Nucleic acid aptamer for detecting thyroid-associated ophthalmopathy as well as preparation method and application of nucleic acid aptamer
By developing high-affinity and specific nucleic acid aptamers for detecting biomarkers in plasma of thyroid-related eye diseases, the problem of early diagnosis and typing difficulties in the prior art has been solved, and more accurate disease identification and diagnosis and treatment basis is achieved.
Patent Information
- Application Number
- CN202411771650.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-04
- Publication Date
- 2025-04-11
AI Technical Summary
It is difficult to accurately diagnose and type thyroid-related eye disease (TAO) in the early stage, and traditional diagnostic methods are subjectively affected and cannot objectively evaluate the disease process.
Develop a high affinity and specific nucleic acid aptamer to detect biomarkers in plasma of thyroid-associated eye diseases, and obtain aptamers through optimized screening methods to achieve early diagnosis and accurate typing.
The aptamers obtained through optimized screening methods have higher specificity and affinity for thyroid-associated eye diseases plasma biomarkers, can more accurately identify disease-related proteins, achieve early diagnosis, and overcome the difficulties in early diagnosis of the prior art.
Smart Images
Figure BDA0005170416020000071 
Figure BDA0005170416020000072 
Figure BDA0005170416020000081
Abstract
Description
Technical Field
[0001] The invention relates to a nucleic acid aptamer for detecting thyroid-related eye diseases and a preparation method and application thereof, belonging to the field of biomedical detection. Background Art
[0002] Thyroid associated ophthalmopathy (TAO), also known as Graves' orbitopathy (GO), is a chronic, blinding autoimmune eye disease.
[0003] TAO usually presents with eyelid retraction (Dalrymple sign) and delayed eyelid droop (vonGraefe sign), proptosis and orbital tissue edema, extraocular muscle hypertrophy and movement disorders. In severe cases, the optic nerve may be compressed, causing visual impairment or even blindness. The global prevalence of Graves' disease is between 0.2% and 1.3%, and the prevalence of combined thyroid eye disease is 40%. Among them, the prevalence of thyroid eye disease in Asians is as high as 45%. The prevalence of thyroid-related eye disease in my country is about 0.3%, with about 4.2 million patients.
[0004] However, the pathogenic mechanism of TAO is still unclear. The traditional view is that TAO is secondary to patients with hyperthyroidism, but with the deepening of research, it is found that some patients have normal or hypothyroid thyroid function when TAO occurs. In clinical practice, TAO is often diagnosed based on the history of abnormal thyroid function, imaging data, etc., and the degree of disease progression of TAO is evaluated according to the activity score (CAS) standard or the visual, inflammation, strabismus and appearance (VISA) grading. However, these diagnostic methods are greatly influenced by subjectivity and cannot objectively evaluate the disease process, which brings great challenges to the diagnosis and classification of TAO. Although there are blood indicators such as TSHR and IgG4 to assist in the diagnosis of TAO, these indicators have a high false positive rate and cannot make a diagnosis for the classification of TAO. Therefore, there is an urgent need for a new molecular tool to discover important markers at different stages of the TAO disease process to provide a basis for the diagnosis and treatment of the disease. Summary of the invention
[0005] The present invention aims to develop an aptamer with high affinity and specificity for the detection of plasma biomarkers of thyroid-related eye disease to achieve early diagnosis and accurate typing.
[0006] In order to solve the above technical problems, the technical solution adopted by the present invention is:
[0007] A nucleic acid aptamer for detecting plasma biomarkers of thyroid-related eye diseases, characterized in that the nucleic acid aptamer is aptamer47-1, aptamer48-1, aptamer48-2, aptamer55-2, aptamer61-2, aptamer70-2, aptamer81-1 and aptamer84-2;
[0008] The nucleotide sequence of the nucleic acid aptamer aptamer47-1 is as shown in SEQ ID NO: 1: TTCAGCACTCCACGCATAGCATCTGCCTTCCTATTATCGGCGAACAACTCGCACCCAACCTATGCGTGCTACCGTGAA;
[0009] The nucleotide sequence of the nucleic acid aptamer aptamer48-1 is as shown in SEQ ID NO: 2:
[0010] TTCAGCACTCCACGCATAGCATCTGTCTCAACCTATTCAACGGACAATCCGTACCCAACCTATGCGTGCTACCGTGAA;
[0011] The nucleotide sequence of the nucleic acid aptamer aptamer48-2 is as shown in SEQ ID NO: 3:
[0012] TTCAGCACTCCACGCATAGCATCTGTTTCCTGCCCATAACCGAATAACTCGGACCCAACCTATGCGTGCTACCGTGAA;
[0013] The nucleotide sequence of the nucleic acid aptamer aptamer55-2 is as shown in SEQ ID NO: 4:
[0014] TTCAGCACTCCACGCATAGCAGTCATTGGGGTTAGGGTTTGGGTGGGCGAATGTAACTCCTATGCGTGCTACCGTGAA;
[0015] The nucleotide sequence of the nucleic acid aptamer aptamer61-2 is as shown in SEQ ID NO: 5:
[0016] TTCAGCACTCCACGCATAGCAGTCAGTAGCGGTTACGGAAACACTCCTGCACGAGCCTCCTATGCGTGCTACCGTGAA;
[0017] The nucleotide sequence of the nucleic acid aptamer aptamer70-2 is as shown in SEQ ID NO: 6:
[0018] TTCAGCACTCCACGCATAGCCGTACTGTTGTGCGTTTTGGGTTAGGGAGGTGTAGGTCCCTATGCGTGCTACCGTGAA;
[0019] The nucleotide sequence of the nucleic acid aptamer aptamer81-1 is as shown in SEQ ID NO: 7:
[0020] TTCAGCACTCCACGCATAGCCTGCACGTTTGTGGTTTTGGTTGGTAGGGGTACGAGTGCCCTATGCGTGCTACCGTGAA;
[0021] The nucleotide sequence of the nucleic acid aptamer aptamer84-2 is as shown in SEQ ID NO: 8:
[0022] TTCAGCACTCCACGCATAGCACGTCGCTTCGGTCGTGTTGGTTGGTCTGGTTGGTTCTCCTATGCGTGCTACCGTGAA.
[0023] The present invention also provides a method for preparing a nucleic acid aptamer for detecting plasma biomarkers of thyroid-related eye diseases, comprising the following steps:
[0024] (1) The positive screening target plasma was mixed in equal proportions and then separated in one dimension and two dimensions. The original mixed blood sample was passed through an immunoaffinity column to remove 14 high-abundance proteins in the blood sample and enrich low-abundance proteins. The sample after immunoremoval was concentrated by ultrafiltration at 4000xg for 3 hours and then injected into a liquid chromatograph for separation. The plasma after homogenization was divided into 96 fractions according to the isoelectric point of the protein, which were collected and stored at -80°C.
[0025] (2) The protein components in the treated plasma were fixed to the bottom of a 96-well black ELISA plate by covalent linkage and incubated with the screening library. The aptamers bound to the target protein and were enriched at the bottom of the plate. The plate was then washed with a buffer to remove unbound and non-specifically bound sequences. The bound sequences at the bottom of the plate were collected by heat denaturation. Finally, the eluted products were subjected to qPCR to monitor the sequence enrichment trend and PCR amplification to prepare a secondary library for the next round of screening. A total of five rounds of screening were performed. In order to remove aptamers that bound to non-differentially expressed proteins, healthy human inactivated plasma was added to the liquid phase for counter-screening starting from the third round of screening.
[0026] (3) Firstly, a rough screening is performed using a chemiluminescence method;
[0027] (4) using qPCR to perform affinity gradient fitting;
[0028] (5) Clinical sample fitting: The feasibility of the above aptamers for distinguishing the plasma of healthy subjects and TAO patients was determined by analyzing the differences in Cq values.
[0029] Furthermore, preferably: the positive screening target plasma is the plasma of a person diagnosed with thyroid-related eye disease for the first time; and the negative screening target plasma is the plasma of a healthy person with normal thyroid function.
[0030] Furthermore, preferably: the step (3) is specifically as follows: first, 3ug of plasma sample is plated overnight to fix the plasma protein on the bottom of the well plate; then, the supernatant is removed, and 100μL of 1mg / mL BSA is added for blocking to reduce the adsorption of the sequence by the well plate material; then, the biotin-labeled aptamer is added and incubated at room temperature for 60min to fully enrich the binding sequence, and similarly, an equal amount of biotin-polyA (20nt) is added to the control group as the background signal of the luminescence experiment; finally, the unbound sequence is washed, and SA-AP and the luminescent substrate are added in sequence to fully react and detect the luminescence value.
[0031] Further, preferably: the luminescence value detection is specifically: the luminescence experiment is divided into 4 stages:
[0032] 1) Use a single fraction corresponding to the aptamer as the target and retain the sequence with a luminescence value greater than 3 times the background signal;
[0033] 2) Using homogenized TAO patient mixed plasma as the target, retaining the sequences with luminescence values greater than 2 times the background signal;
[0034] 3) Using TAO patient mixed plasma as the target, retaining the sequences with luminescence values greater than the background signal but less than the luminescence value in (2), and screening to obtain aptamers with significant binding ability to patient plasma;
[0035] 4) The mixed sera of healthy subjects and TAO patients are used as targets respectively, and the aptamers with significantly different luminescence values are retained.
[0036] Further, preferably: the step (4) is specifically as follows: homogenized TAO plasma and mixed TAO plasma are plated and blocked, and 100 μL of aptamer is added respectively and incubated at room temperature; unbound and non-specific sequences are discarded, 110 μL of ultrapure water is added, and the eluted product is obtained at 95°C for 10 min, and the eluted product is subjected to qPCR absolute quantitative analysis, with the concentration of the aptamer added in the experiment as the horizontal axis, in nM, and the absolute quantitative result (i.e., signal response value) as the vertical axis, in nM, to fit the binding and dissociation curves, and calculate the equilibrium dissociation constant of the aptamer, i.e., Kd value, Kd<1*10 -8 M and R 2 The aptamer with a value of ≥0.95 was the final aptamer.
[0037] Furthermore, preferably: the step (5) is specifically as follows: plating plasma samples from healthy persons and TAO patients, incubating with 100 μL of 100 nM aptamer at room temperature to obtain eluted products, performing qPCR detection, and determining the feasibility of the above aptamer for distinguishing the plasma of healthy persons and TAO patients by analyzing the difference in Cq values.
[0038] The present invention also provides an application of a nucleic acid aptamer in preparing plasma biomarkers for detecting prostate-related eye diseases.
[0039] The present invention also provides an application of a nucleic acid aptamer in the preparation of targeted therapy and personalized medicine drugs.
[0040] Beneficial effects of the present invention:
[0041] By optimizing the screening method, the aptamers obtained in the present invention have higher specificity and affinity for plasma biomarkers of thyroid-related eye disease and can more accurately identify disease-related proteins. The aptamers of the present invention are expected to achieve early diagnosis and overcome the difficulties of the prior art in early diagnosis.
[0042] The aptamer of the present invention has potential application value in biomarker discovery and targeted therapy, and expands the application scope of the existing technology in the field of disease treatment. BRIEF DESCRIPTION OF THE DRAWINGS
[0043] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.
[0044] Figure 1 is a screening flow chart of the aptamer of the present invention;
[0045] Figure 2 This is a graph showing the recovery rate of the library in consecutive screening rounds;
[0046] Figure 3 This is the result of the initial chemiluminescence affinity test;
[0047] Figure 4 This is a grouping diagram of the target protein abundance;
[0048] Figure 5 This is the affinity result of the aptamer in TAO mixed high-abundance plasma;
[0049] Figure 6 The affinity result diagram of the aptamer in TAO mixed plasma;
[0050] Figure 7 This is a graph showing the difference in Cq values of aptamers between TAO patients and the control group. DETAILED DESCRIPTION
[0051] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.
[0052] Test instruments and equipment
[0053] The initial oligonucleotide library was provided by GENEWIZ (Suzhou, China);
[0054] Blood samples were obtained from the Eye and Optometry Hospital of Wenzhou Medical University with ethical approval from the Eye and Optometry Hospital of Wenzhou Medical University.
[0055] Real-time quantitative PCR (Bio-rad Group, USA);
[0056] LC480, DPBS solution (2.68 mM KCl, 1.47 mM KH2PO4, 8.1 mM Na2HPO4, 137 mM NaCl; pH = 7.4), and streptavidin (SA)-coated magnetic beads were purchased from Wisdom Life Science (Changzhou, China);
[0057] BSA and Tween 20 were purchased from Sangon Biotech (Shanghai, China);
[0058] 96 black ELISA plate, Tris-HCl, Cytopure nucleic acid extractor, SA-AP and luminescent substrate (Taizhou, China).
[0059] Example 1
[0060] like Figure 1 As shown, a method for preparing a nucleic acid aptamer for detecting plasma biomarkers of thyroid-related eye disease comprises the following steps:
[0061] (1) The collected anticoagulated blood from patients and the control group was centrifuged at 4°C and 3000 r / min for 10 min, the oil precipitate was discarded, the supernatant (i.e., plasma) was transferred to a cryopreservation tube, and frozen at -80°C. The amount of plasma required for 10 rounds of screening was estimated (a total of 2 mL was required for this experiment).
[0062] The positive screening target plasma is the plasma of patients with thyroid-related eye disease diagnosed for the first time, and the negative screening target plasma is the plasma of healthy people with normal thyroid function.
[0063] The inclusion criteria for thyroid-related eye diseases include: diagnosis in accordance with Bartley criteria; never received radiotherapy; no hormone shock therapy in the past 3 months and no other eye diseases. The inclusion criteria for healthy people include no autoimmune diseases; no systemic diseases such as heart, liver, and kidney, and no glucocorticoids, immunosuppressants, radiotherapy, etc. All plasma was collected in anticoagulant tubes.
[0064] (2) Ten samples of positive screening target plasma were taken, thawed at room temperature, and then mixed in equal amounts (200 μL each) to prepare mixed plasma.
[0065] Afterwards, the original mixed blood sample was removed by immunoaffinity column to remove 14 high-abundance proteins in the blood sample and enrich low-abundance proteins. The immunoremoved sample was ultrafiltered and concentrated at 4000xg for 3 hours and then injected into a liquid chromatograph (Shimadzu high-performance liquid chromatograph LC-20AD) for separation.
[0066] The specific separation conditions were: IEX-A: 20 mM Tris-HCl (pH 8.0); IEX-B: 20 mM Tris-HCl + 1 M NaCl (pH 8.0); the flow rate was 1 mL / min; the fraction collection time window was 3-52 min; the fraction collection volume was 0.5 mL; the gradient conditions were 0 min 0% B, 35 min 30% B, 40 min 50% B, 42 min 100% B, 52 min 100% B. 96 fractions were received in sequence and stored at -80°C.
[0067] (3) SELEX positive screening was performed using the treated mixed plasma of patients with thyroid-related eye disease as the positive screening material. The control group plasma was used as a competitor and added starting from the third round. The synthesized ssDNA library was incubated with the mixed plasma of patients with thyroid-related eye disease, heated and eluted, symmetrical PCR amplified, and ssDNA prepared by streptavidin magnetic beads. The prepared secondary library was used for the next round of subtractive screening. During each round of screening, the amount of ssDNA input was continuously reduced to maximize the removal of non-specific oligonucleotide fragments. A total of 5 rounds of positive SELEX screening were performed. The specific screening process is as follows:
[0068] 1) Blood sample plating: Take 50 μL of each 96x blood sample and spread it on a 96 ELISA plate, add 50 μL of 20 mM pH = 8.0
[0069] Tris-HCl, incubate overnight at 4°C.
[0070] 2) Library pretreatment: Place the centrifuge tube containing the initial library powder in a centrifuge, centrifuge at 12000rpm for 8min, dilute to 5μM with DPBS, and put into the first round of screening. Take the secondary library solution, denature it at 95℃ for 10min, and then at 4℃
[0071] The single-stranded state was maintained for 10 min and 2 h at 25 °C.
[0072] 3) Incubation of plasma and aptamers: using washing buffer The plate with the blood sample was washed twice, the pretreated library was added, and incubated at room temperature for 1 h.
[0073] 4) Heating elution: Wash the plate 4 times with washing buffer, retain the first 2 washes and name them wash1 and
[0074] Wash2. Add 110 μL ultrapure water to each well for heating and elution to obtain the eluate. Determine the concentration of single-stranded DNA in the eluate and calculate the retention rate ( Figure 2 ).
[0075] 5) qPCR monitoring screening process: The reaction system is 20 μL, and the specific components are 18 μL qPCR mix and 2 μL template. The templates are wash1, wash2 and Elution. The specific amplification program is shown in Table 1.1.
[0076] 6) PCR amplification: The reaction system is 500 μL, and the specific components are 450 μL PCR mix and 50 μL template. The amplification conditions are:
[0077] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 sec; annealing at 60°C for 30 sec; extension at 72°C for 30 sec, cycle amplification;
[0078] The final extension was performed at 72°C for 2 min. The template was the eluted product of the positive screen.
[0079] 7) Preparation of secondary library: Purify the PCR product from the previous step and perform quality control. This step is completed on the Cybio fully automatic nucleic acid extraction instrument (see Table 1.2 for the specific process). The obtained secondary library is used for the next round of screening.
[0080] Table 1.1qPCR program settings
[0081]
[0082] Table 1.2 Cybex program settings
[0083]
[0084]
[0085] Example 2
[0086] like Figure 3 As shown, the affinity of nucleic acid aptamers was initially screened using chemiluminescence method:
[0087] Specific steps: First, take 3ug plasma sample and plate overnight to fix plasma protein on the bottom of the plate; then remove the supernatant and add 100μL 1mg / mL BSA for blocking to reduce the adsorption of the sequence by the plate material; then add biotin-labeled aptamers and incubate at room temperature for 60min to fully enrich the binding sequence. Similarly, the control group added an equal amount of biotin-polyA (20nt) as the background signal of the luminescence experiment; finally, wash the unbound sequence, add SA-AP and luminescent substrate in turn, and fully react to detect the luminescence value. 12 nucleic acid aptamers were initially screened by chemiluminescence method for subsequent experiments.
[0088] This part of the experiment is divided into 4 stages:
[0089] 1) Use a single fraction corresponding to the aptamer as the target and retain the sequence with a luminescence value greater than 3 times the background signal;
[0090] 2) Using homogenized TAO patient mixed plasma as the target, retaining the sequences with luminescence values greater than 2 times the background signal;
[0091] 3) Using TAO patient mixed plasma as the target, retaining the sequences with luminescence values greater than the background signal but less than the luminescence value in (2), and screening to obtain aptamers with significant binding ability to patient plasma;
[0092] 4) The luminescence value was detected using equal amounts of plasma from healthy people or TAO patients before and after homogenization. The signal intensity of the unhomogenized serum of healthy people was taken as 1, and the relative signal intensities of the other three groups were calculated. Among them, 12 aptamers can distinguish between the plasma of healthy people and TAO patients, and can be divided into 4 categories according to the abundance and abnormal expression of the target protein ( Figure 4 ):
[0093] a. Possible targets for low-abundance proteins with abnormally downregulated expression, including aptamer47-1, aptamer47-2, aptamer48-1, aptamer48-2, aptamer55-2, and aptamer70-2
[0094] b. A possible target for the abnormally downregulated medium-abundance protein is aptamer63-1
[0095] c. Potentially targets aberrantly upregulated moderately abundant proteins, including aptamer80-1, aptamer81-1, and aptamer84-2
[0096] d. Potentially targeting low-abundance proteins that are abnormally upregulated, including aptamer61-2 and aptamer64-1
[0097] Example 3
[0098] Affinity gradient fitting using qPCR:
[0099] Specifically: take homogenized TAO plasma ( Figure 5 ) and pooled TAO plasma ( Figure 6 ) were plated and blocked, and 100 μL of the aptamers retained in the previous step were added and incubated at room temperature for 60 min; unbound and nonspecific sequences were discarded, 110 μL of ultrapure water was added, and the eluted products were obtained at 95°C for 10 min. The eluted products were subjected to qPCR absolute quantitative analysis, with the concentration of the aptamers added in the experiment as the horizontal axis, in nM, and the absolute quantitative result (i.e., signal response value) as the vertical axis, in nM, for binding and dissociation curve fitting, and the equilibrium dissociation constant of the aptamer, i.e., Kd value, was calculated. Only the values with Kd < 1*10 -8 M and R 2 ≥0.95, and finally 8 nucleic acid aptamers were obtained, and the amino acid sequences were analyzed by sequencing, and then verified by subsequent clinical samples. The specific sequence information is as follows:
[0100] The nucleotide sequence of the nucleic acid aptamer aptamer47-1 is:
[0101] TTCAGCACTCCACGCATAGCATCTGCCTTCCTATTATCGGCGAACAACTCGCACCCAACCTATGCGTGCTACCGTGAA;
[0102] The nucleotide sequence of the nucleic acid aptamer aptamer48-1 is:
[0103] TTCAGCACTCCACGCATAGCATCTGTCTCAACCTATTCAACGGACAATCCGTACCCAACCTATGCGTGCTACCGTGAA;
[0104] The nucleotide sequence of the nucleic acid aptamer aptamer48-2 is:
[0105] TTCAGCACTCCACGCATAGCATCTGTTTCCTGCCCATAACCGAATAACTCGGACCCAACCTATGCGTGCTACCGTGAA;
[0106] The nucleotide sequence of the nucleic acid aptamer aptamer55-2 is:
[0107] TTCAGCACTCCACGCATAGCAGTCATTGGGGTTAGGGTTTGGGTGGGCGAATGTAACTCCTATGCGTGCTACCGTGAA;
[0108] The nucleotide sequence of the nucleic acid aptamer aptamer61-2 is:
[0109] TTCAGCACTCCACGCATAGCAGTCAGTAGCGGTTACGGAAACACTCCTGCACGAGCCTCCTATGCGTGCTACCGTGAA;
[0110] The nucleotide sequence of the nucleic acid aptamer aptamer70-2 is:
[0111] TTCAGCACTCCACGCATAGCCGTACTGTTGTGCGTTTTGGGTTAGGGAGGTGTAGGTCCCTATGCGTGCTACCGTGAA;
[0112] The nucleotide sequence of the nucleic acid aptamer aptamer81-1 is:
[0113] TTCAGCACTCCACGCATAGCCTGCACGTTTGTGGTTTTGGTTGGTAGGGGTACGAGTGCCCTATGCGTGCTACCGTGAA;
[0114] The nucleotide sequence of the nucleic acid aptamer aptamer84-2 is:
[0115] TTCAGCACTCCACGCATAGCACGTCGCTTCGGTCGTGTTGGTTGGTCTGGTTGGTTCTCCTATGCGTGCTACCGTGAA.
[0116] Example 4
[0117] like Figure 7 As shown, a small clinical sample was fitted, and the Graphpad Prism9.5 software was used to statistically analyze the difference in Cq values using the t-test method. The feasibility of the above aptamers for distinguishing the plasma of healthy people and TAO patients was determined by the p value. p < 0.05 was defined as a significant difference.
[0118] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Claims
1. A nucleic acid aptamer for detecting thyroid-related eye diseases, characterized in that: The nucleic acid aptamers are aptamer47-1, aptamer48-1, aptamer48-2, aptamer55-2, aptamer61-2, aptamer70-2, aptamer81-1 and aptamer84-2; The nucleotide sequence of the nucleic acid aptamer aptamer47-1 is the nucleotide sequence shown in SEQ ID NO: 1; The nucleotide sequence of the nucleic acid aptamer aptamer48-1 is the nucleotide sequence shown in SEQ ID NO: 2; The nucleotide sequence of the nucleic acid aptamer aptamer48-2 is the nucleotide sequence shown in SEQ ID NO: 3; The nucleotide sequence of the nucleic acid aptamer aptamer55-2 is the nucleotide sequence shown in SEQ ID NO: 4; The nucleotide sequence of the nucleic acid aptamer aptamer61-2 is the nucleotide sequence shown in SEQ ID NO: 5; The nucleotide sequence of the nucleic acid aptamer aptamer70-2 is the nucleotide sequence shown in SEQ ID NO: 6; The nucleotide sequence of the nucleic acid aptamer aptamer81-1 is the nucleotide sequence shown in SEQ ID NO: 7; The nucleotide sequence of the nucleic acid aptamer aptamer84-2 is the nucleotide sequence shown in SEQ ID NO:
8.
2. A method for preparing a nucleic acid aptamer for detecting thyroid-related eye diseases, characterized in that: The following steps are involved: (1) The positive screening target plasma was mixed in equal proportions and then separated in one dimension and two dimensions. The original mixed blood sample was passed through an immunoaffinity column to remove 14 high-abundance proteins in the blood sample and enrich low-abundance proteins. The sample after immunoremoval was concentrated by ultrafiltration at 4000xg for 3 hours and then injected into a liquid chromatograph for separation. The plasma after homogenization was divided into 96 fractions according to the isoelectric point of the protein, which were collected and stored at -80°C. (2) The protein components in the treated plasma were fixed to the bottom of a 96-well black ELISA plate by covalent linkage and incubated with the screening library. The aptamers bound to the target protein and were enriched at the bottom of the plate. The plate was then washed with a buffer to remove unbound and non-specifically bound sequences. The bound sequences at the bottom of the plate were collected by heat denaturation. Finally, the eluted products were subjected to qPCR to monitor the sequence enrichment trend and PCR amplification to prepare a secondary library for the next round of screening. A total of five rounds of screening were performed. In order to remove aptamers that bound to non-differentially expressed proteins, healthy human inactivated plasma was added to the liquid phase for counter-screening starting from the third round of screening. (3) Firstly, a rough screening is performed using a chemiluminescence method; (4) using qPCR to perform affinity gradient fitting; (5) Clinical sample fitting: The feasibility of the above aptamers for distinguishing the plasma of healthy subjects and TAO patients was determined by analyzing the differences in Cq values.
3. The preparation method according to claim 2, characterized in that: The positive screening target plasma is the plasma of a person who is diagnosed with thyroid-related eye disease for the first time; the negative screening target plasma is the plasma of a healthy person with normal thyroid function.
4. The preparation method according to claim 2, characterized in that: The step (3) is as follows: first, 3ug of plasma sample is taken for overnight plating to fix the plasma protein on the bottom of the well plate; then, the supernatant is removed, and 100μL of 1mg / mL BSA is added for blocking to reduce the adsorption of the sequence by the well plate material; then, the biotin-labeled aptamer is added and incubated at room temperature for 60min to fully enrich the binding sequence, and similarly, an equal amount of biotin-polyA is added to the control group as the background signal of the luminescence experiment; finally, the unbound sequence is washed, and SA-AP and the luminescent substrate are added in sequence to fully react and detect the luminescence value.
5. The preparation method according to claim 4, characterized in that: The luminescence value detection is specifically as follows: the luminescence experiment is divided into 4 stages: (1) Use a single fraction corresponding to the aptamer as the target and retain the sequence with a luminescence value greater than 3 times the background signal; (2) Using homogenized TAO patient mixed plasma as the target, the sequences with luminescence values greater than 2 times the background signal were retained; (3) Using TAO patient mixed plasma as the target, retaining the sequences whose luminescence values are greater than the background signal but less than the luminescence value in (2), and screening to obtain aptamers with significant binding ability to patient plasma; (4) Using the mixed sera of healthy subjects and TAO patients as targets, the aptamers with significantly different luminescence values are retained.
6. The preparation method according to claim 2, characterized in that: The step (4) is specifically as follows: homogenized TAO plasma and mixed TAO plasma are plated and blocked, and 100 μL of aptamer is added respectively and incubated at room temperature; unbound and nonspecific sequences are discarded, 110 μL of ultrapure water is added, and the eluted product is obtained at 95°C for 10 min, and the eluted product is subjected to qPCR absolute quantitative analysis, with the concentration of the aptamer added in the experiment as the horizontal axis, in nM, and the absolute quantitative result (i.e., signal response value) as the vertical axis, in nM, to perform binding and dissociation curve fitting, and calculate the equilibrium dissociation constant of the aptamer, i.e., Kd value, Kd<1*10 -8 M and R 2 The aptamer with a value of ≥0.95 was the final aptamer.
7. The preparation method according to claim 2, characterized in that: The step (5) is specifically as follows: plating plasma samples of healthy persons and TAO patients, incubating with 100 μL of 100 nM aptamer at room temperature to obtain eluted products, performing qPCR detection, and determining the feasibility of the above aptamer for distinguishing the plasma of healthy persons and TAO patients by analyzing the difference in Cq values.
8. Use of the nucleic acid aptamer according to claim 1 in preparing plasma biomarkers for detecting thyroid-related eye diseases.
9. Use of the nucleic acid aptamer according to claim 1 in the preparation of targeted therapy and personalized medicine drugs.