Rice protein oshipp56 related to plant disease resistance and its coding gene and application
By overexpressing OsHIPP56 protein and gene in rice, the unknown function of HIPPs protein in plant disease resistance was solved, and effective resistance to rice blast and bacterial blight was enhanced without affecting rice yield and growth.
Patent Information
- Application Number
- CN202311297985.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-10-09
- Publication Date
- 2025-10-10
- Estimated Expiration
- 2043-10-09
AI Technical Summary
There is limited research on the function of HIPPs proteins in plant immune pathways in the existing technology, and there is an urgent need to analyze their molecular functions through genetic and biochemical methods to clarify their mechanism of action in plant disease resistance.
Provided are the rice protein OsHIPP56 and its encoding gene. By constructing a recombinant vector and expression system, the content and activity of the OsHIPP56 protein or the expression level of the gene are increased, thereby regulating the disease resistance of plants. The specific method includes introducing the recombinant vector into rice and overexpressing the OsHIPP56 gene, and utilizing Agrobacterium-mediated transformation and other technologies.
It significantly enhanced the rice's resistance to rice blast and bacterial blight, and increased the expression of the plant's defense-related genes without affecting the rice's agronomic traits and yield.
Smart Images

Figure HDA0004483626320000011 
Figure HDA0004483626320000012 
Figure HDA0004483626320000013
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of plant genetic engineering, and in particular relates to a rice protein OsHIPP56 related to plant disease resistance, a coding gene thereof, and applications thereof. Background Art
[0002] Rice is one of my country's main staple crops. Safe rice production is crucial to national food security. Diseases are a major factor limiting safe rice production. Rice diseases such as rice blast occur year-round in my country, causing annual yield losses. Identifying plant disease resistance mechanisms and scientifically and rationally utilizing varietal resistance are crucial for controlling rice diseases.
[0003] Heavy metal associated domain (HMA) proteins are also known as metallochaperones. This concept originated from studies of the bacterial CopZ protein and the yeast oxidoreductin (ATX1), and is named for their similar Cys-XX-Cys metal-binding motifs and the first loop of a ferredoxin-like structural fold (βαββαβ) (Robinson and Winge, 2010). HMA proteins are soluble proteins that utilize their structure to transport metal ions, including copper, cadmium, and manganese (Haas et al., 2009; Li et al., 2022; Zhang et al., 2022). Plant HMA proteins are divided into two types based on their structure: heavy metal-associated plant proteins (HPPs) that contain only HMA structures, and heavy metal-associated isoprenylated plant proteins (HIPPs) that contain both HMA structures and isoprenylation motifs (Suzuki et al., 2002; Barth et al., 2009). The isoprenylation motifs in HIPPs are primarily responsible for protein modification or interaction with other proteins. Currently, 22 HPPs and 45 HIPPs have been identified in Arabidopsis and rice, respectively, with 10 HPPs and 59 HIPPs identified (de Abreu-Neto et al., 2013). HIPPs (hybrid protein inhibitors) proteins are conserved in both animals and plants and are involved in plant growth, development, and responses to biotic and abiotic stresses (Tehseen et al., 2010; Freisinger, 2011; de Abreu-Neto et al., 2013; Khan et al., 2019; Zhao et al., 2022). Although several HIPPs genes have been identified in plants, relatively little research has been conducted on their functional characterization, and even less on their involvement in plant immune pathways. Genetic and biochemical analysis of HIPPs is urgently needed to clarify their molecular functions and determine how they participate in plant defense response pathways, thereby providing a basis for understanding the mechanisms of action of HIPPs in plant disease resistance. Summary of the Invention
[0004] In order to solve the above technical problems, the purpose of the present invention is to provide a rice protein OsHIPP56 related to plant disease resistance and its encoding gene and application.
[0005] In a first aspect, the present application provides an application of OsHIPP56 protein in regulating plant disease resistance.
[0006] The OsHIPP56 protein is any one of the following A1), A2), A3) or A4):
[0007] A1) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing;
[0008] A2) a fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of the protein shown in SEQ ID NO: 2 in the sequence listing;
[0009] A3) a protein obtained by substituting and / or deleting and / or adding one or several amino acid residues to the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing and being related to plant disease resistance;
[0010] A4) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology with any one of the amino acid sequences defined in A1) to A3) and being related to plant disease resistance.
[0011] SEQ ID NO: 2 consists of 336 amino acid residues.
[0012] In order to facilitate the purification of the protein in a), a tag shown in Table 1 can be connected to the amino-terminal or carboxyl-terminal end of the protein shown in SEQ ID NO: 2 in the sequence listing.
[0013] Table 1 is the sequence of the tag
[0014] Label residue sequence Poly-Arg 5-6 (usually 5) RRRRR Poly-His 2-10 (usually 6) HHHHHH FLAG 8 DYKDDDDK Strep-tag II 8 WSHPQFEK c-myc 10 EQKLISEEDL
[0015] The protein OsHIPP56 in c) above is obtained by substituting and / or deleting and / or adding not more than 10 amino acid residues.
[0016] The protein OsHIPP56 in c) above can be artificially synthesized or synthesized by first synthesizing its encoding gene and then performing biological expression.
[0017] The encoding gene of the protein OsHIPP56 in c) above can be obtained by deleting the codon of one or several amino acid residues in the DNA sequence shown in SEQ ID NO: 1, and / or performing one or several base pair missense mutations, and / or connecting the encoding sequence of the tag shown in Table 1 to the 5' end and / or 3' end thereof.
[0018] In a second aspect, the present application provides an application of biological material related to OsHIPP56 protein in regulating plant disease resistance:
[0019] The biological material related to the OsHIPP56 protein is any one of the following B1) to B8):
[0020] B1) a nucleic acid molecule encoding an OsHIPP56 protein;
[0021] B2) an expression cassette containing the nucleic acid molecule described in B1);
[0022] B3) a recombinant vector containing the nucleic acid molecule described in B1);
[0023] B4) a recombinant vector containing the expression cassette described in B2);
[0024] B5) a recombinant microorganism containing the nucleic acid molecule described in B1);
[0025] B6) a recombinant microorganism containing the expression cassette described in B2);
[0026] B7) a recombinant microorganism containing the recombinant vector described in B3);
[0027] B8) A recombinant microorganism containing the recombinant vector described in B4).
[0028] In the above application, the nucleic acid molecule in B1) is the gene shown in 1) or 2) or 3) or 4) below:
[0029] 1) Its coding sequence is the DNA molecule shown in SEQ ID NO: 1;
[0030] 2) a DNA molecule derived from rice that has more than 98% homology to the DNA sequence defined in 1) and encodes a plant disease resistance-related protein;
[0031] 3) a DNA molecule that hybridizes with the DNA sequence defined in 1) or 2) under stringent conditions and encodes a plant disease resistance-related protein;
[0032] 4) A DNA molecule that has more than 90% homology with the DNA sequence defined in 1) or 2) and encodes a plant disease resistance-related protein.
[0033] In the above application, the nucleic acid molecule in B1) is the gene shown in 1) or 2) or 3) or 4) below:
[0034] 1) Its coding sequence is the DNA molecule shown in SEQ ID NO: 1;
[0035] 2) a DNA molecule derived from rice that has more than 98% homology to the DNA sequence defined in 1) and encodes a plant disease resistance-related protein;
[0036] 3) a DNA molecule that hybridizes with the DNA sequence defined in 1) or 2) under stringent conditions and encodes a plant disease resistance-related protein;
[0037] 4) A DNA molecule that has more than 90% homology with the DNA sequence defined in 1) or 2) and encodes a plant disease resistance-related protein.
[0038] In the above applications, the nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA. Sequence 1 consists of 1011 nucleotides, and the entire sequence 1 is the coding sequence (ORF) of the OsHIPP56 gene, encoding the protein shown in sequence 2 in the sequence listing.
[0039] Those skilled in the art can readily mutate the nucleotide sequence encoding OsHIPP56 of the present invention using known methods, such as directed evolution and point mutagenesis. Artificially modified nucleotide sequences that share 75% or greater identity with the nucleotide sequence of OsHIPP56 isolated from the present invention are derived from and equivalent to the nucleotide sequence of the present invention, as long as they encode OsHIPP56 and have the same function.
[0040] As used herein, the term "identity" refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or greater, or 85% or greater, or 90% or greater, or 95% or greater identity to the nucleotide sequence of a protein consisting of the amino acid sequence shown in the coding sequence 2 of the present invention. Identity can be evaluated visually or with computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.
[0041] The aforementioned 75% or greater identity may be 80%, 85%, 90% or 95% or greater identity.
[0042] In the above application, the expression cassette containing the nucleic acid molecule encoding OsHIPP56 (OsHIPP56 gene expression cassette) described in B2) refers to DNA capable of expressing OsHIPP56 in a host cell. This DNA may include not only a promoter for initiating transcription of OsHIPP56 but also a terminator for terminating transcription of OsHIPP56. Furthermore, the expression cassette may also include an enhancer sequence. Promoters useful in the present invention include, but are not limited to, constitutive promoters; tissue-, organ-, and development-specific promoters; and inducible promoters. Suitable transcription terminators include, but are not limited to, the Agrobacterium nopaline synthase terminator (NOS terminator), the cauliflower mosaic virus (CaMV) 35S terminator, the tml terminator, the pea rbcS E9 terminator, and the nopaline and octopine synthase terminators.
[0043] The plant recombinant expression vector can be constructed using existing plant expression vectors. The plant expression vector includes a binary Agrobacterium vector and a vector that can be used for microprojectile bombardment, such as pGreen0029, pCAMBIA3301, pCAMBIA1300, pCAMBIA1301, pBI121, pBin19, pCAMBIA2301, pCG1301 or other derived plant expression vectors. The plant expression vector can also include the 3' untranslated region of the foreign gene, i.e., a polyadenylic acid signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylic acid signal can guide polyadenylic acid to be added to the 3' end of the mRNA precursor. When using the gene to construct a recombinant expression vector, any enhancing, constitutive, tissue-specific, or inducible promoter can be added before the transcription initiation nucleotide, such as the cauliflower mosaic virus (CaMV) 35S promoter, the ubiquitin gene Ubiquitin promoter (pUbi), the stress-inducible promoter Rd29A, etc. These can be used alone or in combination with other plant promoters. In addition, when using the gene of the present invention to construct a recombinant expression vector, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be ATG start codons or adjacent start codons, but must be in the same reading frame as the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are diverse and can be natural or synthetic. The translation initiation region can be derived from the transcription initiation region or a structural gene. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as by adding a gene encoding an enzyme that can produce a color change or a luminescent compound that can be expressed in plants, an antibiotic resistance marker, or a chemical resistance marker gene. It is also possible to directly screen transformed plants by using adversity without adding any selection marker genes.
[0044] In the above application, the vector can be a plasmid, cosmid, phage or viral vector. In the present invention, the recombinant vector is specifically a vector obtained by inserting the ubiquitin promoter and OsHIPP56 gene between the Cla I restriction site and the Hind III restriction site of the pCAMBIA1301 vector.
[0045] In the above applications, the microorganism can be yeast, bacteria, algae or fungi, such as Agrobacterium. In the present invention, the Agrobacterium used is specifically EHA105.
[0046] In a third aspect, the present invention provides a use of the OsHIPP56 protein described in the first aspect or the related biological material described in the second aspect in improving plant disease resistance;
[0047] Or, use of the OsHIPP56 protein described in the first aspect or the related biological material described in the second aspect in cultivating plants with high disease resistance;
[0048] Alternatively, the OsHIPP56 protein of the first aspect or the related biological material of the second aspect is used in plant breeding, wherein the purpose of the breeding is to cultivate disease-resistant plant varieties.
[0049] In the above applications, the disease resistance is resistance to rice blast and / or resistance to rice bacterial leaf blight.
[0050] In the above application, the regulation of plant disease resistance is to improve plant disease resistance. The disease resistance may be resistance to rice blast and / or resistance to rice bacterial blight.
[0051] The regulation of plant disease resistance is embodied in that: when the OsHIPP56 protein content and / or activity in the plant is increased or the expression level of the OsHIPP56 gene is increased, the plant's disease resistance is improved; when the OsHIPP56 protein content and / or activity in the plant is decreased or the expression level of the OsHIPP56 gene is decreased, the plant's disease resistance is decreased. When the OsHIPP56 protein content and / or activity in the plant is increased or the expression level of the OsHIPP56 gene is increased, the improved disease resistance of the plant is specifically embodied in the following m1) or m2):
[0052] m1) after inoculation with a pathogen, the length of the lesions on the plant decreases; the pathogen is rice blast fungus (such as rice blast race P007) or bacterial blight fungus (such as rice bacterial blight strain PXO99);
[0053] m2) increasing the expression level of plant defense-related genes, specifically genes PR2 and / or PR8.
[0054] In a fourth aspect, the present invention provides a method for cultivating a transgenic plant with improved disease resistance, comprising the steps of: increasing the content and / or activity of the OsHIPP56 protein described in the first aspect in a recipient plant to obtain a transgenic plant; wherein the transgenic plant has higher disease resistance than the recipient plant;
[0055] Alternatively, the present invention provides a method for cultivating transgenic plants with improved disease resistance, comprising the following steps: increasing the expression of the OsHIPP56 protein encoding gene described in the first aspect in a recipient plant to obtain a transgenic plant; the transgenic plant has higher disease resistance than the recipient plant.
[0056] In the above method, the method for increasing the content and / or activity of the OsHIPP56 protein in the recipient plant is to increase the expression of the gene encoding the OsHIPP56 protein in the recipient plant.
[0057] In the above, the expression of the OsHIPP56 protein encoding gene in the recipient plant is increased by introducing the protein encoding gene into the recipient plant;
[0058] Alternatively, the nucleotide sequence of the gene encoding the protein is the DNA molecule shown in Sequence 1.
[0059] In the above method, introducing the gene encoding the OsHIPP56 protein into the recipient plant involves introducing a recombinant vector carrying the gene encoding the OsHIPP56 protein into the recipient plant. Specifically, this can be achieved by transforming the recipient plant tissue or cells using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, or Agrobacterium-mediated transformation, and then cultivating the transformed plant tissue into a plant. The recombinant vector can be obtained by inserting the ubiquitin promoter and the OsHIPP56 gene between the Cla I and Hind III restriction sites of the pCAMBIA1301 vector.
[0060] In the above methods, the transgenic plants are understood to include not only first-generation transgenic plants obtained by transforming the OsHIPP56 gene into a recipient plant, but also their progeny. Transgenic plants can be propagated within the species in which they are grown, or they can be transferred into other varieties of the same species, particularly commercial varieties, using conventional breeding techniques. Transgenic plants include seeds, callus tissue, whole plants, and cells.
[0061] In the above, the disease resistance is resistance to rice blast and / or resistance to rice bacterial blight.
[0062] The disease resistance of the transgenic plant is higher than that of the recipient plant, as embodied in the following n1) or n2):
[0063] n1) after inoculation with pathogens, the lesions of the transgenic plants are shorter than those of the recipient plants;
[0064] n2) The expression level of defense-related genes in the transgenic plant is higher than that in the recipient plant.
[0065] Furthermore, the pathogen is rice blast fungus (such as rice blast fungus race P007) or bacterial blight fungus (such as rice bacterial blight strain PXO99);
[0066] The defense-related genes are genes PR2 and / or PR8.
[0067] In the above applications or methods, the recipient plant is a monocot or dicot; the monocot can be rice, corn, wheat, etc. In the present invention, the plant is a monocot, the monocot is rice, and the rice variety can specifically be Aichi Asahi.
[0068] In a fifth aspect, the present invention provides the recombinant vector described in the second aspect.
[0069] The present invention cloned the OsHIPP56 gene using PCR technology and performed functional analysis. OsHIPP56-overexpressing plants showed upregulated expression of the OsHIPP56 gene, enhancing resistance to rice blast and bacterial blight compared to wild-type rice without affecting agronomic traits. The increased resistance of OsHIPP56-overexpressing plants to rice blast and bacterial blight has potential applications in increasing plant yield. This invention provides a foundation for molecular breeding using genetic engineering to increase crop yield or enhance plant disease resistance, and has potential applications. BRIEF DESCRIPTION OF THE DRAWINGS
[0070] Figure 1 Figure 2 shows the growth phenotypes of OsHIPP56-overexpressing (OsHIPP56-OE) plants and wild type (WT); A shows the phenotype under field (Beijing) cultivation conditions; the white box represents 10 cm; B shows the relative expression level of the OsHIPP56 gene in OsHIPP56-OE and wild type (WT) detected by real-time quantitative PCR (**: P < 0.01, Student's t test); WT is the wild type.
[0071] Figure 2 Figure 3 is the phenotype of OsHIPP56-OE and wild type (WT) inoculated with pathogens; A is the disease outcome after spray inoculation with rice blast race P007; B is the number of spores in the lesions measured after spray inoculation with rice blast race P007 (data are the average of 6 lesion areas, **: P < 0.01, Student's t test); C is the disease outcome after inoculation with bacterial blight pathogen PXO99; D is the lesion length measured after inoculation with bacterial blight pathogen PXO99 (data are the average of 6 lesion lengths, **: P < 0.01, Student's t test).
[0072] Figure 3 The relative expression levels of two defense genes in OsHIPP56-OE and wild type (WT) were detected by real-time quantitative PCR (**: P < 0.01, Student's t test).
[0073] Figure 4 Comparison results of yield traits between OsHIPP56-OE and wild type (WT); A, number of tillers; B, 1000-grain weight; C, number of grains per ear (ns: P ≥ 0.05, Student's t test).
[0074] Figure 5 The following are the subcellular localization results of OsHIPP56; VirD2NLS is a nuclear marker, and PIP2A is a plasma membrane marker. DETAILED DESCRIPTION
[0075] The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples, unless otherwise specified, are conventional methods. The test materials used in the following examples, unless otherwise specified, were purchased from conventional biochemical reagent stores. The quantitative tests in the following examples were all repeated three times, and the results were averaged.
[0076] The rice blast fungus race P007 in the following examples is described in the document "Physiological races of rice blast fungus and their toxicity (Fan Jinghua, Zhou Huiping, Wang Honghai, et al. Physiological races of rice blast fungus and their toxicity [J]. Plant Protection, 2005, 31(6): 29-31.)" and is available to the public from China Agricultural University. This biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.
[0077] The rice bacterial blight strain PXO99 in the following examples is recorded in the document "Identification and preliminary positioning of a new gene resistant to bacterial blight of small-grain wild rice (Guo Sibin, Zhang Duanpin, Lin Xinghua. Identification and preliminary positioning of a new gene resistant to bacterial blight of small-grain wild rice [J]. Chinese Agricultural Science, 2010, 43(13): 2611-2618.)", which is available to the public from China Agricultural University. The biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.
[0078] Example 1. Obtaining and phenotypic identification of OsHIPP56 gene overexpression (OE) plants
[0079] The gene involved in this example is the OsHIPP56 gene from the rice variety Aichi Asahi, whose nucleotide sequence is Sequence 1 in the sequence listing, encoding the protein (OsHIPP56) shown in Sequence 2 in the sequence listing. Sequence 1 consists of 1011 nucleotides, and Sequence 2 consists of 336 amino acids.
[0080] 1. Acquisition and identification of OsHIPP56-OE plants
[0081] 1. Construction of recombinant expression vector pCAMBIA1301-Ubi-OsHIPP56
[0082] (1) Using the PCR method, primer 5'-ata gagctc GTGCAGCGTGACCCGGT-3' (the underlined part is the Sac I site) and 5'-ata ggatccThe ubiquitin promoter region was amplified using the binary vector pUbiGUSPlus (Purutin Biotechnology (Beijing) Co., Ltd.) using the residue AAGTAACACCAAACAACAGGGT-3' (the underlined portion indicates the Bam HI site). The 1992 bp amplified product was recovered and ligated into the pMD18-T simple (TaKaRa) vector and sequenced. The plasmid verified to be correct by sequencing was digested with Sac I and Bam HI, and the digested product was recovered and ligated into the Sac I and Bam HI sites of the pCAMBIA1301 vector (Purutin Biotechnology (Beijing) Co., Ltd.) to generate pCAMBIA1301-Ubi.
[0083] (2) Using the PCR method, primers OE-HIPP56-F (5'-ATA atcgat ATGGCCTCCGGCTCAGA-3', the underlined part is the Cla I site) and OE-HIPP56-R (5'-TAT aagctt CATCACACTGCAAGAATTAG-3', the underlined portion is the Hind III site), and a 1008 bp open reading frame sequence (SEQ ID NO: 1) of the OsHIPP56 gene was amplified from cDNA of the rice variety Aichi Asahi (obtained by reverse transcription of leaf RNA). The 1008 bp PCR product was recovered and ligated into the pMD-18T vector (TaKaRa). After correct sequencing, it was double-digested with Cla I and Hind III, and the digested product was ligated into the plant expression vector pCAMBIA1301-Ubi in step (1), thereby obtaining the recombinant expression vector pCAMBIA1301-Ubi-OsHIPP56 containing the OsHIPP56 gene.
[0084] The recombinant expression vector pCAMBIA1301-Ubi-OsHIPP56 is obtained by inserting a fragment containing the ubiquitin promoter and the OsHIPP56 gene between the Cla I and Hind III restriction sites of the pCAMBIA1301 vector. In the recombinant expression vector pCAMBIA1301-Ubi-OsHIPP56, the ubiquitin promoter drives the expression of the OsHIPP56 gene.
[0085] In the process of constructing the recombinant expression vector pCAMBIA1301-Ubi-OsHIPP56, the OsHIPP56 gene shown in Sequence 1 in the sequence table can also be artificially synthesized as a template.
[0086] 2. Obtaining OsHIPP56 gene overexpression rice
[0087] The recombinant expression vector pCAMBIA1301-Ubi-OsHIPP56 constructed in step 1 above was introduced into embryonic callus tissue of the rice variety Oryza sativa L. cv. Aichi asahi (hereinafter referred to as wild-type rice) via Agrobacterium EHA105 (Prudin Biotechnology (Beijing) Co., Ltd.) to obtain T0 generation transgenic rice transformed with pCAMBIA1301-Ubi-OsHIPP56. For details on embryonic callus tissue and specific transformation methods, see the article "Yi Zili, Cao Shouyun, Wang Li, Chu Chengcai, Li Xiang, He Shijie, Tang Zuoshun, Zhou Puhua, Tian Wenzhong, Study on Improving the Frequency of Agrobacterium Transformation of Rice," Acta Genetica Sinica, 2001, 28(4): 352-358."
[0088] 3. Identification of OsHIPP56 gene overexpressing rice
[0089] (1) Preliminary PCR identification
[0090] Genomic DNA was extracted from the T0 generation transgenic rice transformed with pCAMBIA1301-Ubi-OsHIPP56 obtained in step 2. The neomycin phosphotransferase gene (HPTII) fragment in the transgenic rice was detected using primers 5'-GCTGCGCCGATGGTTTCTACAA-3' and 5'-CACGGCCTCCAGAAGAAGATGTTG-3'. Rice plants with a 514 bp PCR amplification product were transgenic-positive plants.
[0091] After the above PCR identification, three transgenic positive rice lines transformed with pCAMBIA1301-Ubi-OsHIPP56 were designated as T0 generation OsHIPP56-transgenic rice lines OE-1, OE-7 and OE-9.
[0092] (2) Phenotypic identification of rice OsHIPP56-OE plants
[0093] Seeds of the T0 generation OsHIPP56 transgenic rice lines OE-1, OE-7, and OE-9 were collected, sown, and continuously cultured to obtain T2 generation OsHIPP56 transgenic rice lines, namely, homozygous OsHIPP56-OE plants.
[0094] The phenotypes of homozygous OsHIPP56-OE plants and wild-type Aichi Xu are as follows Figure 1 As shown in A, in the field, OsHIPP56-OE showed normal plant growth on the 125th day after planting, which was no different from the wild type phenotype.
[0095] (3) Transcription level analysis (RNA expression)
[0096] Fluorescence quantitative PCR analysis was performed using the T0 generation OsHIPP56-transgenic rice lines OE-1, OE-7, and OE-9 obtained above and the wild-type rice Aichi Asahi as materials. The expression of the OsHIPP56 gene in OsHIPP56-OE and the wild-type rice Aichi Asahi was analyzed by fluorescence quantitative PCR. The primers for amplifying the OsHIPP56 gene were qRT-OsHIPP56-F and qRT-OsHIPP56-R listed in Table 1; the ACTIN1 gene was used as an internal reference, and the amplification primers were qRT-OsRAc1-F and qRT-OsRAc1-R listed in Table 1. The specific steps are as follows: fully expanded leaves from the same part of OsHIPP56-OE and wild-type rice Aichi Asahi were taken, and the total RNA was extracted using the Trizol reagent method (Invitrogen), and reverse transcription was performed using MMLV reverse transcriptase (TaKaRa) according to the corresponding usage method. Then, real-time fluorescence quantitative PCR technology was used. According to the usage method provided by the manufacturer (TaKaRa), SYBR green I fluorescent dye was added to the PCR system, and the expression of the OsHIPP56 gene was detected in a fluorescence quantitative PCR instrument (ABI 7500, USA). The primer sequences are shown in Table 2. The experiment was repeated three times. The comparative Ct method was used for data processing, that is, the Ct value is the number of cycles experienced when the fluorescence signal in the PCR tube reaches the set threshold, ΔCt = Ct (test gene) - Ct (ACTIN1), with 2 -ΔCt The values were used to measure gene transcription levels, and a comparative analysis was performed between the measured genes in OsHIPP56-OE and wild-type rice.
[0097] Table 2 shows the primer sequences for ACTIN1 and OsHIPP56 genes
[0098] Gene name Locus ID Primer name Sequence of items ACTIN1 LOC_Os03g50885 qRT-OsRAc1-F ATCACTGCCTTGGCTCCTA qRT-OsRAc1-R CATCTGCTGGAATGTGCTG OsHIPP56 LOC_Os01g70710 qRT-OsHIPP56-F CTTGTGCTGAGGGTGTCCAT qRT-OsHIPP56-R GGCCGTGACTATGACCTTGT
[0099] The results of real-time fluorescence quantitative PCR of OsHIPP56 gene in each test material are as follows: Figure 1 As shown in Figure B, it can be seen that compared with the non-transgenic wild-type rice Aichi Asahi, the transcription levels of the OsHIPP56 gene in the T0 generation OsHIPP56 transgenic rice lines OE-1, OE-7 and OE-9 obtained by the present invention are significantly improved.
[0100] 4. Inoculation test
[0101] (1) OsHIPP56-OE and wild-type rice Aichixu leaves were spray-inoculated in vitro with Magnaporthe oryzae race P007. The specific steps were carried out according to the method in the literature "Fang, W., Liu, C., Zhang, H. et al. Selection of differential isolates of Magnaporthe oryzae for postulation of blast resistance genes. Phytopathology, 2018, 108: 878-884."
[0102] The results are as follows Figure 2 As shown in A and 2B, it can be seen that 120 hours after spray inoculation, the lesion area of OsHIPP56-OE was significantly smaller than that of the wild type, indicating that the resistance of OsHIPP56-OE to rice blast fungus was significantly enhanced.
[0103] (2) OsHIPP56-OE and wild-type rice leaves were inoculated with the rice bacterial blight strain PXO99. The specific steps were carried out according to the method in the literature "Zhao, XS; Qiu, TC; Feng, HJ et al. A novel glycine-rich domain protein, GRDP1, functions as a critical feedback regulator for controlling cell death and disease resistance in rice. Journal of Experimental Botany, 2021, 72, 608–622."
[0104] The results are as follows Figure 2 As shown in C and 2D, it can be seen that 2 weeks after inoculation, the lesion length of OsHIPP56-OE was significantly smaller than that of the wild type, indicating that the resistance of OsHIPP56-OE to bacterial blight pathogen was significantly enhanced.
[0105] 5. Detection of defense gene expression
[0106] Fluorescence quantitative PCR was used to analyze the expression of defense-related genes PR2 and PR8 in OsHIPP56-OE and wild-type rice, using the rice ACTIN1 gene as an internal reference. The primer sequences are shown in Table 3. The detection method and data processing were the same as those in step 1, step 3, of Example 1.
[0107] Table 3 shows the primer sequences for ACTIN1 and defense genes
[0108] Gene name Locus ID Primer name Sequence of items ACTIN1 LOC_Os03g50885 qRT-OsRAc1-F ATCACTGCCTTGGCTCCTA qRT-OsRAc1-R CATCTGCTGGAATGTGCTG PR2 LOC_Os01g71340 qRT-PR2-F CTGGCATTGGTCCTTGGAGTT qRT-PR2-R CGATGCCGTTGGACTTGTAG PR8 LOC_Os10g28080 qRT-PR8-F TTCATCTGGTCAGCGGATAGC qRT-PR8-R TATCACGACCGTTCGATGGA
[0109] The results are as follows Figure 3 As shown, A is the defense gene PR2, and B is the defense gene PR8; both defense genes PR2 and PR8 in OsHIPP56-OE showed significant up-regulated expression.
[0110] 2. Yield Trait Identification of Rice OsHIPP56-OE Plants
[0111] Seeds of T2-generation transgenic OsHIPP56 rice lines (homozygous OsHIPP56-OE plants) OE-1, OE-7, and OE-9 were sown in the field. After 160 days of growth, uniform and healthy growth was determined in the field. Statistical data included tiller number, 1000-grain weight, and number of plump grains per panicle. Each measurement was replicated three times. Wild-type rice (WT) served as the control.
[0112] The results are as follows Figure 4 As shown, the yield traits of the OsHIPP56-OE plants (denoted as OsHIPP56-OE 1, OsHIPP56-OE 7, and OsHIPP56-OE 9 in the figure) were not significantly different from those of the wild-type rice strain Aichi Asahi. This indicates that the OsHIPP56-overexpressing rice lines OE-1, OE-7, and OE-9 obtained by the present invention have enhanced disease resistance without compromising their yield.
[0113] Example 2: Subcellular localization of OsHIPP56 protein
[0114] 1. Using PCR method, HIPP56-GFP-F (5'-ata ggtacc ATGGCCTCCGGCTCAGA-3', the underlined part is the Kpn I site) was used as the forward primer, and HIPP56-GFP-R (5'-aat tctaga ATCACACTGCAAGAATTAG-3', the underlined part is the Xba I site) was used as the reverse primer to amplify the partial open reading frame sequence of the OsHIPP56 gene from the cDNA of the rice variety Aichi Asahi.
[0115] 2. The PCR product obtained in step 1 was recovered and ligated into the pMD-18T vector (TaKaRa). After correct sequencing, the product was double-digested with Kpn I and Xba I. The digested product was then ligated into the plant subcellular localization expression vector pCG1301 (Prudin Biotechnology (Beijing) Co., Ltd.), resulting in the recombinant expression vector pCG1301-OsHIPP56-GFP containing the OsHIPP56 gene. The structure of the recombinant expression vector pCG1301-OsHIPP56-GFP is described as follows: the DNA molecule represented by positions 1-1008 of SEQ ID NO: 1 in the sequence listing was inserted between the multiple cloning sites Kpn I and Xba I of the pCG1301 vector. In the recombinant expression vector pCG1301-OsHIPP56-GFP, the 35S promoter drives expression of the OsHIPP56 gene.
[0116] 3. According to the methods in the literature "Li, X., 2011, Infiltration of Nicotiana benthamiana Protocol for Transient Expression via Agrobacterium. Bio-protocol Bio101: e95. DOI: 10.21769 / BioProtoc.95" and the literature "Wang, K., Liu, Y. and Li, S., 2013, Bimolecular Fluorescence Complementation (BIFC) Protocol for Rice Protoplast Transformation. Bio-protocol 3(22): e979. DOI: 10.21769 / BioProtoc.979.", the recombinant expression vector pCG1301-OsHIPP56-GFP (denoted as OsHIPP56-GFP in the figure) was transformed into Aichi Asahi rice protoplasts, and the localization of OsHIPP56 protein was observed under a laser confocal microscope.
[0117] The results are as follows Figure 5 As shown in the figure, it can be seen that OsHIPP56 protein is localized in the nucleus and cytoplasm in rice protoplasts.
[0118] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the technical principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.
Claims
1. Application of OsHIPP56 protein in regulating rice disease resistance; The OsHIPP56 protein is the protein shown in either A1) or A2) below: A1) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing; A2) A fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of the protein shown in Sequence 2 in the sequence listing; The disease resistance is resistance to rice blast and / or resistance to rice bacterial blight.
2. Application of OsHIPP56 protein-related biomaterials in regulating rice disease resistance: The biological material related to the OsHIPP56 protein is any one of the following B1) to B8): B1) Nucleic acid molecule encoding OsHIPP56 protein; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1); B4) a recombinant vector containing the expression cassette described in B2); B5) a recombinant microorganism containing the nucleic acid molecule described in B1); B6) a recombinant microorganism containing the expression cassette described in B2); B7) a recombinant microorganism containing the recombinant vector described in B3); B8) a recombinant microorganism containing the recombinant vector described in B4); The disease resistance is resistance to rice blast and / or resistance to rice bacterial blight.
3. The use according to claim 2, characterized in that: B1) The nucleic acid molecule is the gene shown in 1) or 2) or 3) or 4) below: 1) Its coding sequence is the DNA molecule shown in Sequence 1; 2) a DNA molecule derived from rice that has more than 98% homology to the DNA sequence defined in 1) and encodes the OsHIPP56 of claim 1; 3) a DNA molecule that hybridizes with the DNA sequence defined in 1) or 2) under stringent conditions and encodes the OsHIPP56 of claim 1; 4) A DNA molecule encoding the OsHIPP56 of claim 1, which has a homology of 90% or more to the DNA sequence defined in 1) or 2).
4. Use of the OsHIPP56 protein of claim 1 or the related biological material of claim 2 or 3 in improving disease resistance of rice; Or, use of the OsHIPP56 protein of claim 1 or the related biological material of claim 2 or 3 in cultivating rice with high disease resistance; Or, use of the OsHIPP56 protein of claim 1 or the related biological material of claim 2 or 3 in breeding disease-resistant rice; The disease resistance is resistance to rice blast and / or resistance to rice bacterial blight.
5. A method for cultivating transgenic plants with enhanced disease resistance, comprising the steps of: increasing the content and / or activity of the OsHIPP56 protein of claim 1 in a recipient plant to obtain a transgenic plant; wherein the transgenic plant has enhanced disease resistance compared to the recipient plant; Alternatively, a method for cultivating a transgenic plant with improved disease resistance, comprising the steps of: increasing the expression of the gene encoding the OsHIPP56 protein of claim 1 in a recipient plant to obtain a transgenic plant; wherein the transgenic plant has higher disease resistance than the recipient plant; The plant is rice; The disease resistance is resistance to rice blast and / or resistance to rice bacterial blight.
6. The method according to claim 5, characterized in that: The method for increasing the content and / or activity of the OsHIPP56 protein in the recipient plant is to increase the expression of the OsHIPP56 protein encoding gene in the recipient plant.
Citation Information
Patent Citations
OsHAP2C (oryza sativa heme activator protein 2C) and application of encoding genes thereof to regulating rice bacterial leaf blight resistance
CN109400688A
Rice mitochondrial protein OsNBL3 related to plant disease resistance as well as encoding gene and application thereof
CN113913455A