNA, HBsAg, HBeAg, hepatitis B core antigen (HBcAg), and the like.

[0070] "Inhibiting the expression of HBV antigens" includes inhibiting the expression of HBsAg, HBeAg, and HBcAg proteins.

[0071] "Inhibiting HBV gene expression" includes any level of inhibition of HBV DNA, HBV mRNA, HBsAg, HBeAg, HBcAg, such as at least partial inhibition of HBV DNA, HBV mRNA, HBsAg, HBeAg, HBcAg expression, such as inhibition of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

[0072] Based on any variable level related to HBV gene expression, such as HBV DNA level, HBV mRNA level, HBV antigen protein level, HBV virion level, the expression of HBV gene can be assessed. Inhibition can be assessed by the reduction of one or more of these variables compared to the control level in absolute or relative levels. The control level can be any type of control level utilized in the art, such as baseline level before administration or from a similar untreated or controlled (e.g., only buffer control or inert agent control) treated subject, cell, or sample level determined.

[0073] As used herein, "patient" or "subject" is intended to include humans or non-human animals, preferably mammals, such as mice. Most preferably, the subject or patient is a human.

[0074] As used herein, "HBV gene expression-related diseases" are intended to include any disease associated with HBV genes or proteins. Such diseases may be caused, for example, by overproduction of HBV antigenic proteins, by HBV gene mutations, by abnormal cleavage of HBV antigenic proteins, by abnormal interactions between HBV antigenic proteins and other proteins or other endogenous or exogenous substances. Exemplary HBV-related diseases include hepatitis associated with HBV infection, such as chronic hepatitis B, acute hepatitis B, and HBV / hepatitis D virus (HDV) co-infection, HBV / HIV co-infection-related diseases.

[0075] As used herein, "therapeutically effective amount" is intended to include the amount of RNAi agent sufficient to achieve treatment of a HBV-related disease when administered to a patient (e.g., by weakening, improving, or maintaining the existing disease or one or more disease symptoms). The "therapeutically effective amount" may vary depending on the RNAi agent, how the agent is administered, the disease and its severity, and medical history, age, weight, family history, genetic makeup, the stage of the pathological process mediated by HBV expression, the type of previous or concomitant therapy (if any), and other individual characteristics of the patient to be treated.

[0076] As used herein, "preventive effective amount" is intended to include the amount of RNAi agents sufficient to prevent or improve the disease or one or more symptoms of the disease when given to a subject who has not yet experienced or shown symptoms of a HBV-related disease but may be susceptible to the disease. Improving the disease includes slowing the progression of the disease or reducing the severity of the subsequent disease. The "preventive effective amount" can vary depending on the RNAi agent, how the agent is given, the risk level of the disease, and medical history, age, weight, family history, genetic makeup, previous or concomitant treatment (if any) type, and other individual characteristics of the patient to be treated.

[0077] "Therapeutically effective amount" or "prophylactically effective amount" also includes the amount of RNAi agent that produces a certain desired local or systemic effect at a reasonable benefit / risk ratio applicable to any treatment. The RNAi agent used in the method of the present disclosure can be administered in an amount sufficient to produce a reasonable benefit / risk ratio applicable to such treatment.

[0078] As used herein, the term "sample" includes similar fluids, cells or tissues separated from a subject, and a collection of fluids, cells or tissues present in a subject. Examples of biological fluids include blood, serum and serosal fluid, plasma, cerebrospinal fluid, ocular fluid, lymph, urine, saliva, etc. Tissue samples may include samples from tissues, organs or local areas. For example, a sample may be derived from a fluid or cell in a specific organ, an organ part or these organs. In certain embodiments, a sample may be derived from liver (for example, some segments of the whole liver or liver, or some types of cells in the liver, for example, hepatocytes). In a preferred embodiment, "sample derived from a subject" refers to blood or plasma extracted from the subject. In other embodiments, "sample derived from a subject" refers to liver tissue (or its subcomponent) derived from the subject.

[0079] In one aspect, the present disclosure provides a double-stranded RNAi agent, comprising an antisense strand and a sense strand complementary to the antisense strand forming a double-stranded region, wherein the nucleotide sequence of the antisense strand is as shown in SEQ ID NO: 13, or the nucleotide sequence of the antisense strand is a modified sequence of the sequence shown in SEQ ID NO: 13.

[0080] In some embodiments, the double-stranded RNAi agent comprises an oligonucleotide duplex consisting of a sense strand and an antisense strand pair: the sense strand has a sequence as shown in SEQ ID NO: 6 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof.

[0081] In some embodiments, the sense strand and the antisense strand comprise at least one modified nucleotide.

[0082] In some embodiments, the double-stranded RNAi agent has the function of inhibiting HBV gene expression.

[0083] In some embodiments, at least one of the modified nucleotides is selected from one or more of the group consisting of deoxy-nucleotides, 3'-terminal deoxy-thymidine nucleotides, 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides, unlocked nucleotides, conformationally restricted nucleotides, restricted ethyl nucleotides, abasic nucleotides, 2'-amino-modified nucleotides, 2'-O-allyl-modified nucleotides, 2'-C-alkyl-modified nucleotides, 2'-hydroxy-modified nucleotides, 2'-O-methoxyethyl-modified nucleotides, 2'-O-alkyl-modified nucleotides, morpholino nucleotides, phosphoramidates, nucleotides containing non-natural bases, tetrahydropyran-modified nucleotides, 1,5-anhydrohexitol-modified nucleotides, cyclohexenyl-modified nucleotides, nucleotides containing thiophosphate groups, nucleotides containing methylphosphate groups, nucleotides containing 5'-phosphates, and nucleotides containing 5'-phosphate mimetics.

[0084] In some embodiments, at least one strand of the double-stranded RNAi agent comprises a 3' overhang of at least 2 nucleotides.

[0085] In some embodiments, the double-stranded region of the double-stranded RNAi agent is 20 nucleotide pairs.

[0086] In some embodiments, the sense strand of the double-stranded RNAi agent has 20 nucleotides and the antisense strand has 22 nucleotides.

[0087] In some embodiments, all modifications comprised by the nucleotides on the sense strand and the antisense strand are chemical modifications at the 2' position of the ribose sugar of the nucleotide.

[0088] In some embodiments, the chemical modification of the 2' position of the nucleotide ribose is selected from one or more of the following groups: 2'-methoxy, 2'-O-methoxyethyl, 2'-fluoro, 2'-benzyloxy, 2'-methylcarbonylamino and 2'-pyridylmethoxy.

[0089] In some embodiments, the chemical modification at the 2' position of the ribose of the nucleotide is 2'-methoxy or 2'-fluoro.

[0090] In some embodiments, the nucleotides are linked by 3',5'-phosphodiester bonds.

[0091] In some embodiments, the 3',5'-phosphodiester bond comprises a thio modification.

[0092] In some embodiments, the 5'-carbon atom of the 5'-terminal nucleotide glycoside of the antisense strand is phosphorylated.

[0093] In some embodiments, the phosphorylated 5'-position phosphorylation group comprises one or more selected from: a 5'-vinyl phosphonate group, a 5'-methyl phosphonate group, a 5'-C-methyl phosphate group, a 5'-thiophosphate group and a 5'-phosphate group, and the structure is:

[0094]

[0095] ;

[0096] R is hydrogen, hydroxyl, amine, C 1-4 Alkyl, aromatic, C 1-4 Alkoxy, C 1-4 Alkylcarbonylamino or halogen;

[0097] The base is selected from any one of adenine, guanine, cytosine, thymine and uracil.

[0098] In some embodiments, the terminal nucleotides of the sequence are linked by 3',5'-phosphodiester bonds containing thio modification, and chirally pure 3',5'-phosphothioate diester bonds are formed.

[0099] In some embodiments, the 5' end of the sense strand and the antisense strand contain 1-3 thio linkages, and the 3' end of the antisense strand contains 1-3 thio linkages.

[0100] In some embodiments, the antisense strand is modified in one of the following ways:

[0101]

[0102]

[0103]

[0105] And / or, the sense strand is modified by one of the following methods:

[0106]

[0108] Among them, 2'-OMe is 2'-methoxy; 2'-F is 2'-fluoro; PS is a thiophosphate skeleton; and EVP is 5'-vinyl-(E)-phosphonate.

[0109] In some embodiments, the double-stranded RNAi agent is modified in the following manner:

[0110] The siRNA modification template with modification A in the antisense strand and modification a in the sense strand was named DV27P;

[0111] The siRNA modified template with modification A on the antisense strand and modification b on the sense strand was named DV29P;

[0112] The siRNA modification template with modification B in the antisense strand and modification a in the sense strand was named DV26P;

[0113] The siRNA modification template with modification B on the antisense strand and modification b on the sense strand was named DV28P;

[0114] The siRNA modification template with modification C on the antisense strand and modification b on the sense strand was named DV32P;

[0115] The siRNA modification template with modification D on the antisense strand and modification b on the sense strand was named DV34P;

[0116] The siRNA modified template with modification E on the antisense strand and modification a on the sense strand is named DV25P; or,

[0117] The siRNA modification template with modification F on the antisense strand and modification b on the sense strand was named DV33P.

[0118] In some embodiments, the second to eighth positions of the antisense strand from the 5' end adopt a modification group, and the modification group is selected from one or more of UNA, GNA and DNA, and the structures of UNA and GNA are:

[0119] ;

[0120] The base is selected from any one of adenine, guanine, cytosine, thymine and uracil.

[0121] In some embodiments, the double-stranded RNAi agent comprises any one oligonucleotide duplex selected from the following sense and antisense strand pairs:

[0122] (1) the sense strand has a sequence as shown in SEQ ID NO: 106; and the antisense strand has a sequence as shown in SEQ ID NO: 213, 214, 215 or 216;

[0123] (2) the sense strand has the sequence shown in SEQ ID NO: 107; and the antisense strand has the sequence shown in SEQ ID NO: 214 or 213;

[0124] (3) the sense strand has the sequence shown in SEQ ID NO: 108; and the antisense strand has the sequence shown in SEQ ID NO: 217 or 218;

[0125] (4) the sense strand has the sequence shown in SEQ ID NO: 109; and the antisense strand has the sequence shown in SEQ ID NO: 218; and,

[0126] (5) The sense strand has the sequence shown in SEQ ID NO: 110; and the antisense strand has the sequence shown in SEQ ID NO: 218.

[0127] (6) The sense strand has the sequence shown in SEQ ID NO: 306; and the antisense strand has the sequence shown in SEQ ID NO: 321.

[0128] The double-stranded RNA (dsRNA) agents (double-stranded RNAi agents) of the present disclosure may optionally be conjugated to one or more ligands. The ligand may be attached to the sense strand, antisense strand, or both strands at the 3' end, 5' end, or both ends. For example, the ligand may be conjugated to the sense strand. In a preferred embodiment, the ligand is bound to the 3' end of the sense strand. In a preferred embodiment, the ligand is a GalNAc ligand.

[0129] In another aspect, the present disclosure provides a conjugate, comprising the aforementioned double-stranded RNAi agent, and a ligand conjugated to the double-stranded RNAi agent.

[0130] In some embodiments, the ligand is conjugated to the 3'-end or the 5'-end of the sense strand of the oligonucleotide.

[0131] In some embodiments, the ligand is one or more GalNAc derivatives attached using a divalent or trivalent branched linkage, or a GalNAc derivative attached using a monovalent linkage.

[0132] In some embodiments, the ligand is:

[0133] ,

[0134] wherein X is hydrogen or a hydroxyl protecting group or H, wherein the hydroxyl protecting group includes acetyl, benzoyl or isobutyryl; Y is an amine protecting group or H, wherein the amine protecting group is formyl, acetyl, propionyl, n-butyryl or isobutyryl; n is an integer between 0 and 20; and q, r and s are independently integers between 1 and 7.

[0135] In some embodiments, the ligand is:

[0136] .

[0137] In some embodiments, the ligand is:

[0138] ,

[0139] Wherein, X is oxygen, nitrogen or sulfur;

[0140] Y is an alkyl group or an aromatic group;

[0141] R1 is oxygen or sulfur;

[0142] R2 is hydrogen, amine, C 1-4 Alkyl, aromatic, C 1-4 Alkoxy or halogen;

[0143] A is -(CH2) a -、-(CH2CH2O) b -、-((CH2) c NHCO) d -or-((CH2) c CONH) d -, wherein a is an integer from 1 to 15, b is an integer from 1 to 7, c is an integer from 1 to 7, and d is an integer from 1 to 5;

[0144] B is -(CH2) e -, where e is an integer from 0 to 7;

[0145] L is -CONH- or -NHCO-;

[0146] X1 is -(CH2) f -or-(CH2CH2O) fCH2-, f is an integer from 1 to 5;

[0147] X2 is -(CH2) g -, g is an integer from 1 to 6;

[0148] Y1 is 0 or 1;

[0149] Y2 is 0, 1 or 2;

[0150] Y3 is 1, 2 or 3;

[0151] m is an integer from 0 to 4;

[0152] n is an integer from 0 to 4.

[0153] In some embodiments, the ligand is G4, G5, G6 or G7:

[0154] ,

[0155] ,

[0156] ,or

[0157] .

[0158] In some embodiments, the conjugate has the structure shown below:

[0159] ,

[0160] ,

[0161] ,

[0162] ,or

[0163] .

[0164] In some embodiments, wherein the ligand is:

[0165]

[0166] Wherein, X is oxygen, nitrogen or sulfur;

[0167] Y is an alkyl group or an aromatic group;

[0168] R1 is oxygen or sulfur;

[0169] R2 is hydrogen, amine, C 1-4 Alkyl, aromatic, C 1-4 Alkoxy or halogen;

[0170] A is -(CH2) a -、-(CH2CH2O) b -、-((CH2) c NHCO) d -or-((CH2) c CONH) d -, wherein a is an integer from 1 to 15, b is an integer from 1 to 7, c is an integer from 1 to 7, and d is an integer from 1 to 5;

[0171] B is -(CH2) e -, where e is an integer from 0 to 7;

[0172] L is -CONH- or -NHCO-;

[0173] X1 is -(CH2) f -or-(CH2CH2O) f CH2-, f is an integer from 1 to 5;

[0174] X2 is -(CH2) g -, g is an integer from 1 to 6;

[0175] Y1 is 0 or 1;

[0176] Y2 is 0, 1 or 2;

[0177] Y3 is 1, 2 or 3;

[0178] m is an integer from 0 to 4;

[0179] n is an integer from 0 to 4.

[0180] In some embodiments, wherein the ligand is G101, G102, G103, G105 or G106:

[0181] , , , ,or .

[0182] In some embodiments, the conjugate has the structure shown below:

[0183] ,

[0184] ,

[0185] ,

[0186] ,or

[0187] .

[0188] In some embodiments, the conjugate comprises any one oligonucleotide duplex selected from the following sense and antisense strand pairs:

[0189] The sense strand has a sequence as shown in SEQ ID NO: 350, 351 or 352; and the antisense strand has a sequence as shown in SEQ ID NO: 321.

[0190] In some embodiments, the conjugate has the function of inhibiting HBV gene expression.

[0191] In another aspect, the present disclosure provides a pharmaceutical composition, comprising the aforementioned double-stranded RNAi agent or the aforementioned conjugate, and a pharmaceutically acceptable carrier.

[0192] In one embodiment, provided herein is a pharmaceutical composition containing a double-stranded RNAi agent as described herein and a pharmaceutically acceptable carrier. The pharmaceutical composition containing a double-stranded RNAi agent can be used to treat a disease or condition associated with the expression or activity of the HBV gene, such as chronic hepatitis B. Such pharmaceutical compositions are formulated based on a delivery model. An example is a composition formulated so as to be delivered parenterally, such as by intravenous (IV) delivery for systemic administration. Another example is the following composition, which is formulated for direct delivery to the brain parenchyma, such as by infusion to the brain, such as by continuous pump infusion.

[0193] The pharmaceutical composition comprising the double-stranded RNAi agent of the present disclosure can be, for example, a solution with or without a buffer or a composition containing a pharmaceutically acceptable carrier. Such compositions include, for example, aqueous or crystalline compositions, liposome formulations, micelle formulations, emulsions, and gene therapy vectors.

[0194] In the method of the present disclosure, the double-stranded RNAi agent can be administered in a solution. A free double-stranded RNAi agent can be administered in a non-buffered solution, for example, in physiological saline or in water. Alternatively, the free siRNA can also be administered in a suitable buffer solution. The buffer solution can include acetate, citrate, prolamin, carbonate or phosphate, or any combination thereof. In a preferred embodiment, the buffer solution is phosphate buffered saline (PBS). The pH and volume molar osmotic pressure concentration of the buffer containing the double-stranded RNAi agent can be adjusted so that it is suitable for administering to a subject.

[0195] In some embodiments, the buffer solution further comprises an agent for controlling the osmolality of the solution so that the osmolality is maintained at a desired value, such as the physiological value of human plasma. Solutes that can be added to the buffer solution to control the osmolality include, but are not limited to, proteins, peptides, amino acids, non-metabolizable polymers, vitamins, ions, sugars, metabolites, organic acids, lipids, or salts. In some embodiments, the agent for controlling the osmolality of the solution is a salt. In certain embodiments, the agent for controlling the osmolality of the solution is sodium chloride or potassium chloride.

[0196] The pharmaceutical composition of the present invention can be administered at a dosage sufficient to inhibit the expression of the HBV gene. Typically, the suitable dosage of the double-stranded RNAi agent of the present invention is within the range of about 0.001 to about 200.0 mg per kilogram of body weight per day, typically within the range of about 0.1 to 50 mg per kilogram of body weight per day. For example, a double-stranded RNAi agent (e.g., dsRNA) can be administered at a dosage of about 0.01, 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4. .3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7 .5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 1 44, 45, 46, 47, 48, 49, or about 50 mg / kg.

[0197] The pharmaceutical composition can be given once a day, or the double-stranded RNAi agent can be given twice, three times or more sub-doses at appropriate intervals in one day, or even can be given by controlled release formulations using continuous infusion or delivery. In this case, the double-stranded RNAi agent contained in each sub-dose must be correspondingly less, so as to achieve a daily total dose. The dosage unit can also be compounded for delivery within a few days, for example, using a conventional sustained release formulation that provides a lasting double-stranded RNAi agent release within a few days. Sustained release formulations are well known in the art and are particularly useful for delivering agents at specific sites, thus can be used with agents disclosed herein. In this embodiment, the dosage unit comprises a corresponding plurality of daily doses.

[0198] In other embodiments, a single dose of the pharmaceutical composition may be long-lasting, so that subsequent doses are administered at intervals of no more than 3, 4, or 5 days or at intervals of no more than 1, 2, 3, or 4 weeks. In some embodiments of the present disclosure, a single dose of the pharmaceutical composition of the present disclosure is administered once a week. In other embodiments of the present disclosure, a single dose of the pharmaceutical composition of the present disclosure is administered once a month.

[0199] Those skilled in the art will appreciate that certain factors may affect the dosage and timing required to effectively treat a subject, including, but not limited to, the severity of the disease or condition, previous treatment, the subject's overall health and / or age, and other existing diseases. In addition, treating a subject with a therapeutically effective dose of a composition may include a single treatment or a series of treatments. As described elsewhere herein, the effective dose and in vivo half-life of each double-stranded RNAi agent encompassed by the present disclosure may be estimated using conventional methods or based on in vivo testing using appropriate animal models.

[0200] The pharmaceutical compositions of the present disclosure may be administered in a number of ways, depending on whether local or systemic treatment is desired and on the area to be treated. Administration may be topical (e.g., by a skin patch); pulmonary; for example, by inhalation or insufflation of a powder or aerosol, including by a nebulizer; intratracheal; intranasal; epidermal and transdermal, oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subdermal, for example, via an implant device; or intracranial, for example, intraparenchymal, intrathecal or intraventricular administration.

[0201] The double-stranded RNAi agent used in the compositions and methods of the present disclosure can be formulated to deliver, for example, liposomes or micelles in a membranous molecular assembly. As used herein, the term "liposome" refers to a vesicle composed of amphiphilic lipids arranged in at least one double layer (e.g., a double layer or multiple double layers). Liposomes include single-layer or multi-layer vesicles having a film formed from a lipophilic material and an aqueous interior. The aqueous portion includes the double-stranded RNAi agent composition. The lipophilic material is separated from the aqueous exterior (although in some instances, it may include) that does not typically include a double-stranded RNAi agent composition. Liposomes are useful for transferring active ingredients and delivering them to the site of action. Because the liposome membrane is similar in structure to the biological membrane, when the liposome is applied to a tissue, the liposome double layer fuses with the double layer of the cell membrane. As the fusion of the liposome and the cell proceeds, the internal aqueous content including the double-stranded RNAi agent is delivered to the cell, wherein the double-stranded RNAi agent can specifically bind to a target RNA and can mediate RNAi. In some cases, the liposomes are also specifically targeted, for example to direct the double-stranded RNAi agent to a particular cell type.

[0202] Liposomes comprising double-stranded RNAi agents can be prepared by a variety of methods. In one example, the lipid component of the liposome is dissolved in a detergent so that micelles are formed with the lipid component. For example, the lipid component can be an amphipathic cationic lipid or a lipid conjugate. The detergent can have a high critical micelle concentration and can be nonionic. Exemplary detergents include cholate, CHAPS, octyl glucoside, deoxycholate, and lauroyl sarcosine. The double-stranded RNAi agent preparation is then added to the micelle comprising the lipid component. The cationic group on the lipid interacts with the double-stranded RNAi agent and condenses around the double-stranded RNAi agent to form a liposome. After condensation, the detergent is removed, for example, by dialysis to obtain a liposome preparation of a double-stranded RNAi agent.

[0203] Double-stranded RNAi agents, such as dsRNAs of the present disclosure, can be fully encapsulated in lipid formulations (eg, LNPs or other nucleic acid-lipid particles).

[0204] As used herein, the term "lipid nanoparticle (LNP)" refers to a stable nucleic acid-lipid particle. LNP contains a cationic lipid, a non-cationic lipid, and a lipid (e.g., a PEG-lipid conjugate) that prevents the particle from aggregating. LNP is extremely useful for synthetic applications because they exhibit prolonged circulation life after intravenous (iv) injection and accumulate at distal sites (e.g., at sites physically separated from the site of administration).

[0205] In one embodiment, the ratio of lipid to drug (mass / mass ratio) (e.g., lipid to dsRNA ratio) will be in the range of from about 1:1 to about 50:1, from about 1:1 to about 25:1, from about 3:1 to about 15:1, from about 4:1 to about 10:1, from about 5:1 to about 9:1, or about 6:1 to about 9:1.

[0206] In some embodiments, the double-stranded RNAi agent or the conjugate is administered in a non-buffered solution.

[0207] In some embodiments, the non-buffered solution is saline or water.

[0208] In some embodiments, the double-stranded RNAi agent or the conjugate is administered with a buffer solution.

[0209] In some embodiments, the buffer solution includes acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof.

[0210] In some embodiments, the buffer solution is phosphate buffered saline.

[0211] In some embodiments, the double-stranded RNAi agent or the conjugate is formulated into a lipid formulation for delivery in a membranous molecular assembly.

[0212] In some embodiments, the lipid formulation is a nucleic acid-lipid particle.

[0213] In some embodiments, the lipid formulation is a lipid nanoparticle.

[0214] In some embodiments, the mass / mass ratio of lipid to the double-stranded RNAi agent or the conjugate is 1:1-50:1, 1:1-25:1, 3:1-15:1, 4:1-10:1, 5:1-9:1, or 6:1-9:1.

[0215] In some embodiments, the lipid nanoparticles include cationic lipids, neutral lipids, structured lipids, and polymer-conjugated lipids.

[0216] In some embodiments, the cationic lipid is a compound of formula (I), or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof,

[0217] (I)

[0218] G1 is C 1～6 Alkylene; G2 is C 2～8 Alkylene; G3 is C 1～3 Alkylene; L1 is C6～15 Straight chain alkyl; L2 is C 12～25 Branched chain alkyl.

[0219] In some embodiments, the cationic lipid is YK-009 of formula (II) (see patent CN114044741B):

[0220] (II).

[0221] In some embodiments, the cationic lipid is a compound of formula (II), or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof,

[0222] (II)

[0223] G1 is C 2~8 Alkylene; G2 is C 2~8 Alkylene; L1 is -C(O)O- or -OC(O)-; L2 is -C(O)O- or -OC(O)-; R1 is C 6~25 Straight or branched alkyl; R2 is C 6~25 Straight chain or branched alkyl; G3 is HO(CH2)2- or HO(CH2)3-; G4 is HO(CH2)2- or HO(CH2)3-; L is (CH2)2- or -(CH2)3- or -(CH2)4-.

[0224] In some embodiments, the cationic lipid is YK-401 of formula (II-I) or YK-402 of formula (II-II) (see patent CN115784921B):

[0225] (II-I),

[0226] (II-II).

[0227] In some embodiments, the cationic lipid is a compound of formula (III), or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof,

[0228] (III)

[0229] G1 is C 1~6 Alkylene; G2 is C 2~8 Alkylene; R1 is C 6~20 Straight or branched alkyl; R2 is C 12~25Branched alkyl; G3 is: HO(CH2)2N(CH3)(CH2)2-, HO(CH2)2N(CH2CH3)(CH2)2-, (HO(CH2)2)2N(CH2)2-, CH3O(CH2)2N(CH3)(C H2)2-, (CH3)2N(CH2)3SC(O)O(CH2)2-, (CH3)2N(CH2)3SC(O)-, CH3NH(CH2)2N(CH3)(CH2)2- or CH3CH2NH(CH2)2-.

[0230] In some embodiments, the cationic lipid is YK-201 of formula (III-I) or YK-202 of formula (III-II) (see patent CN115677518B):

[0231] (III-I),

[0232] (III-II).

[0233] In some embodiments, the cationic lipid is a compound of formula (IV), or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof,

[0234] (IV),

[0235] G1 is C 1~8 Alkylene; G2 is C 2~8 Alkylene; R1 is C 6~25 Straight or branched alkyl; R2 is C 12~25 Straight or branched alkyl; G3 is: HO(CH2)2N(R3)CH2CH(OH)CH2-, wherein R3 is -CH3 or -CH2CH3 or -CH2CH2OH .

[0236] In some embodiments, the cationic lipid is YK-305 of formula (IV-I) or YK-310 of formula (IV-II) (see patent CN115745820B):

[0237] (IV-I),

[0238] (IV-II).

[0239] In some embodiments, the cationic lipid is a compound of formula (V), or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof,

[0240] (V),

[0241] G 1 and G 2 Each independently is an unsubstituted C6-C 10 Alkylene; G 3 For unsubstituted C1-C 12 Alkylene; R 1 and R 2 Each independently is C6-C 24 Alkyl or C6-C 24 Alkenyl; R 3 OR 5 、N、-C(=O)OR 4 、-OC(=O)R 4 or -NR 5 C(=O)R 4 ; R 4 C1-C 12 A hydrocarbon group; and R 5 It is H or C1-C6 hydrocarbon group.

[0242] In some embodiments, the cationic lipid is ALC0315 of formula (VI) (see patent CN108368028B):

[0243] (VI).

[0244] In some embodiments, the cationic lipid is a compound of formula (VI), or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof,

[0245] (VI)

[0246] R4 is selected from -(CH2) n Q and -(CH2) n CHQR; Q is selected from the group consisting of: -OR, -OH, -O(CH2) n N(R)2, -OC(O)R, -CX3, -CN, -N(R)C(O)R, -N(H)C(O)R, -N(R)S(O)2R, -N(H)S(O)2R, -N(R)C(O)N(R)2, -N(H)C(O)N(R)2, -N(H)C(O)N(H)(R), -N(R)C(S)N(R)2, -N(H)C(S)N(R)2, -N(H)C(S)N(H)(R), -N(R)S(O)2R8 and heterocycle; n is 1, 2 or 3.

[0247] In some embodiments, the cationic lipid is SM102 of formula (VI-I) (see patent CN110520409A):

[0248] (VI-I).

[0249] In some embodiments, the cationic lipid is a compound of formula (VII) DLIN-MC3-DMA (see CN102625696B), or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof,

[0250] (VII).

[0251] In some embodiments, the cationic lipid comprises one or more selected from the group consisting of: YK-009, YK-401, YK-305, ALC0315, SM102, and DLIN-MC3-DMA.

[0252] In some embodiments, the molar ratio of the cationic lipid to the neutral lipid is 1:1 to 10:1.

[0253] In some embodiments, the molar ratio of the cationic lipid to the structural lipid is 1:1 to 5:1.

[0254] In some embodiments, the molar ratio of the cationic lipid, the neutral lipid, the structural lipid, and the polymer-conjugated lipid is (25-65):(5-25):(25-70):(0.5-5).

[0255] In some embodiments, the molar ratio of the cationic lipid, the neutral lipid, the structural lipid, and the polymer-conjugated lipid is (25-65):(5-25):(25-45):(0.5-5).

[0256] In some embodiments, the molar ratio of the cationic lipid, the neutral lipid, the structural lipid, and the polymer-conjugated lipid is 50:10:38.5:1.5 or 49:10:39.5:1.5.

[0257] In some embodiments, the neutral lipids include one or more selected from the group consisting of phosphatidylcholine, phosphatidylethanolamine, sphingomyelin, ceramide, sterol and derivatives thereof.

[0258] In some embodiments, the neutral lipid is selected from one or more of the following: 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesteryl hemisuccinyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dialinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoyl phosphatidylethanolamine (POPE), distearoyl-phosphatidyl-ethanolamine (DSPE), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), 1-stearoyl-2-oleoyl-stearoylethanolamine (SOPE), 1-stearoyl-2-oleoyl-phosphatidylcholine (SOPC), sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyloleoylphosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine (LPE) and mixtures thereof.

[0259] In some embodiments, the neutral lipid is 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine and / or 1,2-distearoyl-sn-glycero-3-phosphocholine.

[0260] In some embodiments, the structured lipid is selected from one or more of the following: cholesterol, non-sterols, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatine, ursolic acid, alpha-tocopherol, and corticosteroids.

[0261] In some embodiments, the structured lipid is cholesterol.

[0262] In some embodiments, the polymer-conjugated lipid is selected from one or more of the following: PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, and PEG-modified dialkylglycerol.

[0263] In some embodiments, the polymer conjugated lipid is selected from one or more of the following: distearoylphosphatidylethanolamine polyethylene glycol 2000 (DSPE-PEG2000), dimyristoylglycerol-3-methoxy polyethylene glycol 2000 (DMG-PEG2000) and methoxy polyethylene glycol ditetradecanoyl acetamide (ALC-0159).

[0264] Pharmaceutical compositions of the present disclosure include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions can be produced from a variety of components, including, but not limited to, preformed liquids, self-emulsifying solids, and self-emulsifying semisolids. Particularly preferred are formulations that target the liver when treating liver disorders (e.g., liver cancer).

[0265] The pharmaceutical compositions of the present disclosure (which may conveniently be in unit dosage form) may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the following steps: combining the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the pharmaceutical compositions are prepared by uniformly and finely combining the active ingredients with a liquid carrier or a finely dispersed solid carrier or both, and, if desired, shaping the product.

[0266] Pharmaceutical compositions of the present disclosure can be formulated into any one of many possible dosage forms, such as but not limited to tablets, capsules, gel capsules, liquid syrups, soft capsules, suppositories and enemas. Pharmaceutical compositions of the present disclosure can also be formulated into suspensions in aqueous, non-aqueous media or mixed media. Aqueous suspensions can further include materials that increase the viscosity of the suspension, such materials include, for example, sodium carboxymethylcellulose, sorbitol and / or dextran. The suspension can also include a stabilizer.

[0267] Some pharmaceutical compositions of the present disclosure also incorporate carrier compounds into the formulation. As used herein, "carrier compound" or "carrier" may refer to a nucleic acid or its analog, which is inert (i.e., not biologically active per se), but is considered to be a nucleic acid in the in vivo process, such as by degrading biologically active nucleic acids or promoting their removal from the circulation to reduce the bioavailability of biologically active nucleic acids. Co-administration of nucleic acids and carrier compounds (generally an excess of the latter substance) can result in a significant reduction in the amount of nucleic acids recovered in the liver, kidneys, or other external circulation reservoirs, assuming that competition for common receptors between the carrier compound and the nucleic acid is due. For example, when co-administered with polyinosinic acid, dextran sulfate, polycytidylic acid, or 4-acetamido-4'stilbene isothiocyanate-2,2'-disulfonic acid, the recovery of partially phosphorothioated dsRNA in liver tissue can be reduced.

[0268] In contrast to carrier compounds, a "pharmaceutical carrier" or "excipient" is a pharmaceutically acceptable solvent, suspending agent, or any other pharmaceutically inert vehicle for delivering one or more nucleic acids to an animal. The excipient may be liquid or solid, and when combined with the nucleic acid and other components of a particular pharmaceutical composition, the excipient is selected to provide the desired volume, consistency, etc., with reference to the intended mode of administration. Typical pharmaceutical carriers include, but are not limited to, binders (e.g., pregelatinized corn starch, polyvinyl pyrrolidone, or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates, or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silicon dioxide, colloidal silicon dioxide, stearic acid, metal stearates, hydrogenated vegetable oils, corn starch, polyethylene glycol, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulfate, etc.).

[0269] Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration, which do not react toxically with nucleic acids, can also be used to prepare the pharmaceutical compositions of the present disclosure. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, saline solution, alcohol, polyethylene glycol, gelatin, lactose, straight-chain starch, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinyl pyrrolidone, etc.

[0270] The preparation that is used for local administration of nucleic acid can comprise the aseptic or non-aseptic aqueous solution, non-aqueous solution in common solvent such as alcohol, or the nucleic acid solution in liquid or solid oil matrix.These solutions can also comprise buffer, diluent and other suitable additives.Can use be suitable for non-parenteral administration and do not have toxic reaction with nucleic acid, pharmaceutically acceptable organic or inorganic excipient.

[0271] Suitable pharmaceutically acceptable excipients include, but are not limited to, water, saline solution, alcohol, polyethylene glycol, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinyl pyrrolidone, and the like.

[0272] The dosage form, carrier compound, drug carrier, excipient, etc. of the above-mentioned pharmaceutical composition are described in U.S. Patent No. 10125369B2, which is incorporated herein by reference.

[0273] In another aspect, the present disclosure provides a kit of parts, comprising kit A, wherein kit A includes one or more of the aforementioned double-stranded RNAi agents, conjugates or pharmaceutical compositions.

[0274] In some embodiments, the kit further comprises a kit B, wherein the kit B contains one or two of the following:

[0275] (1) Other drugs for reducing HBV gene expression or compositions containing such drugs for reducing HBV gene expression;

[0276] (2) One or more of the group consisting of hormonal agents, targeted small molecule agents, proteasome inhibitors, imaging agents, diagnostic agents, chemotherapeutic agents, oncolytic drugs, cytotoxic agents, cytokines, activators of co-stimulatory molecules, inhibitors of inhibitory molecules, and vaccines.

[0277] The "other drugs for reducing HBV gene expression or compositions containing the drugs for reducing HBV gene expression" described herein refer to drugs that do not contain the double-stranded RNAi agent, conjugate or pharmaceutical composition provided by the present disclosure.

[0278] In another aspect, the present disclosure provides use of the aforementioned double-stranded RNAi agent, conjugate or pharmaceutical composition in the preparation of a drug for preventing and / or treating diseases related to HBV gene expression.

[0279] In some embodiments, the HBV gene expression-related disease is selected from the following disease types: chronic hepatitis B, liver fibrosis, cirrhosis, liver cancer, acute hepatitis B, and HBV / hepatitis D virus co-infection-related diseases.

[0280] In another aspect, the present disclosure provides a method for reducing HBV gene expression or inhibiting HBV replication for non-preventive and / or therapeutic purposes, the method comprising administering one or more of the aforementioned double-stranded RNAi agents, conjugates, pharmaceutical compositions and kits to a sample.

[0281] The "non-preventive and / or therapeutic purpose" mentioned herein refers to reducing HBV gene expression or inhibiting HBV replication for scientific research purposes, such as in the laboratory.

[0282] The nucleotide abbreviations herein are as follows:

[0283] A = Adenosine-3'-phosphate

[0284] Am=2'-methoxyadenosine-3'-phosphate

[0285] Ams = 2'-methoxyadenosine-3'-phosphorothioate

[0286] Af = 2'-fluoroadenosine-3'-phosphate

[0287] Afs = 2'-fluoroadenosine-3'-phosphorothioate

[0288] G = Guanosine-3'-phosphate

[0289] Gm = 2'-methoxyguanosine-3'-phosphate

[0290] Gms = 2'-methoxyguanosine-3'-phosphorothioate

[0291] Gf = 2'-fluoroguanosine-3'-phosphate

[0292] Gfs = 2'-fluoroguanosine-3'-phosphorothioate

[0293] C = Cytidine-3'-phosphate

[0294] Cm = 2'-methoxycytidine-3'-phosphate

[0295] Cms = 2'-methoxycytidine-3'-phosphorothioate

[0296] Cf = 2'-fluorocytidine-3'-phosphate

[0297] Cfs = 2'-fluorocytidine-3'-phosphorothioate

[0298] U = Uridine-3'-phosphate

[0299] Um = 2'-methoxyuridine-3'-phosphate

[0300] Ums = 2'-methoxyuridine-3'-phosphorothioate

[0301] Uf = 2'-fluorouridine-3'-phosphate

[0302] Ufs = 2'-fluorouridine-3'-phosphorothioate

[0303] AmsEVP = 5'-vinyl-(E)-phosphonate-2'-methoxyadenosine-3'-phosphorothioate

[0304] UmsEVP = 5'-vinyl-(E)-phosphonate-2'-methoxyuridine-3'-phosphorothioate

[0305] A(gna) = adenosine diol nucleic acid

[0306] C(gna) = cytidine-diol nucleic acid

[0307] G(gna)=guanosine diol nucleic acid

[0308] T(gna) = thymidine diol nucleic acid

[0309] U(gna) = uridine-diol nucleic acid

[0310] dA = deoxyadenosine-3'-phosphate

[0311] dG = deoxyguanosine-3'-phosphate

[0312] dC = deoxycytidine-3'-phosphate

[0313] dT = deoxythymidine-3'-phosphate

[0314] The following examples are used to illustrate the present disclosure, but are not intended to limit the scope of the present disclosure. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0315] Example 1: Synthesis of small interfering oligonucleotides modified with DV29P template

[0316] A total of 36 siRNA basic sequences were designed, with Alnylam's VIR-2218 as the positive ginseng, and the sequence number in this embodiment is APC-VIR; ANC-DV29P is used as a negative control. The basic sequence was modified using the DV29P template. The 7, 9, 11, and 17 positions of the sense chain were 2'-F modified, and the remaining positions were 2'-OMe modified; the 2, 4, 5, 6, 14, and 16 positions of the antisense chain were 2'-F modified, and the remaining positions were 2'-OMe modified. In addition, there are two thio modifications at the 5' end of the sense chain; there are two thio modifications at the 5' end and 3' end of the antisense chain; and there is an EVP modification at the 5' end of the antisense chain. The siRNA sequences modified with the DV29P template are shown in Table 1.

[0317] 1. Synthesis of DV29P template modified sequence A194-DV29P

[0318] The basic sequence of the small interfering RNA with sequence number A194-DV29P in Table 1 is:

[0319] Sense strand: 5'- UCGUGUUACAGGCGGGGUUUU -3' (SEQ ID NO: 15)

[0320] Antisense strand: 5'-AAAACCCCGCCUGUAACACGAGA -3' (SEQ ID NO: 47)

[0321] The sense strand is modified with 2'-F at positions 7, 9, 11, and 17, and the rest are modified with 2'-OMe; the antisense strand is modified with 2'-F at positions 2, 4, 5, 6, 14, and 16, and the rest are modified with 2'-OMe. In addition, there are two thio-modifications at the 5' end of the sense strand; two thio-modifications at the 5' and 3' ends of the antisense strand; and one EVP modification at the 5' end of the antisense strand.

[0322] Instruments and reagents: Qingke 192 P model DNA / RNA automatic synthesizer, whose solid phase carrier is a universal carrier of cross-linked polystyrene beads, model Primer support 5G Unylinker 350 (cytiva manufacturer).

[0323] Preparation method:

[0324] According to the monomer concentration of 0.15 M, the following nucleotide monomer solutions were prepared with acetonitrile: DMT-A-OMe phosphoramidite monomer (Formula 1), DMT-C-OMe phosphoramidite monomer (Formula 2), DMT-G-OMe phosphoramidite monomer (Formula 3) and DMT-U-OMe phosphoramidite monomer (Formula 4), DMT-AF phosphoramidite monomer (Formula 5), ​​DMT-CF phosphoramidite monomer (Formula 6), DMT-GF phosphoramidite monomer (Formula 7), DMT-UF phosphoramidite monomer (Formula 8), vinyl-(E)-phosphonate-A-OMe phosphoramidite monomer (Formula 9), and vinyl-(E)-phosphonate-U-OMe phosphoramidite monomer (Formula 10).

[0325] Formula 1 Formula 2

[0326] Formula 3 Formula 4

[0327] Formula 5 Formula 6

[0328] Formula 7 Formula 8

[0329] Formula 9 Formula 10

[0330] The 7th base from the 5' end of the antisense strand of the APC-VIR sequence of Yangshen contains a glycol nucleic acid (GNA) modification, and the structure of the GNA monomer is as follows:

[0331] (S)-GNA-U (S)-GNA-C

[0332] (S)-GNA-A (S)-GNA-G

[0333] Prepared by the following steps:

[0334] (1) Deprotection

[0335] A 3% dichloroacetic acid solution in toluene was used as a deprotection agent to remove the DMT protecting group, followed by washing with acetonitrile.

[0336] (2) Coupling

[0337] Each nucleotide monomer in acetonitrile was coupled using 0.25 M 5-ethylthiotetrazolyl in acetonitrile as an activating agent, followed by rinsing with acetonitrile.

[0338] (3) Oxidation / sulfurization

[0339] Oxidation: Oxidation was performed using a 0.05 M iodine solution in pyridine / water (90 / 10) as the oxidant, followed by rinsing with acetonitrile.

[0340] Sulfurization: Use 3% hydrogenated xanthan gum in pyridine as the sulfurizing agent for sulfurization, and then use acetonitrile for washing.

[0341] (4) Hydroxyl protection

[0342] Hydroxyl protection was performed using 10% acetic anhydride in tetrahydrofuran (CAP A) and tetrahydrofuran / pyridine / nitromethylimidazole 74 / 10 / 16 (v / v / v) (CAP B) as hydroxyl protecting reagents, followed by rinsing with acetonitrile.

[0343] Repeat the above steps and cycle according to the set sequence to obtain a fully protected product.

[0344] (5) Use 3% dichloroacetic acid in toluene as a deprotection reagent to remove the DMT protecting group of the last nucleotide, and then use acetonitrile for washing.

[0345] (6) Aminolysis and purification

[0346] The solid phase carrier is transferred to the reactor, concentrated ammonia water (25-28%) is added, and after maintaining the aminolysis at 60°C for 12 hours, the system is cooled to room temperature, and the mixture is filtered and rinsed with a mixed solution of purified water and ethanol. The filtrates are combined, passed through a chromatography column, concentrated, and freeze-dried to obtain the product.

[0347] (7) Annealing

[0348] The purified sense strand and antisense strand were mixed in a 1:1 ratio, heated to 95°C and maintained for 3 min, and then slowly cooled to room temperature to form a double strand.

[0349] A194-DV29P purity: 90.52%; measured molecular weight: 14727.09.

[0350] 2. Synthesis of other sequences

[0351] The other sequences listed in Table 1 were synthesized according to the above method.

[0352] Table 1 DV29P template modified siRNA sequences

[0353]

[0354]

[0355]

[0356]

[0357]

[0358]

[0359]

[0360]

[0361] Example 2: Inhibitory effect of DV29P template modified sequence on HBsAg and HBeAg

[0362] After the DV29P template-modified siRNA sequence synthesized in Example 1 was transfected into HepG2.2.15 cells via lipid nanoparticles (LNP), the inhibitory effect of each sequence on HBsAg and HBeAg was detected using ELISA technology.

[0363] 1. Experimental Materials

[0364] Test samples: DV29P template-modified siRNA sequences listed in Table 1 (synthesized in Example 1).

[0365] Cell type: HepG2.2.15 cells

[0366] Drug solvent: sterile enzyme-free water, Gibco Opti-MEM (Thermo Fisher Scientific).

[0367] 2. Experimental methods

[0368] ELISA was used to detect the inhibition of samples on HBsAg and HBeAg in HepG2.2.15 cell line.

[0369] 2.1 Cell culture

[0370] Subculture: HepG2.2.15 cells were subcultured in DMEM / F12 medium containing 10% fetal bovine serum, 370 μg / ml GENETICN, 1% L-glutamine, 1% non-essential amino acids, and 1% penicillin-streptomycin, and placed in a cell culture incubator at 37°C with 5% CO2, and subcultured every three days. Digested and subcultured with 0.25% trypsin, centrifuged at 800 r / min for 3 min, discarded the supernatant, and added fresh medium for subculture.

[0371] Plating culture: HepG2.2.15 cells were plated and cultured in DMEM / F12 medium containing 10% fetal bovine serum, 1% L-glutamine, 1% non-essential amino acids, and 1% penicillin-streptomycin.

[0372] 2.2 Cell transfection

[0373] Preparation of transfection mixture: Lipofectamine TM RNAiMAX (Thermo Fisher Scientific) and Opti-MEM were mixed at a ratio of 2:98 and vortexed.

[0374] Preparation of transfection complex: Add 30 μL of siRNA solution diluted in Opti-MEM to 30 μL of transfection mixture at a ratio of 1:1 (v / v), vortex to mix, and let stand at room temperature for 15 min to obtain transfection complex.

[0375] Transfection control group transfection reagent preparation: Add 15 μL of the prepared transfection mixture to 15 μL of Opti-MEM. Vortex to mix well and let stand at room temperature for 15 min.

[0376] Add the prepared transfection complex to a 96-well cell culture plate (15 μL per well, 3 replicates per sequence) to make the final siRNA concentration in each well 0.3 nM. Add 135 μL of cell suspension (containing 2.25×10 4 cells). After mixing using the cross method, the cells were placed in a cell culture incubator at 37°C and 5% CO2.

[0377] 2.3 Detection of HBsAg and HBeAg in cell supernatant

[0378] 1) Collection of cell supernatant

[0379] a. On the third day after cell transfection, change the medium, discard the cell supernatant, and add 150 μL / well of fresh medium to continue culturing.

[0380] b. Collect cell supernatant on day 6 after transfection for detection of HBsAg and HBeAg levels.

[0381] 2) Quantitative detection of HBsAg and HBeAg

[0382] Use the Hepatitis B virus e antigen detection kit (Antu Biotechnology CL0310) and the Hepatitis B virus surface antigen detection kit (Antu Biotechnology CL0312) to detect the concentration of HBsAg and HBeAg. The specific steps are as follows:

[0383] a. Return the test kit and the sample to be tested to room temperature.

[0384] b. Add 50 μL of the sample, standard, negative control, and ginseng to the well plate.

[0385] c. Add 50 μL of enzyme conjugate to each well, mix thoroughly and incubate at 37°C for 60 min.

[0386] d. Remove the liquid from the plate and wash it five times with detergent. Finally, pat the plate dry on absorbent paper.

[0387] e. Mix luminescent substrates A and B in equal proportions, add 50 μL / well, and react at room temperature in the dark for 3 min.

[0388] f. Measure the luminescence value on an enzyme-labeled instrument.

[0389] 2.4 Data Processing

[0390] The calculation formula of HBsAg and HBeAg inhibition rate is as follows:

[0391] HBsAg inhibition rate (%) = (1-HBsAg expression level in sample / HBsAg expression level in transfection control group in the same plate) × 100%;

[0392] HBeAg inhibition rate (%) = (1-HBeAg expression level in the sample / HBeAg expression level in the transfection control group in the same plate) × 100%.

[0393] The inhibition rate of HBsAg relative to Yang Shen (the inhibition rate of Yang Shen is set to 1) = sample HBsAg inhibition rate (%) / Yang Shen inhibition rate (%) in the same plate; it should be understood that a value greater than 1 indicates that the sequence has a better inhibitory effect on HBsAg than Yang Shen, and a value less than 1 indicates that the sequence has a lower inhibitory efficiency on HBsAg than Yang Shen.

[0394] The inhibition rate of HBeAg relative to Yang Shen (the inhibition rate of Yang Shen is set to 1) = the inhibition rate of HBeAg in the sample (%) / the inhibition rate of Yang Shen in the same plate (%); it should be understood that a value greater than 1 indicates that the sequence has a better inhibitory effect on HBeAg than Yang Shen, and a value less than 1 indicates that the sequence has a lower inhibitory efficiency on HBeAg than Yang Shen.

[0395] 2.5 IC50 experiment

[0396] In this experiment, the concentration of each sequence was set starting from 10 nM and diluted 4 times, with a total of 8 concentration points (10 nM, 2.5 nM, 0.625 nM, 0.15625 nM, 39.06 pM, 9.77 pM, 2.44 pM and 0.61 pM). The inhibition rate of each sequence at each concentration was measured, and a plot was drawn to calculate the IC50 concentration of each sequence and Yangshen.

[0397] 2.6 Cytotoxicity assay

[0398] When conducting IC50 experiments, the cell supernatant was collected and then assayed using CellTiter-Glo ® The cell viability was determined by the Promega kit. The method was briefly described as follows: CellTiter-Glo reagent was mixed with culture medium in a ratio of 1:1, 100 μL was added to each well, and the cells were incubated at room temperature for 10 min. The luminescent signal was then detected using an enzyme-labeled instrument.

[0399] The formula for calculating cell viability is: Cell viability (%) = (sample signal value – blank control average) / (transfection control average – blank control average) × 100%.

[0400] 3. Experimental results

[0401] The experimental results showed that the sequences B207S-DV29P, B1572-DV29P, B1575-DV29P, B418S-DV29P, A206-DV29P, A416-DV29P, A1548-DV29P, A1550-DV29P, and A1573-DV29P had significantly better inhibitory effects on HBsAg than other sequences, and significantly better inhibitory effects on HBeAg than other sequences.

[0402] The expression inhibition rate of HBsAg and HBeAg of each sequence at a single concentration and the inhibition rate relative to the Yangshen sequence APC-VIR are shown in Tables 3, 4, 5 and 6.

[0403] The results of single-concentration screening experiments showed that some sequences modified with template DV29P, including B207S-DV29P, B1572-DV29P, B1575-DV29P, B418S-DV29P, A206-DV29P, A416-DV29P, A1548-DV29P, A1550-DV29P, and A1573-DV29P (specific sequences are shown in Table 2 ) ranked higher than Yangshen APC-VIR in terms of inhibition rate against HBsAg and HBeAg.

[0404] The IC50 test and cytotoxicity results of each sequence are shown in Table 7. The IC50 test results show that the IC50 values ​​of the 11 candidate sequences modified by the disclosed design modification template DV29P are between 0.01 and 0.08 nM for HBsAg, which are better than 0.1777 nM of Yangshen; for example, the IC50 values ​​of A261-DV29P, A1573-DV29P, and A206-DV29P are 0.0169 nM, 0.0226 nM, and 0.0226 nM, respectively. These sequences can effectively inhibit the expression of HBsAg at low concentrations. The IC50 values ​​of these 11 candidate sequences for HBeAg were between 0.06 and 0.4 nM, which were better than 0.7685 nM of Yangshen; for example, the IC50 values ​​of A1573-DV29P, A206-DV29P, and A1550-DV29P were 0.0684 nM, 0.1105 nM, and 0.1202 nM, respectively. Cytotoxicity results showed that among the 11 sequences, except for sequence A416-DV29P, which had a cell viability of 81.82% at the highest tested concentration of 10 nM, the cell viabilities of the remaining sequences were all greater than 90%, showing no obvious cytotoxicity, indicating that the sequences have a wide concentration selection range.

[0405] The HBsAg inhibition effect was the main focus, while the HBeAg inhibition effect was also taken into consideration. Based on the above results, 9 sequences were selected from the 11 sequences for further optimization design, and the sequences B207S-DV29P, B1572-DV29P, B1575-DV29P, B418S-DV29P, A206-DV29P, A416-DV29P, A1548-DV29P, A1550-DV29P, and A1573-DV29P could be used as candidate sequences.

[0406] Table 2 siRNA sequences with higher inhibition rates on HBsAg and HBeAg than those of Yangshen

[0407]

[0408]

[0409] (i) Inhibitory effect of each sequence on HBV gene expression at a single concentration after modification with DV29P template

[0410] (1) The sequences with better HBsAg inhibition effect than Yangshen are shown in Table 3, including B207S-DV29P, B1575-DV29P, B1572-DV29P, B418S-DV29P, A261-DV29P, A206-DV29P, A1550-DV29P, A1573-DV29P, A1548-DV29P, and A416-DV29P. Among them, the inhibition rates of B207S-DV29P, B1575-DV29P, B1572-DV29P, and B418S-DV29P on HBsAg at a concentration of 0.3 nM were all over 80%. For example, the inhibition rate of B207S-DV29P reached 93.37%, which was 23.59% higher than that of Yangshen.

[0411] Table 3 The inhibition rate of HBsAg is higher than that of DV29P modified sequence of Yangshen

[0412]

[0413] (2) The sequences with inferior HBsAg inhibition effect than that of Yangshen are shown in Table 4. For example, the inhibition rate of sequence B416S-DV29P on HBsAg is only 6.98%.

[0414] Table 4 The inhibition rate of HBsAg is lower than that of DV29P modified sequence of Yangshen

[0415]

[0416] (3) The sequences with better HBeAg inhibition effect than Yangshen are shown in Table 5, among which B1575-DV29P, B207S-DV29P, B1572-DV29P, and B418S-DV29P ranked the highest, being 38.62%, 22.07%, 17.10%, and 13.24% better than Yangshen, respectively.

[0417] Table 5 The inhibition rate of HBeAg is higher than that of DV29P modified sequences of Yangshen

[0418]

[0419] (4) The sequences with inferior HBeAg inhibition effect than Yangshen are shown in Table 6. For example, the inhibition rate of sequence A1520-DV29P was only 0.28% at a concentration of 0.3 nM.

[0420] Table 6 The inhibition rate of HBeAg is lower than that of DV29P modified sequence of Yangshen

[0421]

[0422] (ii) IC50 experiment and cytotoxicity results

[0423] We selected 9 sequences, including B207S-DV29P, B1572-DV29P, B1575-DV29P, B418S-DV29P, A206-DV29P, A416-DV29P, A1548-DV29P, A1550-DV29P, and A1573-DV29P, in single-concentration experiments and conducted IC50 experiments. The results showed that the IC50 values ​​of these candidate sequences for HBsAg and HBeAg were all lower than that of Yangshen, proving that the inhibitory effects were better than Yangshen. For example, the IC50 values ​​of A261-DV29P, A1573-DV29P, and A206-DV29P for HBsAg were 0.019 nM, 0.022 nM, and 0.024 nM, respectively, and the IC50 values ​​of A1573-DV29P, B207S-DV29P, A206-DV29P, and A1550-DV29P for HBeAg were 0.079 nM, 0.093 nM, 0.115 nM, and 0.138 nM, respectively. The specific results are shown in Table 7.

[0424] The cytotoxicity results showed that among these sequences, except for sequence A416-DV29P, which had a cell viability of 81.82% at the highest tested concentration of 10 nM, the cell viabilities of the remaining sequences were all greater than 90%, showing no obvious cytotoxicity, indicating that the sequences had a wide concentration selection range. The specific results are shown in Table 7.

[0425] Table 7 IC50 experiments on HBsAg and HBeAg

[0426]

[0427] Example 3: Inhibitory effect of unmodified sequences on HBV genes

[0428] In this example, some unmodified sequences corresponding to the modified sequences in Example 1 were synthesized and transfected into HepG2.2.15 cells via lipid nanoparticles (LNP). The inhibitory effects of each sequence on HBsAg and HBeAg were detected using ELISA technology, and unmodified siRNA sequences with better inhibitory effects were screened out.

[0429] 1. Experimental Materials

[0430] Test samples:

[0431] The unmodified siRNA sequences are listed in Table 8. All sequences were synthesized according to the method in Example 1.

[0432] Table 8 Unmodified siRNA sequences

[0433]

[0434] Cell type: HepG2.2.15 cells

[0435] Drug solvent: sterile enzyme-free water, Gibco Opti-MEM.

[0436] 2. Experimental methods

[0437] Referring to Example 2, the screening concentration was set to 0.3 nM.

[0438] 3. Experimental results

[0439] The experimental results show that the sequences B207S, B1572, B1575, B418S, A206, A416, A1548, A1550, and A1573 have significantly better inhibitory effects on HBsAg and HBeAg than other sequences.

[0440] The expression inhibition rates of HBsAg and HBeAg of each sequence at a single concentration that are better than those of Yangshen are shown in Table 9, including B207S, B1575, B418S, A1573, B1572, A261, A206, A1550, A416, and A1548. Among them, the inhibition rates of B207S on HBsAg and HBeAg reached 77.02% and 40.74%, respectively, which were significantly better than 61.45% and 20.85% of the Yangshen sequence APC.

[0441] Table 9 The inhibition rate of HBsAg and HBeAg is higher than that of the basic sequence of Yangshen

[0442]

[0443] Example 4: Inhibitory effects of sequences modified with different templates on HBsAg and HBeAg

[0444] In this embodiment, the unmodified sequences A205, B208, B207S, A261, B262, B264, A1550, B1556, B1560, B1575, A1573, B1572, B418S, A416, B416S, a total of 15 sequences, are modified by using the 8 modification templates DV25P, DV26P, DV27P, DV28P, DV29P, DV32P, DV33P and DV34P designed by the present disclosure, and the existing public templates DV30P, DV31P, DV21P, DV22P, a total of 154 sequences. After being transfected into HepG2.2.15 cells through lipid nanoparticles (LNP), the inhibitory effects of each sequence on HBsAg and HBeAg were detected by ELISA technology.

[0445] 1. Experimental Materials

[0446] Test samples: Table 11 lists sequences modified from 15 siRNA basic sequences using different templates (DV25P, DV26P, DV27P, DV28P, DV29P, DV32P, DV33P, DV34P, DV30P, DV31P, DV21P, DV22P) (the synthesis method refers to Example 1).

[0447] Cell type: HepG2.2.15 cells

[0448] Drug solvent: sterile enzyme-free water, Gibco Opti-MEM

[0449] The modification principles of the disclosed modification template are as follows:

[0450] When the antisense strand is 23 nucleotides in length, the antisense strand adopts one or a combination of two or more of the modification methods shown in Table 10-1 below:

[0451] Table 10-1 Antisense strand modification methods

[0452]

[0453]

[0454]

[0455] When the antisense strand is 22 nucleotides in length, the antisense strand adopts one or a combination of two or more of the modification methods shown in Table 10-2 below:

[0456] Table 10-2 Antisense strand modification methods

[0457]

[0458]

[0459] When the length of the sense strand is 21 nucleotides, the sense strand adopts one or a combination of two of the modification methods shown in Table 10-3 below:

[0460] Table 10-3 Sense chain modification methods

[0461]

[0462] When the length of the sense strand is 20 nucleotides, the sense strand adopts one or a combination of two of the modification methods shown in Table 10-4 below:

[0463] Table 10-4 Sense chain modification methods

[0464]

[0465] In Tables 10-1 to 10-4 above, 2'-OMe is 2'-methoxy; 2'-F is 2'-fluoro; PS is a phosphorothioate skeleton; EVP is 5'-vinyl-(E)-phosphonate;

[0466] The siRNA modified template in which the antisense strand was modified by A and the sense strand was modified by a was named DV27P;

[0467] The siRNA modified template in which the antisense strand was modified by A and the sense strand was modified by b was named DV29P;

[0468] The siRNA modified template in which the antisense strand was modified by B and the sense strand was modified by a was named DV26P;

[0469] The siRNA modification template in which the antisense strand was modified with modification B and the sense strand was modified with modification b was named DV28P;

[0470] The siRNA modification template in which the antisense strand was modified by C and the sense strand was modified by b was named DV32P;

[0471] The siRNA modification template in which the antisense strand was modified with D and the sense strand was modified with b was named DV34P;

[0472] The siRNA modified template in which the antisense strand was modified by E and the sense strand was modified by a was named DV25P;

[0473] The siRNA modification template in which the antisense strand is modified by F and the sense strand is modified by b is named DV33P.

[0474] The synthesis methods of each sequence are the same as in Example 1.

[0475] Table 11 Sequences modified using different modification templates

[0476]

[0477]

[0478]

[0479]

[0480]

[0481]

[0482]

[0483]

[0484]

[0485]

[0486]

[0487]

[0488]

[0489]

[0490]

[0491]

[0492]

[0493]

[0494]

[0495]

[0496]

[0497]

[0498]

[0499]

[0500]

[0501]

[0502]

[0503]

[0504]

[0505]

[0506]

[0507] 2. Experimental methods

[0508] Referring to Example 2, the concentration of the single concentration screening experiment was set to 0.3 nM.

[0509] 3. Experimental results

[0510] The experimental results showed that the sequences B207S-DV32P, A1550-DV27P, B1572-DV27P, B1575-DV27P, B207S-DV29P, A1573-DV29P, B1575-DV29P, B418S-DV34P, and A416-DV27P had significantly better inhibitory effects on HBsAg than the Yangshen sequence, and significantly better inhibitory effects on HBeAg than the Yangshen sequence.

[0511] The inhibition rate of each sequence on the expression of HBsAg and HBeAg at a single concentration and the inhibition rate relative to the Yangshen sequence APC-VIR are shown in Table 12-41. The comprehensive ranking is expressed as the ranking of the inhibition rate of the sequence relative to Yangshen.

[0512] The results of the single concentration screening experiment showed that some basic sequences modified with the modified templates DV25P-29P and DV32P-34P designed by the present disclosure had a better inhibitory effect on HBsAg and HBeAg than the Yangshen sequence. Among them, the modified sequences designed with the basic sequences B207S and B1575 ranked the highest in terms of HBsAg inhibition rate, proving the sensitivity of the target position, among which the sequences B207S-DV29P, B207S-DV32P, B1575-DV29P, B1575-DV26P and B1575-DV27P all had an inhibition rate of more than 90% on HBsAg. For example, the inhibition rates of sequences B207S-DV29P and B1575-DV29P on HBsAg reached 92.11% and 91.78%, respectively. Among them, the modified sequences designed based on the basic sequences B1575 and A1573 ranked highest in terms of HBeAg inhibition rate, demonstrating the sensitivity of this target. The sequences B1575-DV29P, B1575-DV26P, B1575-DV27P, and B1575-DV32P all had inhibition rates of more than 60% on HBeAg.

[0513] The same siRNA sequence has a very large difference in activity after being modified with different modification templates. For example, the basic sequence B1556 modified with the disclosed modification template DV27P can significantly increase the inhibition rate of HBsAg by 48.63% compared with the modified sequence modified with the disclosed modification template DV28P.

[0514] Although the basic sequences are similar, the sensitivity to each modification template is different. For example, the basic sequence B1572 is modified with the modification template DV27P designed by the present disclosure, and the inhibition rate of HBsAg and HBeAg is the highest, while the basic sequences A1573 and B1575 are modified with the template DV29P, and the inhibition rate of HBsAg and HBeAg is the highest. Therefore, it is uncertain which modification template is used to modify the siRNA sequence to have high activity.

[0515] The IC50 test and cytotoxicity results of each sequence are shown in Table 42. The experimental results show that the IC50 values ​​of the 11 sequences subjected to the IC50 test for HBsAg range from 0.05 nM to 0.15 nM, which are all less than 0.3362 nM of the Yangshen sequence, proving that the inhibitory effects are better than Yangshen, such as the IC50 values ​​of B1572-DV27P, B1550-DV27P, and B207S-DV32P for HBsAg are 0.0538 nM, 0.0570 nM, and 0.0572 nM, respectively. Except for the sequence B261-DV26P, the IC50 values ​​of the other 10 sequences for HBeAg ranged from 0.2nM to 0.85nM, which were all lower than the 1.89nM of the Yangshen sequence, proving that the inhibitory effects were better than those of Yangshen. For example, the IC50 values ​​of sequences B1550-DV27P, B1572-DV27P, and B1575-DV26P for HBeAg were 0.2073nM, 0.2143nM, and 0.2923nM, respectively. The cytotoxicity results showed that the cell viability of these 11 sequences was greater than 90% at the highest tested concentration of 10nM, and no obvious cytotoxicity was shown, indicating that the sequences have a wide concentration selection range.

[0516] Based on the above results, 10 sequences B207S-DV29P, B207S-DV32P, B1575-DV29P, B1575-DV26P, B1575-DV27P, B1572-DV27P, B1573-DV29P, B1550-DV27P, B416-DV27P and B418S-DV34P can be used as candidate sequences.

[0517] (i) Inhibitory effects of each basic sequence on HBsAg and HBeAg after template modification

[0518] (1) Base sequence A1550

[0519] Table 12 HBsAg inhibition rate of basic sequence A1550 after template modification

[0520]

[0521] Table 13 HBeAg inhibition rate of basic sequence A1550 after template modification

[0522]

[0523] After the basic sequence A1550 was modified with the modification templates DV25P-29P and DV32P-34P designed in the present disclosure, the inhibition rates of HBsAg and HBeAg were improved compared with the modification templates disclosed in the prior art. For example, after modification with templates DV26P and DV27P, the inhibition rates of B1550-DV26P and B1550-DV27P on HBsAg were increased by 25.36% and 25.51%, respectively, and the inhibition rates on HBeAg were increased by 24.77% and 26.55%, respectively. The specific results are shown in Table 12 and Table 13.

[0524] (2) Base sequence B1556

[0525] Table 14 HBsAg inhibition rate of basic sequence B1556 after template modification

[0526]

[0527] Table 15 HBeAg inhibition rate of basic sequence B1556 after template modification

[0528]

[0529] After the basic sequence B1556 was modified with the modification templates DV26P-29P, DV32P, and DV34P designed by the present disclosure, compared with the modification templates disclosed in the prior art, after modification with templates DV26P and DV27P, the inhibition rates of B1556-DV26P and B1556-DV27P on HBsAg were increased by 37.46% and 47.61%, respectively, and the inhibition rates on HBeAg were increased by 25.29% and 31.73%, respectively. The specific results are shown in Tables 14 and 15.

[0530] (3) Base sequence B1560

[0531] Table 16 HBsAg inhibition rate of basic sequence B1560 after template modification

[0532]

[0533] Table 17 HBeAg inhibition rate of basic sequence B1560 after template modification

[0534]

[0535] After the basic sequence B1560 was modified with the modification templates DV26P-29P, DV32P, and DV34P designed by the present disclosure, compared with the modification templates disclosed in the prior art, after modification with templates DV26P and DV27P, the inhibition rates of B1560-DV26P and B1560-DV27P on HBsAg were increased by 35.82% and 43.60%, respectively, and the inhibition rates on HBeAg were increased by 20.84% ​​and 28.54%, respectively. The specific results are shown in Tables 16 and 17.

[0536] From this we can see that:

[0537] 1) For the basic sequences A1550, B1556, and B1560, after modification with the modified templates DV25P-29P and DV32P-34P designed in the present disclosure, the inhibitory effects on HBsAg and HBeAg were significantly better than those disclosed in the prior art. After modification with DV26P and DV27P, the inhibition rates on HBsAg and HBeAg were the highest, and significantly better than those disclosed in the prior art.

[0538] 2) The same siRNA sequence has a very large difference in activity after being modified with different modification templates. For example, the basic sequence B1556 modified with the disclosed modification template DV27P can significantly increase the inhibition rate of HBsAg by 48.63% compared with the modified sequence modified with the disclosed modification template DV28P.

[0539] 3) The activities of siRNAs with similar sequences vary greatly. For example, the inhibition rate of HBsAg by the DV29P modified sequence A1550-DV29P is 40.86% higher than that of A1556-DV29P.

[0540] (4) Base sequence B1572

[0541] Table 18 HBsAg inhibition rate of basic sequence B1572 after template modification

[0542]

[0543] Table 19 HBeAg inhibition rate of basic sequence B1572 after template modification

[0544]

[0545] After the basic sequence B1572 was modified with the modification templates DV26P-29P, DV32P, and DV34P designed by the present disclosure, compared with the modification templates disclosed in the prior art, after modification with templates DV26P and DV27P, the inhibition rates of B1572-DV26P and B1572-DV27P on HBsAg were increased by 26.84% and 27.59%, respectively, and the inhibition rates on HBeAg were increased by 32.02% and 36.74%, respectively. The specific results are shown in Tables 18 and 19.

[0546] (5) Base sequence A1573

[0547] Table 20 HBsAg inhibition rate of basic sequence A1573 after template modification

[0548]

[0549] Table 21 HBeAg inhibition rate of basic sequence A1573 after template modification

[0550]

[0551] After the basic sequence A1573 was modified with the modification templates DV26P-29P, DV32P, and DV34P designed in the present disclosure, the inhibition rates of HBsAg and HBeAg were significantly improved compared with the modification templates disclosed in the prior art. For example, after modification with the template DV29P, the inhibition rates of A1573-DV29P on HBsAg and HBeAg were increased by 16.08% and 32.68%, respectively. The specific results are shown in Tables 20 and 21.

[0552] (6) Base sequence B1575

[0553] Table 22 HBsAg inhibition rate of basic sequence B1575 after template modification

[0554]

[0555] Table 23 HBeAg inhibition rate of basic sequence B1575 after template modification

[0556]

[0557] The basic sequence B1575 was modified with the modification templates DV26P-29P, DV32P, and DV34P designed by the present disclosure. Compared with the modification templates disclosed in the prior art, the inhibition rates of HBsAg and HBeAg were significantly improved. For example, after modification with the template DV29P, the inhibition rates of B1575-DV29P on HBsAg and HBeAg were increased by 31.19% and 46.17%, respectively. The specific results are shown in Table 22 and Table 23.

[0558] From this we can see that:

[0559] 1) For the basic sequences B1572, A1573, and B1575, after modification with the modified templates DV26P-29P, DV32P, and DV34P designed by the present disclosure, the inhibitory effects on HBsAg and HBeAg are significantly better than the modified templates disclosed in the prior art. For the basic sequence B1572, after modification with the modified templates DV26P and DV27P disclosed by the present disclosure, the inhibition rate of HBsAg and HBeAg is the highest, and it is significantly better than the modified templates disclosed in the prior art. For the basic sequences A1573 and B1575, after modification with the modified template DV29P disclosed by the present disclosure, the inhibition rate of HBsAg and HBeAg is the highest, and it is significantly better than the modified templates disclosed in the prior art.

[0560] 2) The same siRNA sequence has a very large difference in activity after being modified with different modification templates. For example, the basic sequence B1575 modified with the disclosed modification template DV29P has a significant increase in the inhibition rate of HBsAg by 29.99% compared with the modified sequence modified with the disclosed modification template DV28P.

[0561] 3) siRNAs with similar sequences have different sensitivities to different modification templates. For example, the basic sequence B1572 modified with the modification template DV27P designed in the present invention has the highest inhibition rate against HBsAg and HBeAg, while the basic sequences A1573 and B1575 modified with the template DV29P have the highest inhibition rate against HBsAg and HBeAg.

[0562] (7) Basic sequence B205

[0563] Table 24 HBsAg inhibition rate of basic sequence B205 after template modification

[0564]

[0565] Table 25 HBeAg inhibition rate of basic sequence B205 after template modification

[0566]

[0567] The basic sequence B205 was modified with the modification templates DV26P-29P, DV32P, and DV34P designed by the present disclosure. Compared with the modification templates disclosed in the prior art, the inhibition rates of HBsAg and HBeAg were significantly improved. For example, after modification with the template DV28P, the inhibition rates of B205-DV28P on HBsAg and HBeAg were increased by 36.55% and 25.36%, respectively. The specific results are shown in Table 24 and Table 25.

[0568] (8) Base sequence B207S

[0569] Table 26 HBsAg inhibition rate of basic sequence B207S after template modification

[0570]

[0571] Table 27 HBeAg inhibition rate of basic sequence B207S after template modification

[0572]

[0573] The basic sequence B207S was modified with the modification templates DV25P-29P and DV32P-34P designed by the present disclosure. Compared with the modification templates disclosed in the prior art, the inhibition rates of HBsAg and HBeAg were significantly improved. For example, after modification with templates DV29P and DV32P, the inhibition rates of B207S-DV29P on HBsAg and HBeAg were increased by 35.37% and 26.71%, respectively, and the inhibition rates of B207S-DV32P on HBsAg and HBeAg were increased by 34.98% and 18.95%, respectively. The specific results are shown in Tables 26 and 27.

[0574] (9) Basic sequence B208

[0575] Table 28 HBsAg inhibition rate of basic sequence B208 after template modification

[0576]

[0577] Table 29 HBeAg inhibition rate of basic sequence B208 after template modification

[0578]

[0579] The basic sequence B208 was modified with the modification templates DV26P-29P, DV32P, and DV34P designed in the present disclosure. Compared with the modification templates disclosed in the prior art, after modification with template DV26P, the inhibition rate of B208-DV26P on HBsAg and HBeAg was most significantly improved, increasing by 37.63% and 19.38% respectively. The specific results are shown in Tables 28 and 29.

[0580] From this we can see that:

[0581] 1) For the basic sequences B205, B207S, and B208, after modification with the modified templates DV25P-29P and DV32P-34P designed in the present invention, the inhibitory effects on HBsAg and HBeAg were significantly better than the modified templates disclosed in the prior art. For the basic sequence B205, after modification with the modified template DV28P designed in the present invention, the sequence had the highest inhibition rate on HBsAg and HBeAg, and was significantly better than the modified templates disclosed in the prior art. For the basic sequence B207S, after modification with the modified template DV29P designed in the present invention, the sequence had the highest inhibition rate on HBsAg and HBeAg, and was significantly better than the modified templates disclosed in the prior art. For the basic sequence B208, after modification with the modified template DV26P designed in the present invention, the sequence had the highest inhibition rate on HBsAg and HBeAg, and was significantly better than the modified templates disclosed in the prior art.

[0582] 2) The same siRNA sequence has a very large difference in activity after being modified with different modification templates. For example, the basic sequence B208 modified with the disclosed modification template DV26P has a significant increase in the inhibition rate of HBsAg by 21.96% compared with the modified sequence modified with the disclosed modification template DV29P.

[0583] 3) The activities of siRNAs with similar sequences vary greatly. For example, the DV29P modified sequence B207S-DV29P has a 45.84% higher inhibition rate against HBsAg than B208-DV29P and a 23.77% higher inhibition rate than B205-DV29P.

[0584] 4) It can be seen that although the basic sequences are similar, the sensitivity to each modification template is different. For example, the basic sequence B205 is modified with the modification template DV28P designed by the present invention, and the inhibition rate of HBsAg and HBeAg is the highest, which are 78.48% and 35.95% respectively; and the basic sequence B207S is modified with the template DV29P, and the inhibition rate of HBsAg and HBeAg is the highest, which are 92.11% and 55.18% respectively; the basic sequence B208 is modified with the template DV26P, and the inhibition rate of HBsAg and HBeAg is the highest, which are 68.23% and 41.45% respectively.

[0585] (10) Base sequence A261

[0586] Table 30 HBsAg inhibition rate of basic sequence A261 after template modification

[0587]

[0588] Table 31 HBeAg inhibition rate of basic sequence A261 after template modification

[0589]

[0590] The basic sequence A261 was modified with the modification templates DV26P-29P, DV32P, and DV34P designed in the present disclosure. Compared with the modification templates disclosed in the prior art, the inhibition rates of HBsAg and HBeAg were significantly improved. For example, after modification with the template DV26P, the inhibition rates of B261-DV26P on HBsAg and HBeAg were increased by 16.82% and 11.89%, respectively. The specific results are shown in Tables 30 and 31.

[0591] (11) Base sequence B262

[0592] Table 32 HBsAg inhibition rate of basic sequence B262 after template modification

[0593]

[0594] Table 33 HBeAg inhibition rate of basic sequence B262 after template modification

[0595]

[0596] The basic sequence B262 was modified with the modification templates DV26P-29P, DV32P, and DV34P designed in the present disclosure. Compared with the modification templates disclosed in the prior art, the inhibition rates of HBsAg and HBeAg were significantly improved. For example, after modification with the template DV26P, the inhibition rates of B261-DV26P on HBsAg and HBeAg were increased by 28.99% and 17.93% at most. The specific results are shown in Tables 32 and 33.

[0597] (12) Base sequence B264

[0598] Table 34 HBsAg inhibition rate of basic sequence B264 after template modification

[0599]

[0600] Table 35 HBeAg inhibition rate of basic sequence B264 after template modification

[0601]

[0602] The basic sequence B264 was modified with the modification templates DV26P-29P, DV32P, and DV34P designed by the present disclosure. Compared with the modification templates disclosed in the prior art, the inhibition rates of HBsAg and HBeAg were significantly improved. For example, after modification with the template DV29P, the inhibition rates of B264-DV29P on HBsAg and HBeAg were increased by 35.22% and 13.12%, respectively. The specific results are shown in Tables 34 and 35.

[0603] From this we can see that:

[0604] 1) For the basic sequences A261, B262, and B264, after modification with the modified templates DV26P-29P, DV32P, and DV34P designed by the present disclosure, the inhibitory effects on HBsAg and HBeAg are significantly better than the modified templates disclosed in the prior art. For the basic sequence A261, after modification with the modified template DV26P designed by the present disclosure, the sequence has the highest inhibition rate on HBsAg, and after modification with the DV27P template, the sequence has the highest inhibition rate on HBeAg, and is significantly better than the modified templates disclosed in the prior art. For the basic sequence B262, after modification with the modified template DV28P designed by the present disclosure, the sequence has the highest inhibition rate on HBsAg and HBeAg, and is significantly better than the modified templates disclosed in the prior art. For the basic sequence B264, after modification with the modified template DV29P designed by the present disclosure, the sequence has the highest inhibition rate on HBsAg and HBeAg, and is significantly better than the modified templates disclosed in the prior art.

[0605] 2) The same siRNA sequence has a very large difference in activity after being modified with different modification templates. For example, the base sequence B264 was modified with the disclosed modification template DV27P, and compared with the DV29P template modification, the inhibition rate of HBsAg was significantly reduced by 20.16%.

[0606] 3) The activities of siRNAs with similar sequences vary greatly. For example, the DV29P modified sequence A261-DV29P has a 40.21% higher inhibition rate against HBsAg than B262-DV29P and a 30.46% higher inhibition rate than B264-DV29P.

[0607] 4) It can be seen that although the basic sequences are similar, the sensitivity to each modification template is different. For example, the basic sequence B262 is modified with the modification template DV28P designed by the present invention, and the inhibition rate of HBsAg and HBeAg is the highest, while the basic sequence B264 is modified with the template DV29P, and the inhibition rate of HBsAg and HBeAg is the highest.

[0608] (13) Base sequence A416

[0609] Table 36 HBsAg inhibition rate of basic sequence A416 after template modification

[0610]

[0611] Table 37 HBeAg inhibition rate of basic sequence A416 after template modification

[0612]

[0613] The basic sequence A416 was modified with the modification templates DV26P-29P, DV32P, and DV34P designed in the present disclosure. Compared with the modification templates disclosed in the prior art, the inhibition rates of HBsAg and HBeAg were significantly improved. For example, the inhibition rates of HBsAg and HBeAg were increased by 29.19% and 33.83% respectively by using DV27P modification. The specific results are shown in Tables 36 and 37.

[0614] (14) Base sequence B416S

[0615] Table 38 HBsAg inhibition rate after template modification of basic sequence B416S

[0616]

[0617] Table 39 HBeAg inhibition rate after template modification of basic sequence B416S

[0618]

[0619] After the basic sequence B416S was modified with the modification templates DV26P-29P, DV32P, and DV34P designed in the present disclosure, the inhibition rates of HBsAg and HBeAg were lower than 25% compared with the modification templates disclosed in the prior art. The specific results are shown in Tables 38 and 39.

[0620] (15) Base sequence B418S

[0621] Table 40 HBsAg inhibition rate after template modification of basic sequence B418S

[0622]

[0623] Table 41 HBeAg inhibition rate after template modification of basic sequence B418S

[0624]

[0625] The basic sequence B418S was modified with the modification templates DV26P-29P, DV32P, and DV34P designed in the present disclosure. Compared with the modification templates disclosed in the prior art, the inhibition rates of HBsAg and HBeAg were significantly improved. For example, the inhibition rates of HBsAg and HBeAg were increased by 25.62% and 26.91% respectively after modification with the DV34P template. The specific results are shown in Tables 40 and 41.

[0626] From this we can see that:

[0627] 1) For the basic sequences A416 and B418S, after modification with the modification templates DV26P-29P, DV32P, and DV34P designed by the present disclosure, the inhibitory effects on HBsAg and HBeAg are significantly better than the modification templates disclosed in the prior art. For the basic sequence A416, after modification with the modification template DV27P designed by the present disclosure, the sequence has the highest inhibition rate on HBsAg and HBeAg. For the basic sequence B418S, after modification with DV34P, the sequence has the highest inhibition rate on HBsAg and HBeAg. For the basic sequence B416S, the inhibition rates of the sequences on HBsAg and HBeAg are low, less than 25%, using the modification templates DV26P-28P, DV32P, DV34P designed by the present disclosure and the modification templates disclosed in the prior art.

[0628] 2) The same siRNA sequence has a very large difference in activity after being modified with different modification templates. For example, the base sequence A416 is modified with the disclosed modification template DV27P, and the inhibition rate of HBsAg is increased by 16.79% compared with the modification with the DV32P template.

[0629] 3) The activities of siRNAs with similar sequences vary greatly. For example, the inhibition rate of HBsAg by the DV29P modified sequence A416-DV29P was 72.41% higher than that of B416S-DV29P.

[0630] 4) It can be seen that although the basic sequences are similar, the sensitivity to each modification template is different. For example, the basic sequence A416 is modified with the modification template DV27P designed by the present invention, and the inhibition rate of HBsAg and HBeAg is the highest, while the basic sequence B418S is modified with the template DV34P, and the inhibition rate of HBsAg and HBeAg is the highest.

[0631] (ii) IC50 experiment and cytotoxicity results

[0632] The dominant sequences in the single-concentration screening experiment were selected, including B207S-DV29P, B207S-DV32P, B1575-DV29P, B1575-DV26P, B1575-DV27P, B1572-DV27P, B1573-DV29P, B1550-DV27P, B261-DV26P, B416-DV27P and B418S-DV34P, and 1 Yangshen APC-VIR, a total of 12 sequences, and IC50 experiments were carried out to determine the IC50 concentration of each sequence.

[0633] Table 42 IC50 experimental results of each modified sequence

[0634]

[0635] The results of IC50 experiments showed that the IC50 values ​​of these 11 sequences for HBsAg were between 0.05 nM and 0.15 nM, which were all lower than 0.3362 nM of the Yangshen sequence, proving that the inhibitory effects were better than those of Yangshen. For example, the IC50 values ​​of sequences B1572-DV27P, B1550-DV27P, and B207S-DV32P for HBsAg were 0.0538 nM, 0.0570 nM, and 0.0572 nM, respectively, indicating that these sequences can effectively inhibit HBsAg expression at low concentrations. Except for the sequence B261-DV26P, the IC50 values ​​of the other 10 sequences for HBeAg ranged from 0.2 nM to 0.85 nM, which were all lower than the 1.89 nM of the Yangshen sequence, proving that the inhibitory effects were better than those of Yangshen. For example, the IC50 values ​​of sequences B1550-DV27P, B1572-DV27P, and B1575-DV26P for HBeAg were 0.2073 nM, 0.2143 nM, and 0.2923 nM, respectively, indicating that these sequences can effectively inhibit HBeAg expression at low concentrations. The experimental results are shown in Table 42.

[0636] The cytotoxicity results showed that the cell viability of these 11 sequences was greater than 90% at the highest tested concentration of 10 nM, and no obvious cytotoxicity was shown, indicating that the sequences have a wide concentration selection range. The specific results are shown in Table 42.

[0637] Example 5: Comparison of the inhibitory effect of the sequences disclosed in the prior art on the HBV gene

[0638] In this example, the inhibition efficiency of the HBV gene is compared between the unmodified sequences disclosed in the prior art that are identical or similar to the basic sequences B207S, B1575, B1550, B1572, A416, B1573, and B418S disclosed in the present invention, the sequences modified with the existing modified templates DV30P, DV31P, DV21P, and DV22P, and the sequences modified with the modified templates DV25P, DV26P, DV27P, DV28P, DV29P, DV32P, DV33P, and DV34P disclosed in the present invention.

[0639] 1. Experimental Materials

[0640] Test samples:

[0641] (1) The prior art disclosed sequence is shown in Table 43.

[0642] Table 43 Prior art disclosed sequences

[0643]

[0644] Note: The sequences disclosed in the above patent applications are all unmodified sequence RNA.

[0645] (2) In Example 4, the modified templates DV25P, DV26P, DV27P, DV28P, DV29P, DV32P, DV33P, DV34P, DV30P, DV31P, DV21P, and DV22P modified siRNA sequences and the corresponding unmodified basic sequences were used.

[0646] Cell type: HepG2.2.15 cells

[0647] Drug solvent: sterile enzyme-free water, Gibco Opti-MEM

[0648] 2. Experimental methods

[0649] Referring to Example 2, the concentration of the single concentration screening experiment was set to 0.3 nM.

[0650] 3. Experimental results

[0651] The experimental results show that the inhibition rates of the unmodified basic sequences B207S, A1550, B1572, B1575, A1573, B418S, and A416 disclosed in the present invention on HBsAg and HBeAg are significantly better than those of P206, P413, P1551, and APC with similar sequences. After template modification, the inhibition rates are further significantly improved.

[0652] Table 44 and Table 45 respectively show the comparison of the inhibition rates of HBsAg and HBeAg between sequences disclosed in the prior art and sequences relatively close to those disclosed in the present invention.

[0653] It can be seen from Table 43 that compared with the sequence P206 disclosed in the prior art, the sequence B207S disclosed in the present invention has moved backward by 1 base and its length has been reduced by 1 base. Compared with P206, the inhibition rates of B207S on HBsAg and HBeAg are increased by 15.57% and 11.69%, respectively. After B207S is modified with the template disclosed in the present invention, the inhibition efficiency is further improved. For example, after modification with DV32P, the inhibition rates of B207S-DV32P on HBsAg and HBeAg are increased by 28.92% and 20.55%, respectively. At the same time, it is significantly better than the modified templates DV30P, DV31P, DV21P and DV22P disclosed in the prior art.

[0654] Compared with the sequence P413 disclosed in the prior art, the sequence A416 disclosed in the present invention has moved backward by 3 bases. Compared with P413, the inhibition rates of A416 on HBsAg and HBeAg are increased by 5.95% and 7.42%, respectively. After A416 is modified with the template disclosed in the present invention, the inhibition efficiency is further improved. For example, after modification with DV27P, the inhibition rates of B416-DV27P on HBsAg and HBeAg are increased by 24.16% and 21.26%, respectively. At the same time, it is significantly better than the modified templates DV30P, DV31P, DV21P, and DV22P disclosed in the prior art.

[0655] Compared with the sequence P1551 disclosed in the prior art, the sequence A1550 disclosed in the present invention has moved forward by 1 base. Compared with P1551, the inhibition rates of A1550 on HBsAg and HBeAg are increased by 7.98% and 9.03%, respectively. After A1550 is modified with the template disclosed in the present invention, the inhibition efficiency is further improved. For example, after modification with DV27P, the inhibition rates of B1550-DV27P on HBsAg and HBeAg are increased by 23.96% and 26.06%, respectively. At the same time, it is significantly better than the modified templates DV30P, DV31P, DV21P, and DV22P disclosed in the prior art.

[0656] Compared with the sequence APC disclosed in the prior art, the sequences B1575, B1573, and B1572 disclosed in the present invention moved forward by 4, 6, and 7 bases, respectively, and the lengths were extended by 2 bases. Compared with APC, the inhibition rates of B1575, B1573, and B1572 on HBsAg were increased by 13.46%, 10.80%, and 9.94%, respectively. After modification with the template disclosed in the present invention, the inhibition efficiency was further improved. For example, the sequence B1575-DV29P had the most significant improvement effect, increasing by 29.28%, and the inhibition rate of HBeAg was increased by 24.25%. The inhibition rate of sequence B1575-DV26P on HBsAg was increased by 27.18%, and the inhibition rate on HBeAg was increased by 16.55%. At the same time, it was significantly better than the modified templates DV30P, DV31P, DV21P, and DV22P disclosed in the prior art.

[0657] Table 44 Comparison of HBsAg inhibition rates between prior art and the disclosed sequences

[0658]

[0659]

[0660] Table 45 Comparison of HBeAg inhibition rates of the prior art and the disclosed sequences

[0661]

[0662]

[0663] Example 6: Inhibitory effect of sequences designed to prevent off-target genes on HBV and off-target genes

[0664] In the actual application of siRNA, there are a lot of cases where the expression of non-target mRNAs that are only partially complementary to the guide strand (antisense strand) is inhibited. Research by Alnylam has shown that the hepatotoxicity of n-acetylgalactosamine (GalNAc)-coupled siRNA is mainly attributed to the off-target effect caused by gene inhibition of the wrong target through a recognition mechanism similar to microRNA (miRNA).

[0665] To solve this problem, heat-labile nucleotide modifications such as glycol nucleic acid (GNA), unlocking nucleotide (UNA), DNA, etc. can be performed at positions 6 and 7 of the antisense strand seed region to disrupt the antisense strand seed region, thereby affecting the binding of siRNA to non-target mRNA through seed region recognition, thereby significantly reducing off-target effects and alleviating hepatocellular toxicity. In the latest fifth-generation template design, Alnylam has adopted a method of placing a GNA modification at position 7 of the siRNA antisense strand to reduce the off-target effect of siRNA.

[0666] In this example, the basic sequences B207S, B1575, A1550, B1572, A1573, A261, A416, and B418S were used to study off-target and off-target prevention. In order to evaluate the off-target situation of each sequence, this example compared the inhibition efficiency of each sequence on the target gene and off-target gene in the cell experiment by qPCR.

[0667] In order to reduce the off-target effect of the sequence, in this example, the sequences B418S-DV34P and B416-DV27P with potential off-target effects were modified with DNA or GNA at positions 6 and 7 of the antisense strand, and the activity and off-target effect were compared with those of the sequences that were not modified with anti-off-target.

[0668] 1. Experimental Materials

[0669] Test samples: template modified sequences listed in Table 46 and corresponding sequences designed with anti-off-target (synthesis method refers to Example 1). In the sequence number, d67B indicates that the sequence is modified with d67B to prevent off-target, d7B indicates that the sequence is modified with d7B to prevent off-target, and + indicates that the sequence is modified with GNA to prevent off-target.

[0670] Cell type: HepG2.2.15 cells

[0671] Drug solvent: sterile enzyme-free water, Gibco Opti-MEM.

[0672] Table 46 Template modification and anti-off-target design sequence

[0673]

[0674] 2. Experimental methods

[0675] The qRT-PCR method was used to detect the inhibition of samples on HBV and off-target genes in HepG2.2.15 cells.

[0676] 2.1 Cell culture

[0677] Subculture: HepG2.2.15 cells were subcultured in DMEM / F12 medium containing 10% fetal bovine serum, 370 μg / ml GENETICN, 1% L-glutamine, 1% non-essential amino acids, and 1% penicillin-streptomycin, and placed in a cell culture incubator at 37°C with 5% CO2, and subcultured every three days. Digested and subcultured with 0.25% trypsin, centrifuged at 800 r / min for 3 min, discarded the supernatant, and added fresh medium for subculture.

[0678] Plating culture: HepG2.2.15 cells were plated and cultured in DMEM / F12 medium containing 10% fetal bovine serum, 1% L-glutamine, 1% non-essential amino acids, and 1% penicillin-streptomycin.

[0679] 2.2 Cell transfection

[0680] Preparation of transfection reagent: Mix Lipofectamine RNAiMAX and Opti-MEM in a ratio of 2:98 and vortex to mix.

[0681] Preparation of transfection complex: Add 30 μL of siRNA solution diluted in Opti-MEM to 30 μL of transfection mixture at a ratio of 1:1 (v / v), vortex to mix, and let stand at room temperature for 15 min to obtain transfection complex.

[0682] Transfection control group transfection reagent preparation: Add 15 μL of the prepared transfection mixture to 15 μL of Opti-MEM. Vortex to mix well and let stand at room temperature for 15 min.

[0683] The prepared transfection complex was added to a 96-well cell culture plate (15 μL per well, 3 replicates per sequence), so that the final siRNA concentrations in each well were 0.065, 0.14, and 0.28 nM, respectively. Three concentrations of each siRNA were set, and 3 replicates were set for each concentration. 135 μL of cell suspension (containing 2.25×10 4 cells). After mixing using the cross method, the cells were placed in a cell culture incubator at 37°C and 5% CO2.

[0684] 2.3 RNA extraction and reverse transcription

[0685] 48 h after transfection, the culture medium was removed and the cells were collected for RNA extraction. Total RNA was extracted using the RNeasy® 96 Kit (QIAGEN-74182) according to the kit instructions. RNA was then reverse transcribed into cDNA using HiScript Ⅲ RT SuperMixfor qPCR (Vazyme) according to the instructions.

[0686] 2.4 RT-qPCR

[0687] HBV and off-target gene cDNA were detected by qPCR, and GAPDH cDNA was detected in parallel as an internal control. 8 μL of the prepared qPCR reaction solution and 2 μL of sample cDNA were added to 384 wells. The SYBR qPCR reaction program was: heating at 50 °C for 2 min, heating at 95 °C for 2 min, then entering the cycle mode, heating at 95 °C for 5 s, then 60 °C for 30 s, for a total of 40 cycles; finally, the melting curve was heated at 95 °C for 15 s, 60 °C for 1 min, and 95 °C for 15 s.

[0688] 2.5 Data Analysis

[0689] The target gene RNA expression level in each sample was calculated based on the CT value of each sample using the ΔΔCT relative quantitative method. The relative expression of the target gene was calculated using 2 -ΔΔCT express.

[0690] The calculation formula is as follows:

[0691] ΔCT = average CT value of target gene - average CT value of GAPDH;

[0692] ΔΔCT = ΔCT (experimental group) - ΔCT (transfection control group);

[0693] Relative expression of target gene mRNA = 2 -ΔΔCT

[0694] Gene expression inhibition rate (%) = (1 – sample mRNA expression / transfection control group mRNA expression) × 100%

[0695] 3. Experimental results

[0696] The experimental results show that sequences B207S, B1575, A1550, B1572, A1573, and A261 have no off-target effects. After the anti-off-target design was adopted for sequences B418S-DV34P and A416-DV27P, the inhibitory effect on off-target genes was significantly reduced, without affecting the inhibitory effect of the target gene HBV. This shows that the anti-off-target design will not affect the inhibitory effect of the template modification sequence disclosed in the present invention on the HBV gene, but can significantly inhibit the off-target effect.

[0697] (i) qPCR analysis of potential off-target effects and anti-off-target effects of each sequence

[0698] (1) The inhibition efficiency of each sequence on the target gene and off-target gene is shown in Table 47. The results show that the inhibition of the gene SLCO2B1 by sequence A416 is obviously concentration-dependent, with a maximum inhibition rate of 40.05%. The inhibition of the gene SLC41A2 by sequence B418S is somewhat concentration-dependent, with a maximum inhibition rate of 24.13%. The inhibition rates of the remaining sequences B207S, A1550, and A416 on off-target genes are all lower than 20%, indicating that there is no off-target effect. The two sequences A416 and BS18S also have a large number of potential off-target genes as a whole, so sequences A416 and BS18S have potential off-target effects.

[0699] Table 47 Inhibitory effect of each sequence on off-target genes and target genes

[0700]

[0701] (2) Anti-off-target d7B and d67B were designed for sequences A416 and BS18S. The inhibitory effects of the anti-off-target designed sequences and the sequences without anti-off-target design on off-target genes and target genes are shown in Table 48. The results showed that after modification with the anti-off-target modification d7B, the IC50 of the sequence C416-DV27Pd7B on the off-target gene SLCO2B1 increased by 5.69 times, and the maximum inhibition rate decreased by 9.54%. The maximum inhibition rate of the sequence C418S-DV34Pd7B on the off-target gene SLC41A2 decreased by 16.91%, which was significantly better than the anti-off-target modification d67B and GNA modification. At the same time, the IC50 of sequence C418S-DV34Pd7B against the target gene HBV is 0.22 nM, which is close to the sequence B418S-DV34P without anti-off-target modification. The maximum inhibition rate of the target gene is about 81%, indicating that the inhibition of the target gene by sequence C418S-DV34Pd7B is not affected after modification by d7B.

[0702] Table 48 Inhibitory effect of anti-off-target modification sequence on off-target genes and target genes

[0703]

[0704] Example 7: Inhibitory effect of sequences modified with the disclosed modified template (high dose) on HBV in mice

[0705] In this example, some sequences are selected, including basic sequences B418S, A416, B1550, B207S, B1575, B1572, and A1573, and these sequences are modified, such as using only template modification, using template modification and anti-off-target design at the same time, and all are coupled to GalNAc ligands. The AAV-HBV mouse model is used to analyze the in vivo efficacy of these RNAi agents after repeated administration at high doses, such as 3 mg / kg. After infection with a recombinant adeno-associated virus (AAV) with a replicable HBV genome, this mouse model can continuously produce HBV virus particles and HBV antigens and has no serum conversion for more than 1 year, reproducing some of the immunological characteristics of clinical chronic hepatitis B patients. Therefore, this model is also used to evaluate new immune-based therapies and antiviral treatments. In this example, the AAV-HBV mouse model is used to detect the inhibitory effects of the above sequences on HBsAg, HBeAg, and HBV DNA in serum at different time points, as well as the effects of each sequence on the reconstruction of adaptive immune function in mice at specific time points.

[0706] 1. Experimental Materials

[0707] Tested drugs:

[0708] Each sequence in Table 49, including sequences using only template modification, sequences using template modification and anti-off-target design, the 3' end of the sense chain of these sequences is coupled to the GalNAc ligand G5, and the structural formula is as follows:

[0709]

[0710] The coupling method of oligonucleotide and ligand G5 refers to the preparation method in Example 3 of patent application CN116854754A.

[0711] The oligonucleotide forms a conjugate with ligand G5 as shown below:

[0712]

[0713] The specific sequences of each sequence are shown in Table 49. In the sequence number, G5 indicates that the sequence is coupled with the GalNAc ligand G5, and GL indicates that the sequence is coupled with the GalNAc ligand L96.

[0714] The structural formula of L96 is as follows:

[0715]

[0716] Table 49 siRNA sequences in animal experiments

[0717]

[0718]

[0719] Preparation of test drug:

[0720] Drug solvent: PBS buffer

[0721] Preparation conditions: Sterile environment

[0722] Labeling method: The prepared drug preparations are labeled with labels, and the outer packaging is marked with the topic number, name, concentration, quantity, preparation date, preparer, and storage conditions;

[0723] Storage conditions: Prepare immediately before use and store remaining samples at -80℃.

[0724] Experimental Animal Information:

[0725] Species / strain: AAV-HBV mice

[0726] Rating: SPF

[0727] Gender: Male

[0728] Quantity: 100

[0729] Age: 7 weeks

[0730] Weight: 19-24 g

[0731] Source: Guangdong Zhiyuan Biopharmaceutical Technology Co., Ltd.

[0732] Production license number: SCXK (Guangdong) 2021-0057

[0733] Experimental Animal Ethics Review (IACUC):

[0734] The experimental animals were received and kept in Guangzhou Jinio Biotechnology Co., Ltd., with the use license number: JENNIO (Jinbin) 2019-0002. This project has been reviewed by the Experimental Animal Ethics Committee of Guangzhou Jinio Biotechnology Co., Ltd., with the IACUC number JENNIO-IACUC-2024-A005. The experimental process was carried out in strict accordance with IACUC requirements to ensure animal welfare.

[0735] Feeding and management:

[0736] Feeding conditions: The experimental animals were received and raised by Guangzhou Jinio Biotechnology Co., Ltd. They were raised in a feeding cage with the specifications of length × width × height = 29.0 cm × 18.5 cm × 13.0 cm; the set temperature range was 20-26℃, the set humidity range was 40% ~ 70%, and the lighting was automatic, with 12-hour light and dark alternation.

[0737] The standard of breeding environment conditions refers to the National Standard of the People's Republic of China GB14925-2010.

[0738] Animals were allowed to eat and drink freely. The feed was irradiated sterilized experimental mouse maintenance feed, provided by Jiangsu Collaborative Pharmaceutical Bioengineering Co., Ltd., with a production license number of Su Feed Certificate (2019) 01008. The feed nutrient content test was in accordance with the National Standard of the People's Republic of China GB14924.3-2010, and the pollutant content test was in accordance with the National Standard of the People's Republic of China GB14924.2-2001. The feed supplier provided a test report for each batch. The drinking water was reverse osmosis water, which was stored in drinking water bottles. The drinking water test was in accordance with the National Standard of the People's Republic of China GB5750-2006, and was sent to a third-party testing agency for testing once a year.

[0739] The animal bedding is corn cob bedding, provided by Guangzhou Saibino Biotechnology Co., Ltd. The animal bedding production license number is SCXK (Beijing) 2019-0004. The bedding pollutant content test refers to the National Standard of the People’s Republic of China GB14924.2-2001, and the bedding supplier provides a test report for each batch.

[0740] Animal cages and bedding should be replaced at least once a week. All animal cages and bedding should be sterilized under high pressure in a pulsating vacuum sterilizer before being used in a barrier environment. Animal cages should be cleaned, disinfected and wiped at least once a week.

[0741] The animal breeding and observation room is cleaned and disinfected every day, including the flat racks, floors, tables, etc.

[0742] The disinfectants used in the barrier environment include: 6.67% Sanisol solution, 0.5% 84 disinfectant, 75% disinfectant, and 0.08% Baidusai. The four disinfectants should be used in turn and cannot be mixed.

[0743] 2. Experimental methods

[0744] 2.1 AAV-HBV mouse model

[0745] Definition of experimental date: The day on which the animals were administered with the vehicle or the test drug was defined as day 0.

[0746] 100 SPF-grade C57BL / 6 male mice were adaptively raised in a barrier facility for 7 days and observed daily. Modeling was performed after confirming that the mice were healthy and normal. rAAV8-1.3HBV (Guangzhou Paizhen Biotechnology Co., Ltd., name: AAV8[HBV-D,ayw](D#2012), batch number: HBV101-6) was injected into the tail vein of the mice. Each mouse was injected with 1×10 11GC / 100μL. At 5 and 6 weeks (D-14 and D-7) after modeling, blood was collected from the animals, centrifuged, and plasma was collected to detect HBV DNA, HBsAg, and HBeAg levels.

[0747] 2.2 Animal grouping and drug administration

[0748] Definition of experimental date: The day on which the animals were administered with the vehicle or the test drug was defined as day 0 (D0).

[0749] The grouping was carried out according to the index of the 6th week (D-7) of modeling. 72 animals were selected from the animals with successful modeling and randomly divided into 12 groups according to the HBsAg index, with 6 animals in each group. It was ensured that the average HBsAg value among the groups was at the same level, and there was no statistical difference in HBV DNA and HBeAg index among the groups. After grouping, the drug was administered at the 7th week (D 0) of modeling. The details of grouping and drug administration are shown in Table 50.

[0750] Table 50 Group setting and drug administration details

[0751]

[0752] Note: sc: subcutaneous injection.

[0753] 2.3 Secondary challenge experiment

[0754] At D 60 of drug administration, 3 mice in the C207S-DV32PG5 group were injected with 8 μg pAAV-HBV1.2 plasmid (Fenghui Biotechnology) through the tail vein hydrodynamic injection, with an injection volume of 100 μL / g for virus challenge, and the remaining 3 mice were not treated. Another 3 blank group mice were also challenged with virus as a control.

[0755] 2.4 Observation and indicator monitoring

[0756] (1) General observation

[0757] During the modeling and experimental periods, the animals were observed and recorded daily. The observation contents included: whether they were dead or dying, feed and water intake, trauma, feces, appearance and coat, mental state, activity status, etc.

[0758] (2) Weight

[0759] Acclimation period: The animals were weighed and recorded upon receipt, and weighed and recorded on the day the acclimation period ended.

[0760] Experimental period: During the experimental period, the animals were weighed and recorded every week. If medication or blood sampling was required on the same day, they were weighed before the operation and before being killed.

[0761] (3) Determination of serum HBsAg, HBeAg, HBV DNA, HBsAb, and ALT levels

[0762] The animals were subjected to blood sampling from the inner canthus of the orbit once a week at 5 weeks (D-14), 6 weeks (D-7), before administration (D 0), and after administration. 200 μL of blood was added to EDTA-k2 anticoagulant tubes for anticoagulation, and plasma was collected after centrifugation at 1000 g for 10 min. The mice subjected to the challenge operation were subjected to the challenge operation at D60 of administration, and 200 μL of blood was collected from the inner canthus of the orbit once at D63, D67, D74, and D81, respectively, and added to EDTA-k2 anticoagulant tubes for anticoagulation. Plasma was collected after centrifugation at 1000 g for 10 min. 20 μL of plasma was added to 980 μL of PBS and vortexed for detection of HBsAg, HBV DNA, HBeAg, and ALT indicators; another 15 μL of plasma was added to 210 μL of PBS and vortexed for detection of HBsAb indicators. All processed samples were tested by Guangzhou Huayin Medical Testing Center Co., Ltd., and the remaining plasma was stored at -80℃.

[0763] 3. Experimental results

[0764] The experimental results showed that compared with the vehicle control group and the negative control group, the sequences B207S-DV32P, A1550-DV27P, B1572-DV27P, B1575-DV27P, B207S-DV29P, A1573-DV29P, B1575-DV29P, B418S-DV34Pd7B, and A416-DV27Pd7B could be targetedly delivered to the liver after coupling with conjugate G5, and continuously and significantly inhibited the levels of HBsAg, HBeAg, and HBV DNA in plasma.

[0765] Among them, sequences C207S-DV32PG5, C207S-DV29PG5, and C418S-DV34Pd7BG5 showed superior effects in reducing HBsAg, HBV DNA, and HBeAg, and were significantly better than the Yangshen sequence VIR-2218-GL. In addition, sequences C207S-DV32PG5 and C207S-DV29PG5 eventually achieved negative conversion of HBsAg and HBV DNA in all mice in the group, and both produced high levels of antibodies. In the end, 3 / 6 mice in the sequence C418S-DV34Pd7BG5 group achieved negative conversion of HBsAg, and also produced high levels of antibodies.

[0766] The results of the secondary challenge experiment showed that HBsAg, HBeAg and HBV DNA appeared in the blank group (not infected with HBV virus before D56) after the challenge, indicating that the challenge method was effective. After the challenge, the HBVDNA of mice in the C207S-DV32PG5 group first increased and then decreased to the lower limit of detection. At the same time, the serum HBsA antibody increased significantly, and HBsAg remained below the detection limit, proving that the challenge was effective, and the hepatitis B mice treated with the small nucleic acid sequence were protected from the re-attack of HBV virus. It was proved that the hepatitis B mice treated with the small nucleic acid sequence were protected from the re-attack of HBV virus.

[0767] (i) Changes of HBsAg, HBeAg, HBV DNA, HBsAb, and ALT levels in mice in each sequence group over time

[0768] The changes in HBsAg, HBeAg, HBV DNA, HBsAb, ALT and body weight levels of mice in each group over time are shown in Tables 51-59 and Figure 1A-1F As can be seen from the table, sequences C207S-DV32PG5, C207S-DV29PG5, and C418S-DV34Pd7BG5 showed superior effects in reducing HBsAg, HBV DNA, and HBeAg, which were significantly better than the Yangshen sequence VIR-2218-GL. In addition, sequences C207S-DV32PG5 and C207S-DV29PG5 eventually achieved negative conversion of HBsAg and HBV DNA in all mice in the group, and both produced high levels of antibodies. Among them, the C207S-DV32PG5 group achieved negative conversion of HBsAg and HBV DNA in all mice in the group on the 14th and 21st days after administration, respectively, and continued until the end of the experiment. It can be considered that all mice have achieved functional cure. In the sequence C418S-DV34Pd7BG5 group, 3 / 6 mice finally achieved negative conversion of HBsAg, and also produced high levels of antibodies. The above data demonstrate the superiority of C207S-DV32PG5, C207S-DV29PG5, and C418S-DV34Pd7BG5 sequences in terms of efficacy.

[0769] Table 51 Changes in plasma HBsAg levels in mice in each sequence group

[0770]

[0771]

[0772] Note: "-" indicates that the test was stopped; " / " indicates that the C207S-DV32PG5 group was selected as the challenge test animal when the drug was administered on D56. Compared with the PBS group, * indicates P < 0.05; ** indicates P < 0.01. Compared with the positive control group VIR-2218-GL group, # Indicates P < 0.05; ## Indicates P < 0.01.

[0773] Table 52 Changes in plasma HBV DNA levels in mice in each sequence group

[0774]

[0775] Note: "-" indicates that the test was stopped; " / " indicates that the C207S-DV32PG5 group was selected as the challenge test animal when the drug was administered on D56. Compared with the PBS group, * indicates P < 0.05; ** indicates P < 0.01. Compared with the positive control group VIR-2218-GL group, # Indicates P < 0.05; ## Indicates P < 0.01.

[0776] Table 53 Changes in plasma HBeAg levels in mice in each sequence group

[0777]

[0778] Note: "-" indicates that the test was stopped; " / " indicates that the C207S-DV32PG5 group was selected as the challenge test animal when the drug was administered on D56. Compared with the PBS group, * indicates P < 0.05; ** indicates P < 0.01. Compared with the positive control group VIR-2218-GL group, # Indicates P < 0.05; ## Indicates P < 0.01.

[0779] Table 54 Changes in the number of mice with HBsAg negative in each sequence group

[0780]

[0781] Table 55 Changes in the number of mice with HBV DNA negative in each sequence group

[0782]

[0783] Table 56 Changes in the number of mice producing antibodies in each sequence group

[0784]

[0785] Table 57 Changes in plasma HBsAb levels in mice in each sequence group

[0786]

[0787] Table 58 Changes in plasma ALT levels in mice in each sequence group

[0788]

[0789] Table 59 Body weight changes of mice in each sequence group

[0790]

[0791] (ii) Protective effect of sequence CS7S-DV32PG5 against secondary challenge in mice

[0792] The mice in the CS7S-DV32PG5 group were injected with HBV plasmid via tail vein high pressure hydrodynamic injection at D60 to simulate secondary HBV infection. Figure 2A-2F The results showed that the blank group (not infected with HBV virus before D56) had HBsAg, HBeAg and HBV DNA in the body after high-pressure hydrodynamic injection of HBV plasmid, indicating that the virus attack method was effective. After the virus attack, the HBV DNA of the mice in the C207S-DV32PG5 group first increased and then decreased to the detection limit. At the same time, the serum HBsA antibody increased significantly, and HBsAg remained below the detection limit. This result proved that the virus attack was effective, and the hepatitis B mice treated with this small nucleic acid sequence were protected from the re-attack of HBV virus.

[0793] Example 8: Inhibitory effect of sequences modified with the disclosed modified template (low dose) on HBV in mice

[0794] In this example, some sequences are selected as examples, such as the sequences C207S-DV32PG5, C207S-DV29PG5, C418S-DV34Pd7BG5 and C1575-DV27PG5 in Example 7, see Table 49, and the in vivo efficacy of these RNAi agents after multiple administrations at low doses, such as 0.5 mg / kg, is analyzed using the AAV-HBV mouse model.

[0795] 1. Experimental Materials

[0796] The sequences C207S-DV32PG5, C207S-DV29PG5, C418S-DV34Pd7BG5, C1575-DV27PG5 and VIR-2218-GL in Example 7 are shown in Table 49. And entecavir (ETV).

[0797] 2. Experimental methods

[0798] Same as Example 7, the grouping and dosing details are shown in Table 60.

[0799] Table 60 Group setting and drug administration details

[0800]

[0801] Note: sc: subcutaneous injection; ig: intragastric administration.

[0802] 3. Experimental results

[0803] The changes in HBsAg, HBeAg, HBV DNA, HBsAb, and ALT levels of mice in each group over time are shown in Tables 61-68 and Figure 3A-Figure 3F The experimental results showed that the sequences C207S-DV32PG5 and C207S-DV29PG5 were significantly better than the Yangshen sequence VIR-2218-GL in inhibiting HBsAg, HBV DNA, and HBeAg. Among them, C207S-DV32PG5 had the best effect, which could reduce HBsAg by about 2.9 log10 on the 56th day, which was about 1.4 log10 higher than C207S-DV29PG5. On the 56th day, 3 mice turned negative for HBsAg, 4 mice produced antibodies, and there was no negative mouse in the C207S-DV29PG5 group. The above data once again prove the superiority of the sequence C207S-DV32PG5 in terms of efficacy.

[0804] Table 61 Changes in plasma HBsAg levels in mice in each sequence group

[0805]

[0806] Note: Compared with the PBS group, * indicates P < 0.05; ** indicates P < 0.01.

[0807] Table 62 Changes in plasma HBV DNA levels in mice in each sequence group

[0808]

[0809] Note: Compared with the PBS group, * indicates P < 0.05; ** indicates P < 0.01

[0810] Table 63 Changes in plasma HBeAg levels in mice in each sequence group

[0811]

[0812] Note: Compared with the PBS group, * indicates P < 0.05; ** indicates P < 0.01.

[0813] Table 64 Number of mice with negative HBsAg in plasma in each sequence group

[0814]

[0815] Table 65 Number of mice with negative HBV DNA in plasma in each sequence group

[0816]

[0817] Table 66 Number of mice producing HBsAb in each sequence group

[0818]

[0819] Table 67 Changes in plasma HBsAb levels in mice in each sequence group

[0820]

[0821] Table 68 Changes in plasma ALT levels in mice in each sequence group

[0822]

[0823] Example 9: Inhibitory effect of the sequence modified by the disclosed delivery ligand on HBV in mice

[0824] This example selects some sequences, including the basic sequences B418S and B207S, and modifies these sequences, such as using only template modification, using template modification and anti-off-target design at the same time, and coupling delivery of different ligands. The in vivo efficacy of these RNAi agents is analyzed using the AAV-HBV mouse model.

[0825] 1. Experimental Materials

[0826] Tested drugs:

[0827] Each sequence in Table 69, including sequences using only template modification, sequences using template modification and anti-off-target design, the 3' end of the sense strand of these sequences is coupled to the delivery ligand G5, G101 or G103, and the structural formula is as follows:

[0828] ,

[0829] , .

[0830] The coupling method of oligonucleotide and ligand G5, G101 or G103 refers to the preparation method in Example 3 of patent application CN116854754A.

[0831] The oligonucleotides formed conjugates with ligands G5, G101 or G103 as shown below:

[0832] ,

[0833] ,

[0834] 。

[0835] For each sequence, the specific sequence is shown in Table 69. In the sequence number, G5 indicates that the sequence is coupled with the delivery ligand G5, G101 indicates that the sequence is coupled with the delivery ligand G101, G103 indicates that the sequence is coupled with the delivery ligand G103, and GL indicates that the sequence is coupled with the delivery ligand L96. The structural formula of L96 is as follows:

[0836]

[0837] Table 69 siRNA sequences in animal experiments

[0838]

[0839]

[0840] Preparation of the test drug:

[0841] Same as Example 7.

[0842] Experimental animal information:

[0843] Species / strain: AAV-HBV mice

[0844] Grade: SPF

[0845] Sex: Male

[0846] Quantity: 82

[0847] Age: 5 weeks

[0848] Body weight: 19 - 24 g

[0849] Source: Beijing Vital River Laboratory Animal Technology Co., Ltd.

[0850] Production license number: SCXK(Beijing)2021 - 0006

[0851] Experimental animal ethics review (IACUC):

[0852] After the experimental animals were received, they were housed in Beijing Vitalstar Biotechnology Co., Ltd., and the use license number is: SCXK(Beijing)2022 - 0013. This project has passed the review of the Experimental Animal Ethics Committee of Beijing Vitalstar Biotechnology Co., Ltd., and the IACUC number is VST-SY-24062701. The test process was carried out strictly in accordance with the requirements of IACUC to ensure animal welfare.

[0853] Feeding and management:

[0854] The animals were kept in a negative pressure barrier environment, using plastic (polycarbonate) boxes (volume 370×157×180mm) IVC. Since the experimental animals were male and aggressive, they were kept in individual cages. The animal feeding was the responsibility of Beijing Weitongda Biotechnology Co., Ltd.

[0855] The use and testing of animal feed, bedding and drinking water were carried out in accordance with GB14925-2010 "Experimental Animal Environment and Facilities". The control of animal feeding environment, including temperature and humidity, pressure difference, noise, illumination, ventilation frequency, ammonia concentration, etc., was temporarily implemented in accordance with GB50447-2008 "Technical Specifications for Laboratory Animal Facility Buildings". The temperature of the animal room was controlled at room temperature of 20~26℃ (daily temperature difference ≤4℃); the relative humidity was controlled at 40~70%; artificial lighting was used for illumination, with 12 / 12 hours of light and dark alternation during the day and night. Compressed wood shavings bedding was purchased from Beijing Ke'ao Xieli Feed Co., Ltd. (Batch No.: 23109613), and rat growth and breeding feed was purchased from Beijing Ke'ao Xieli Feed Co., Ltd. (Batch No.: 23103313). The relevant records of animal feeding management and environmental control during the experiment were kept in Beijing Weitongda Biotechnology Co., Ltd.

[0856] 2. Experimental methods

[0857] 2.1 AAV-HBV mouse model

[0858] Definition of experimental date: The day on which the animals were administered with the vehicle or the test drug was defined as day 0.

[0859] 100 SPF-grade C57BL / 6 male mice were adaptively raised in a barrier facility for 7 days and observed daily. The model was established after confirming that the mice were healthy and normal. The mouse animal model of persistent HBV infection was prepared by injecting rAAV8-1.3HBV into the tail vein. The AAV virus injection dose was 1.00×10 10 vg / mouse, and the AAV virus was diluted to 5.00×10 10 vg / mL, 200 μL was injected into each mouse, and the levels of HBV DNA, HBeAg and HBsAg in serum were detected 4 weeks after virus injection.

[0860] 2.2 Animal grouping and drug administration

[0861] Definition of experimental date: The day on which the animals were administered with the vehicle or the test drug was defined as day 0 (D0).

[0862] On day -2, all mice were bled submandibularly to collect plasma. The collected blood samples were anticoagulated with EDTA, centrifuged at 5000 rpm for 10 min, and the supernatant was used for HBV modeling detection. On day 0, 72 animals were selected according to the test results on day -2 for grouping, with 6 animals in each group, for a total of 12 groups. The details of grouping and dosing are shown in Table 70.

[0863] Table 70 Group setting and drug administration details

[0864]

[0865] Note: sc: subcutaneous injection.

[0866] 2.4 Observation and indicator monitoring

[0867] (1) General observation

[0868] During the modeling and experimental periods, the animals were observed and recorded daily. The observation contents included: whether they were dead or dying, feed and water intake, trauma, feces, appearance and coat, mental state, activity status, etc.

[0869] (2) Weight

[0870] Acclimation period: The animals were weighed and recorded upon receipt, and weighed and recorded on the day the acclimation period ended.

[0871] Experimental period: During the experimental period, the animals were weighed and recorded every week. If medication or blood sampling was required on the same day, they were weighed before the operation and before being killed.

[0872] (3) Determination of serum HBsAg, HBeAg, HBV DNA, and ALT levels

[0873] All animals were bled submandibularly to collect plasma on days -2, 6, 13, 20, 27, and 34. The collected blood samples were anticoagulated with EDTA and centrifuged at 5000 rpm for 10 min to separate the serum. After blood collection, the serum was separated and diluted with PBS solution and sent for testing. 10 μL of serum was taken from each sample, diluted to 500 μL (50 times diluted) with PBS solution, and sent to Beijing Dian Medical Testing Laboratory Co., Ltd. for testing serum HBV DNA, HBeAg, and HBsAg. 30 μL of serum was taken from each sample, diluted to 120 μL (4 times diluted) with PBS solution, and sent to Beijing Dian Medical Testing Laboratory Co., Ltd. for testing serum ALT. The remaining plasma for testing was stored at -80°C.

[0874] 3. Experimental results

[0875] The changes in HBsAg, HBeAg, HBV DNA, ALT levels and body weight of mice in each group over time are shown in Tables 71-75 and Figure 4A-4E The experimental results showed that the efficacy of all sequences was better than that of the Yangshen sequence VIR-2218-GL. Among them, C207S-DV29PG101, C207S-DV29PG103, C207S-DV32PG101, and C207S-DV32PG103 showed superior effects in reducing HBsAg, HBV DNA, and HBeAg, which were significantly better than the Yangshen sequence VIR-2218-GL. On the 28th day after administration, they could still reduce HBsAg by more than 3 log10 and HBV DNA by more than 3 log10, and no rebound had occurred, showing excellent anti-HBV efficacy.

[0876] Table 71 Changes in plasma HBsAg levels in mice in each sequence group

[0877]

[0878] Table 72 Changes in plasma HBV DNA levels in mice in each sequence group

[0879]

[0880] Table 73 Changes in plasma HBeAg levels in mice in each sequence group

[0881]

[0882] Table 74 Changes in plasma ALT levels in mice in each sequence group

[0883]

[0884] Table 75 Changes in body weight of mice in each sequence group

[0885]

Claims

1. A double-stranded RNAi agent, characterized in that The double-stranded RNAi agent comprises an antisense strand and a sense strand complementary to the antisense strand forming a double-stranded region, the nucleotide sequence of the antisense strand is as shown in SEQ ID NO: 13, or the nucleotide sequence of the antisense strand is a modified sequence of the sequence shown in SEQ ID NO:

13.

2. The double-stranded RNAi agent according to claim 1, characterized in that The double-stranded RNAi agent comprises an oligonucleotide duplex consisting of a sense strand and an antisense strand pair: The sense strand has a sequence as shown in SEQ ID NO: 6 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof.

3. The double-stranded RNAi agent according to claim 2, characterized in that The sense strand and the antisense strand contain at least one modified nucleotide.

4. The double-stranded RNAi agent according to claim 1, characterized in that The double-stranded RNAi agent has the function of inhibiting the expression of HBV genes.

5. The double-stranded RNAi agent according to claim 3, characterized in that At least one of the modified nucleotides is selected from one or more of the following groups: deoxy-nucleotides, 3'-terminal deoxy-thymine nucleotides, 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides, unlocked nucleotides, configurationally restricted nucleotides, restricted ethyl nucleotides, abasic nucleotides, 2'-amino-modified nucleotides, 2'-O-allyl-modified nucleotides, 2'-C-alkyl-modified nucleotides, 2'-hydroxy-modified nucleotides, 2'-O-methoxyethyl-modified nucleotides, 2'-O-alkyl-modified nucleotides, morpholino nucleotides, phosphoramidates, nucleotides containing non-natural bases, tetrahydropyran modified nucleotides, 1,5-anhydrohexitol modified nucleotides, cyclohexenyl modified nucleotides, nucleotides containing thiophosphate groups, nucleotides containing methylphosphonate groups, nucleotides containing 5'-phosphates, and nucleotides containing 5'-phosphate mimetics.

6. The double-stranded RNAi agent according to claim 1, characterized in that At least one strand of the double-stranded RNAi agent comprises a 3' overhang of at least 2 nucleotides.

7. The double-stranded RNAi agent according to claim 1, characterized in that The double-stranded region of the double-stranded RNAi agent is 20 pairs of nucleotides.

8. The double-stranded RNAi agent according to claim 1, characterized in that The sense strand of the double-stranded RNAi agent has 20 nucleotides, and the antisense strand has 22 nucleotides.

9. The double-stranded RNAi agent according to claim 1, characterized in that All modifications contained in the nucleotides on the sense strand and the antisense strand are chemical modifications at the 2' position of the ribose sugar of the nucleotide.

10. The double-stranded RNAi agent according to claim 9, characterized in that The chemical modification of the 2' position of the ribose of the nucleotide is selected from one or more of the following groups: 2'-methoxy, 2'-O-methoxyethyl, 2'-fluoro, 2'-benzyloxy, 2'-methylcarbonylamino and 2'-pyridinemethoxy.

11. The double-stranded RNAi agent according to claim 10, characterized in that The chemical modification of the 2' position of the ribose of the nucleotide is 2'-methoxy or 2'-fluoro.

12. The double-stranded RNAi agent according to claim 1, characterized in that The nucleotides are linked by 3',5'-phosphodiester bonds.

13. The double-stranded RNAi agent according to claim 12, characterized in that The 3',5'-phosphodiester bond comprises a thio modification.

14. The double-stranded RNAi agent according to claim 1, characterized in that The 5' carbon atom of the 5' terminal nucleotide glycoside of the antisense strand is phosphorylated.

15. The double-stranded RNAi agent according to claim 14, characterized in that The phosphorylated 5'-position phosphorylation group includes one or more selected from: 5'-vinyl phosphonate group, 5'-methyl phosphonate group, 5'-C-methyl phosphate group, 5'-thiophosphate group and 5'-phosphate group, and the structure is: ； R is hydrogen, hydroxyl, amine, C 1-4 Alkyl, aromatic, C 1-4 Alkoxy, C 1-4 Alkylcarbonylamino or halogen; The base is selected from any one of adenine, guanine, cytosine, thymine and uracil.

16. The double-stranded RNAi agent according to claim 1, characterized in that The nucleotides at the ends of the sequence are connected by 3',5'-phosphodiester bonds containing thiolation modifications, and form chirally pure 3',5'-thiophosphate diester bonds.

17. The double-stranded RNAi agent according to claim 16, characterized in that The 5' ends of the sense strand and the antisense strand contain 1-3 thio linkages, and the 3' end of the antisense strand contains 1-3 thio linkages.

18. The double-stranded RNAi agent according to claim 1, characterized in that The antisense strand is modified in one of the following ways: And / or, the sense strand is modified by one of the following methods: Among them, 2'-OMe is 2'-methoxy; 2'-F is 2'-fluoro; PS is a thiophosphate skeleton; and EVP is 5'-vinyl-(E)-phosphonate.

19. The double-stranded RNAi agent according to claim 18, characterized in that The double-stranded RNAi agent is modified in the following manner: The antisense strand adopts modification method A, and the sense strand adopts modification method a; The antisense strand adopts modification method A, and the sense strand adopts modification method b; The antisense strand adopts modification method B, and the sense strand adopts modification method a; The antisense strand adopts modification method B, and the sense strand adopts modification method b; The antisense strand adopts modification method C, and the sense strand adopts modification method b; The antisense strand adopts modification method D, and the sense strand adopts modification method b; The antisense strand adopts modification method E, and the sense strand adopts modification method a; or, The antisense strand adopts modification method F, and the sense strand adopts modification method b.

20. The double-stranded RNAi agent according to claim 1, characterized in that The second to eighth positions of the antisense strand from the 5' end adopt a modification group, wherein the modification group is selected from one or more of UNA, GNA and DNA, and the structures of UNA and GNA are: ； The base is selected from any one of adenine, guanine, cytosine, thymine and uracil.

21. The double-stranded RNAi agent according to any one of claims 1 to 20, characterized in that The double-stranded RNAi agent comprises any oligonucleotide duplex selected from the following sense and antisense strand pairs: (1) the sense strand has the sequence shown in SEQ ID NO: 106; and the antisense strand has the sequence shown in SEQ ID NO: 213, 214, 215 or 216; (2) the sense strand has the sequence shown in SEQ ID NO: 107; and the antisense strand has the sequence shown in SEQ ID NO: 214 or 213; (3) the sense strand has the sequence shown in SEQ ID NO: 108; and the antisense strand has the sequence shown in SEQ ID NO: 217 or 218; (4) the sense strand has the sequence shown in SEQ ID NO: 109; and the antisense strand has the sequence shown in SEQ ID NO: 218; and, (5) The sense strand has the sequence shown in SEQ ID NO: 110; and the antisense strand has the sequence shown in SEQ ID NO:

218. (6) The sense strand has the sequence shown in SEQ ID NO: 306; and the antisense strand has the sequence shown in SEQ ID NO:

321.

22. A conjugate, characterized in that The conjugate includes the double-stranded RNAi agent of any one of claims 1 to 21, and a ligand conjugated to the double-stranded RNAi agent.

23. The conjugate according to claim 22, characterized in that The ligand is conjugated to the 3'-end or 5'-end of the sense strand of the oligonucleotide.

24. The conjugate according to claim 22, characterized in that The ligand is one or more GalNAc derivatives attached using a divalent or trivalent branched linkage, or a GalNAc derivative attached using a monovalent linkage.

25. The conjugate according to claim 22, characterized in that The ligand is: ， wherein X is hydrogen or a hydroxyl protecting group or H, wherein the hydroxyl protecting group includes acetyl, benzoyl or isobutyryl; Y is an amine protecting group or H, wherein the amine protecting group is formyl, acetyl, propionyl, n-butyryl or isobutyryl; n is an integer between 0 and 20; and q, r and s are independently integers between 1 and 7.

26. The conjugate according to claim 25, characterized in that The ligand is: 。 27. The conjugate according to claim 22, characterized in that The ligand is: ， Wherein, X is oxygen, nitrogen or sulfur; Y is an alkyl group or an aromatic group; R1 is oxygen or sulfur; R2 is hydrogen, amine, C 1-4 Alkyl, aromatic, C 1-4 Alkoxy or halogen; A is -(CH2) a -、-(CH2CH2O) b -、-((CH2) c NHCO) d -or-((CH2) c CONH) d -, wherein a is an integer from 1 to 15, b is an integer from 1 to 7, c is an integer from 1 to 7, and d is an integer from 1 to 5; B is -(CH2) e -, where e is an integer from 0 to 7; L is -CONH- or -NHCO-; X1 is -(CH2) f -or-(CH2CH2O) f CH2-, f is an integer from 1 to 5; X2 is -(CH2) g -, g is an integer from 1 to 6; Y1 is 0 or 1; Y2 is 0, 1 or 2; Y3 is 1, 2 or 3; m is an integer from 0 to 4; n is an integer from 0 to 4.

28. The conjugate according to claim 27, characterized in that The ligand is G4, G5, G6 or G7: ， ， ,or 。 29. The conjugate according to claim 28, characterized in that The conjugate has the structure shown below: ， ， ， ,or 。 30. The conjugate according to claim 22, characterized in that The ligand is: Wherein, X is oxygen, nitrogen or sulfur; Y is an alkyl group or an aromatic group; R1 is oxygen or sulfur; R2 is hydrogen, amine, C 1-4 Alkyl, aromatic, C 1-4 Alkoxy or halogen; A is -(CH2) a -、-(CH2CH2O) b -、-((CH2) c NHCO) d -or-((CH2) c CONH) d -, wherein a is an integer from 1 to 15, b is an integer from 1 to 7, c is an integer from 1 to 7, and d is an integer from 1 to 5; B is -(CH2) e -, where e is an integer from 0 to 7; L is -CONH- or -NHCO-; X1 is -(CH2) f -or-(CH2CH2O) f CH2-, f is an integer from 1 to 5; X2 is -(CH2) g -, g is an integer from 1 to 6; Y1 is 0 or 1; Y2 is 0, 1 or 2; Y3 is 1, 2 or 3; m is an integer from 0 to 4; n is an integer from 0 to 4.

31. The conjugate according to claim 30, characterized in that Wherein the ligand is G101, G102, G103, G105 or G106: , , , ,or .

32. The conjugate according to claim 31, characterized in that The conjugate has the structure shown below: ， ， ， ,or 。 33. The conjugate according to claim 22, characterized in that The conjugate comprises any oligonucleotide duplex selected from the following sense and antisense strand pairs: The sense strand has a sequence as shown in SEQ ID NO: 350, 351 or 352; and the antisense strand has a sequence as shown in SEQ ID NO:

321.

34. The conjugate according to any one of claims 22 to 33, characterized in that The conjugate has the function of inhibiting the expression of HBV genes.

35. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the double-stranded RNAi agent according to any one of claims 1 to 21 or the conjugate according to any one of claims 22 to 34, and a pharmaceutically acceptable carrier.

36. The pharmaceutical composition according to claim 35, characterized in that The double-stranded RNAi agent or the conjugate is administered in a non-buffered solution.

37. The pharmaceutical composition according to claim 36, characterized in that The non-buffered solution is saline or water.

38. The pharmaceutical composition according to claim 35, characterized in that The double-stranded RNAi agent or the conjugate is administered with a buffer solution.

39. The pharmaceutical composition according to claim 38, characterized in that The buffer solution comprises acetate, citrate, prolamine, carbonate or phosphate or any combination thereof.

40. The pharmaceutical composition according to claim 39, characterized in that The buffer solution is phosphate buffered saline.

41. The pharmaceutical composition according to claim 38, wherein The double-stranded RNAi agent or the conjugate is formulated into a lipid formulation for delivery in a membranous molecular assembly.

42. The pharmaceutical composition according to claim 41, characterized in that The lipid formulation is a nucleic acid-lipid particle.

43. The pharmaceutical composition according to claim 42, characterized in that The lipid formulation is a lipid nanoparticle.

44. The pharmaceutical composition according to claim 41, characterized in that The mass / mass ratio of lipid to the double-stranded RNAi agent or the conjugate is 1:1-50:1, 1:1-25:1, 3:1-15:1, 4:1-10:1, 5:1-9:1, or 6:1-9:

1.

45. The pharmaceutical composition according to claim 43, characterized in that The lipid nanoparticles include cationic lipids, neutral lipids, structured lipids and polymer-conjugated lipids.

46. ​​The pharmaceutical composition according to claim 45, characterized in that The cationic lipid is a compound of formula (I), or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof, (I)， G1 is C 1～6 Alkylene; G2 is C 2～8 Alkylene; G3 is C 1～3 Alkylene; L1 is C 6～15 Straight chain alkyl; L2 is C 12～25 Branched chain alkyl.

47. The pharmaceutical composition according to claim 46, wherein The cationic lipid is YK-009 of formula (II): (I-I)。 48. The pharmaceutical composition of claim 45, wherein The cationic lipid is a compound of formula (II), or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof, (II), G1 is C 2~8 Alkylene; G2 is C 2~8 Alkylene; L1 is -C(O)O- or -OC(O)-; L2 is -C(O)O- or -OC(O)-; R1 is C 6~25 Straight or branched alkyl; R2 is C 6~25 Straight chain or branched alkyl; G3 is HO(CH2)2- or HO(CH2)3-; G4 is HO(CH2)2- or HO(CH2)3-; L is (CH2)2- or -(CH2)3- or -(CH2)4-.

49. The pharmaceutical composition according to claim 48, characterized in that The cationic lipid is YK-401 of formula (II-I) or YK-402 of formula (II-II): (II-I), (II-II).

50. The pharmaceutical composition of claim 45, wherein The cationic lipid is a compound of formula (III), or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof, (III), G1 is C 1~6 Alkylene; G2 is C 2~8 Alkylene; R1 is C 6~20 Straight or branched alkyl; R2 is C 12~25 Branched alkyl; G3 is: HO(CH2)2N(CH3)(CH2)2-, HO(CH2)2N(CH2CH3)(CH2)2-, (HO(CH2)2)2N(CH2)2-, CH3O(CH2)2N(CH3)(C H2)2-, (CH3)2N(CH2)3SC(O)O(CH2)2-, (CH3)2N(CH2)3SC(O)-, CH3NH(CH2)2N(CH3)(CH2)2- or CH3CH2NH(CH2)2-.

51. The pharmaceutical composition of claim 50, wherein The cationic lipid is YK-201 of formula (III-I) or YK-202 of formula (III-II): (III-I), (III-II)。 52. The pharmaceutical composition of claim 45, wherein The cationic lipid is a compound of formula (IV), or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof, (IV), G1 is C 1~8 Alkylene; G2 is C 2~8 Alkylene; R1 is C 6~25 Straight or branched alkyl; R2 is C 12~25 Straight chain or branched alkyl; G3 is: HO(CH2)2N(R3)CH2CH(OH)CH2-, wherein R3 is -CH3 or -CH2CH3 or -CH2CH2OH.

53. The pharmaceutical composition of claim 52, wherein The cationic lipid is YK-305 of formula (IV-I) or YK-310 of formula (IV-II): (IV-I), (IV-II)。 54. The pharmaceutical composition of claim 45, wherein The cationic lipid is a compound of formula (V), or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof, (V)， G 1 and G 2 Each independently is an unsubstituted C6-C 10 Alkylene; G 3 For unsubstituted C1-C 12 Alkylene; R 1 and R 2 Each independently is C6-C 24 Alkyl or C6-C 24 Alkenyl; R 3 OR 5 、N、-C(=O)OR 4 、-OC(=O)R 4 or -NR 5 C(=O)R 4 ; R 4 C1-C 12 A hydrocarbon group; and R 5 It is H or C1-C6 hydrocarbon group.

55. The pharmaceutical composition of claim 54, wherein The cationic lipid is ALC0315 of formula (VI): (VI) 56. The pharmaceutical composition of claim 45, wherein The cationic lipid is a compound of formula (VI), or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof, (WE), R4 is selected from -(CH2) n Q and -(CH2) n CHQR; Q is selected from the group consisting of: -OR, -OH, -O(CH2) n N(R)2, -OC(O)R, -CX3, -CN, -N(R)C(O)R, -N(H)C(O)R, -N(R)S(O)2R, -N(H)S(O)2R, -N(R)C(O)N(R)2, -N(H)C(O)N(R)2, -N(H)C(O)N(H)(R), -N(R)C(S)N(R)2, -N(H)C(S)N(R)2, -N(H)C(S)N(H)(R), -N(R)S(O)2R8 and heterocycle; n is 1, 2 or 3.

57. The pharmaceutical composition of claim 56, wherein The cationic lipid is SM102 of formula (VI-I): (VI-I).

58. The pharmaceutical composition of claim 45, wherein The cationic lipid is a compound DLIN-MC3-DMA of formula (VII), or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof, (VII)。 59. The pharmaceutical composition of claim 45, wherein The cationic lipids include one or more selected from the group consisting of: YK-009, YK-401, YK-305, ALC0315, SM102 and DLIN-MC3-DMA.

60. The pharmaceutical composition of claim 45, wherein The molar ratio of the cationic lipid to the neutral lipid is 1:1 to 10:

1.

61. The pharmaceutical composition of claim 45, wherein The molar ratio of the cationic lipid to the structural lipid is 1:1 to 5:

1.

62. The pharmaceutical composition of claim 45, wherein The molar ratio of the cationic lipid, the neutral lipid, the structural lipid and the polymer conjugated lipid is (25-65):(5-25):(25-70):(0.5-5).

63. The pharmaceutical composition of claim 62, wherein The molar ratio of the cationic lipid, the neutral lipid, the structural lipid and the polymer conjugated lipid is (25-65):(5-25):(25-45):(0.5-5).

64. The pharmaceutical composition of claim 63, wherein The molar ratio of the cationic lipid, the neutral lipid, the structural lipid and the polymer conjugated lipid is 50:10:38.5:1.5 or 49:10:39.5:1.

5.

65. The pharmaceutical composition of claim 45, wherein The neutral lipids include one or more selected from: phosphatidylcholine, phosphatidylethanolamine, sphingomyelin, ceramide, sterol and derivatives thereof.

66. The pharmaceutical composition of claim 65, wherein The neutral lipids are selected from one or more of the following: 1,2-dilinoleoyl-sn-glycero-3-phosphocholine, 1,2-dimyristoyl-sn-glycero-phosphocholine, 1,2-dioleoyl-sn-glycero-3-phosphocholine, 1,2-dipalmitoyl-sn-glycero-3-phosphocholine, 1,2-distearoyl-sn-glycero-3-phosphocholine, 1,2-diondecanoyl-sn-glycero-phosphocholine, 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine alkali, 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine, 1-oleoyl-2-cholesteryl hemisuccinyl-sn-glycero-3-phosphocholine, 1-hexadecyl-sn-glycero-3-phosphocholine, 1,2-dialinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine, 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine, 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1- glycerol) sodium salt, dipalmitoylphosphatidylglycerol, palmitoyloleoylphosphatidylethanolamine, distearoyl-phosphatidyl-ethanolamine, dipalmitoylphosphatidylethanolamine, dimyristoylphosphoethanolamine, 1-stearoyl-2-oleoyl-stearoylethanolamine, 1-stearoyl-2-oleoyl-phosphatidylcholine, sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyloleoylphosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine and mixtures thereof.

67. The pharmaceutical composition of claim 66, wherein The neutral lipid is 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine and / or 1,2-distearoyl-sn-glycero-3-phosphocholine.

68. The pharmaceutical composition of claim 45, wherein The structured lipids are selected from one or more of the following: cholesterol, non-sterols, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatine, ursolic acid, α-tocopherol and corticosteroids.

69. The pharmaceutical composition of claim 68, wherein The structural lipid is cholesterol.

70. The pharmaceutical composition of claim 45, wherein The polymer conjugated lipid is selected from one or more of the following: PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol and PEG-modified dialkylglycerol.

71. The pharmaceutical composition of claim 70, wherein The polymer conjugated lipid is selected from one or more of the following: distearoylphosphatidylethanolamine polyethylene glycol 2000, dimyristoylglycerol-3-methoxy polyethylene glycol 2000 and methoxy polyethylene glycol ditetradecyl acetamide.

72. A medicine kit, characterized in that: The kit comprises Kit A, which includes one or more of the double-stranded RNAi agent according to any one of claims 1 to 21, the conjugate according to any one of claims 22 to 34, or the pharmaceutical composition according to any one of claims 35 to 71.

73. The kit according to claim 72, characterized in that: The kit also includes a kit B, which contains one or two of the following: (1) Other drugs for reducing HBV gene expression or compositions containing such drugs for reducing HBV gene expression; (2) One or more of the group consisting of hormonal agents, targeted small molecule agents, proteasome inhibitors, imaging agents, diagnostic agents, chemotherapeutic agents, oncolytic drugs, cytotoxic agents, cytokines, activators of co-stimulatory molecules, inhibitors of inhibitory molecules, and vaccines.

74. Use of the double-stranded RNAi agent according to any one of claims 1-21, the conjugate according to any one of claims 22-34, or the pharmaceutical composition according to any one of claims 35-71 in the preparation of a drug for preventing and / or treating diseases related to HBV gene expression.

75. The use according to claim 74, characterized in that The HBV gene expression-related diseases are selected from the following disease types: chronic hepatitis B, liver fibrosis, cirrhosis, liver cancer, acute hepatitis B, and HBV / hepatitis D virus co-infection-related diseases.

76. A method for reducing HBV gene expression or inhibiting HBV replication for non-preventive and / or therapeutic purposes, characterized in that: The method comprises administering to the sample one or more of the double-stranded RNAi agent of any one of claims 1-21, the conjugate of any one of claims 22-34, the pharmaceutical composition of any one of claims 35-71, and the kit of parts of claims 72 or 73.

Images