Application of oshtt6 protein in regulating tolerance to high temperature stress and yield in rice

Abstract

The application discloses application of OsHTT6 protein in regulating high-temperature stress tolerance and yield of rice. The application finds that inhibiting expression of the OsHTT6 protein can improve the high-temperature stress tolerance of rice, improve the survival rate of rice seedlings after suffering high-temperature stress, and improve the single-plant yield of rice by constructing an OsHTT6 protein function loss mutant rice strain and an OsHTT6 protein overexpression transgenic rice strain; and overexpression of the OsHTT6 protein can reduce the high-temperature stress tolerance of rice, and reduce the single-plant yield of rice. That is, the high-temperature stress tolerance of rice and the yield of rice can be regulated by regulating expression of the OsHTT6 protein; a reagent capable of inhibiting expression of the OsHTT6 protein can be used to improve the high-temperature stress tolerance and yield of rice, or a heat-resistant and high-yield rice plant can be constructed. The application is favorable for cultivation of heat-resistant and high-yield rice varieties.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of genetic engineering. More specifically, it relates to the application of OsHTT6 protein in regulating the tolerance of rice to high temperature stress and yield. BACKGROUND

[0002] With the intensification of global climate change, the frequency of extreme climate events has increased significantly. High temperature stress has become one of the important factors that seriously affect agricultural production. It has been reported that for every 1℃ increase in average temperature, rice production will decrease by about 3%. In addition to causing a decrease in rice production, high temperature stress also seriously reduces rice quality. Therefore, it is urgent to breed heat-resistant rice varieties to cope with extreme climate events, reduce the impact of high temperature stress on crop growth, and ensure grain yield and quality.

[0003] Currently, the tolerance of rice to high temperature stress is mainly improved through agronomic management measures and breeding based on seed setting rate selection and other agronomic traits. Although some genes related to the tolerance of rice to high temperature stress have been reported, the molecular mechanism of rice response to high temperature stress is still poorly understood, and the genetic improvement of the tolerance of rice to high temperature stress in actual breeding is slow. Therefore, it is still necessary to continuously explore genes related to the tolerance of rice to high temperature stress in order to facilitate the breeding of rice varieties with high tolerance to high temperature stress. SUMMARY

[0004] The present application provides the application of OsHTT6 protein in regulating the tolerance of rice to high temperature stress and yield.

[0005] The first object of the present application is to provide the application of OsHTT6 protein or gene encoding OsHTT6 protein in regulating the tolerance of rice to high temperature stress.

[0006] The second object of the present application is to provide the application of OsHTT6 protein or gene encoding OsHTT6 protein in regulating the yield of rice.

[0007] The third object of the present application is to provide a method for improving the tolerance of rice to high temperature stress and / or yield.

[0008] The fourth object of the present application is to provide the application of an agent inhibiting the expression of OsHTT6 protein in improving the tolerance of rice to high temperature stress or in preparing a product for improving the tolerance of rice to high temperature stress.

[0009] The fifth object of the present application is to provide the application of an agent inhibiting the expression of OsHTT6 protein in breeding rice plants with improved tolerance to high temperature stress.

[0010] A sixth object of the present application is to provide use of an agent inhibiting expression of OsHTT6 protein in improving yield of rice or in preparing a product for improving yield of rice.

[0011] A seventh object of the present application is to provide use of an agent inhibiting expression of OsHTT6 protein in breeding rice plants with improved yield.

[0012] The above objects of the present application are achieved by the following technical solutions.

[0013] The present application finds that inhibiting expression of OsHTT6 protein can improve tolerance of rice to high-temperature stress, improve survival rate of rice seedlings after suffering high-temperature stress, and further improve primary branch number, average effective tiller number, average seed setting rate and yield per plant of rice, thereby improving yield of rice, while overexpression of OsHTT6 protein can reduce tolerance of rice to high-temperature stress, reduce primary branch number, average effective tiller number, average seed setting rate and yield per plant of rice, indicating that expression of OsHTT6 protein can be regulated to regulate tolerance of rice to high-temperature stress and yield of rice.

[0014] Therefore, the present application claims use of OsHTT6 protein or a gene encoding OsHTT6 protein in regulating tolerance of rice to high-temperature stress.

[0015] The present application also claims use of OsHTT6 protein or a gene encoding OsHTT6 protein in regulating yield of rice.

[0016] Specifically, the amino acid sequence of the OsHTT6 protein is shown in SEQ ID NO. 3.

[0017] In specific embodiments of the present application, the nucleotide sequence of the gene encoding OsHTT6 protein is shown in SEQ ID NO. 2.

[0018] The present application also provides a method for improving tolerance of rice to high-temperature stress and / or yield, which comprises inhibiting expression of OsHTT6 protein in rice.

[0019] Specifically, expression of the gene encoding OsHTT6 protein is interfered, or coding region or promoter of the gene encoding OsHTT6 protein is mutated or knocked out to inhibit expression of OsHTT6 protein in rice.

[0020] More specifically, the expression of the gene encoding the OsHTT6 protein is interfered by RNA interference technology; or the coding region or promoter of the gene encoding the OsHTT6 protein is mutated by a gene editing system; or the expression of the OsHTT6 protein in rice is inhibited by knocking out the gene sequence encoding the OsHTT6 protein through homologous recombination.

[0021] Specifically, the mutation includes insertion, deletion or base conversion of a base.

[0022] In specific embodiments of the present application, the nucleotide sequence of the gene encoding the OsHTT6 protein is shown in SEQ ID NO. 2; and the promoter sequence of the gene is shown in SEQ ID NO. 1.

[0023] Optionally, the gene editing system is a CRISPR / Cas9-based gene editing system.

[0024] In specific embodiments of the present application, the expression of the OsHTT6 protein in rice is inhibited by mutating the gene encoding the OsHTT6 protein.

[0025] Specifically, the method for inhibiting the expression of the OsHTT6 protein in rice is as follows: designing a sgRNA sequence based on CRISPR / Cas9 for the gene (or target sequence) encoding the OsHTT6 protein, connecting a DNA fragment containing the sgRNA sequence to a pCRISPR / Cas9 vector carrying a Cas9 expression cassette and transforming rice callus, achieving site-directed mutation of the gene encoding the OsHTT6 protein, and then making the OsHTT6 protein lose function.

[0026] Specifically, the target sequence recognized by the sgRNA conforms to the sequence rule of 5'-N X -NGG-3' or 5'-N X -NTT-3'; wherein N represents any one of A, T, C and G, x is an integer between 17 and 20, and N X represents X 17 to 20 continuous deoxyribonucleotides.

[0027] As one of the optional embodiments, the nucleotide sequence of the target site recognized by the sgRNA is shown in SEQ ID NO. 4.

[0028] Specifically, the present application obtains the OsHTT6 protein function loss mutant strain by mutating the gene encoding the OsHTT6 protein in rice, including the following steps:

[0029] S1. Designing sgRNA target sequence and linker primer;

[0030] S2. Constructing sgRNA vector containing target sequence fragment: synthesizing adaptor primer, annealing the adaptor primer after denaturation, and then cooling to room temperature to complete annealing; connecting the annealed primer to the sgRNA vector after enzyme digestion, and then performing PCR amplification and sequencing to verify positive plasmid;

[0031] S3. Constructing pCRISPR / Cas9 vector containing target sequence fragment: cutting the gRNA expression cassette containing the target sequence fragment from the gRNA, and then connecting the gRNA expression cassette to the pCRISPR / Cas9 vector containing the Cas9 expression cassette;

[0032] S4. Transformation: transforming the pCRISPR / Cas9 vector containing the target into rice callus, and then performing screening, differentiation and rooting to form seedlings, and identifying positive transgenic plants;

[0033] S5. Identifying mutation site: extracting DNA of the positive plants, designing identification primers to amplify the extracted DNA, purifying the amplified DNA, and then performing sequencing to analyze mutation.

[0034] Specifically, when the target sequence is the nucleotide sequence shown in SEQ ID NO. 4, the nucleotide sequences of the designed adaptor primers are shown in SEQ ID NO. 5 and SEQ ID NO. 6.

[0035] Specifically, the nucleotide sequences of the primer pairs used for identifying the mutation site are shown in SEQ ID NO. 7 and SEQ ID NO. 8.

[0036] Specifically, the rice is indica rice.

[0037] More specifically, the rice is indica rice variety Nanguizhan.

[0038] In view of the fact that inhibiting the OsHTT6 protein can improve the tolerance of rice to high-temperature stress and yield, the application also claims the use of a reagent for inhibiting the expression of the OsHTT6 protein in improving the tolerance of rice to high-temperature stress or in preparing a product for improving the tolerance of rice to high-temperature stress.

[0039] The application also claims the use of a reagent for inhibiting the expression of the OsHTT6 protein in cultivating rice plants with improved tolerance to high-temperature stress.

[0040] Specifically, the improved tolerance of rice to high-temperature stress is improved tolerance of rice to high-temperature stress at the seedling stage.

[0041] The application also claims the use of a reagent for inhibiting the expression of the OsHTT6 protein in improving the yield of rice or in preparing a product for improving the yield of rice.

[0042] The application also claims the use of the agent for inhibiting the expression of OsHTT6 protein in cultivating rice plants with improved yield.

[0043] Specifically, the agent improves the yield of rice by increasing the number of primary branches, the average effective tiller number, the average seed setting rate and / or the yield per plant of rice.

[0044] Specifically, the agent for inhibiting the expression of OsHTT6 protein includes an agent for interfering with the expression of a gene encoding OsHTT6 protein or a vector for mutating or knocking out the gene encoding OsHTT6 protein.

[0045] The application has the following beneficial effects:

[0046] The application finds that inhibiting the expression of OsHTT6 protein can improve the tolerance of rice to high temperature stress, improve the survival rate of rice seedlings after suffering from high temperature stress, and further improve the number of primary branches, the average effective tiller number, the average seed setting rate and the yield per plant of rice, while overexpression of OsHTT6 protein can reduce the tolerance of rice to high temperature stress, reduce the number of primary branches, the average effective tiller number, the average seed setting rate and the yield per plant of rice. That is, by regulating the expression of OsHTT6 protein, the tolerance of rice to high temperature stress and its yield can be regulated, and the agent for inhibiting the expression of OsHTT6 protein can be used to improve the tolerance of rice to high temperature stress and its yield, or to construct rice plants that are heat-resistant and high-yield. The application is conducive to the cultivation of heat-resistant and high-yield rice varieties. BRIEF DESCRIPTION OF DRAWINGS

[0047] Figure 1 The expression of OsHTT6 gene in OsHTT6 mutant lines, overexpression transgenic lines and wild type Nanguizhan; in the figure, *** p<0.001, all compared with the wild type.

[0048] Figure 2 The phenotype of OsHTT6 mutant lines, overexpression transgenic lines and wild type Nanguizhan before and after high temperature stress treatment.

[0049] Figure 3 The chlorophyll fluorescence imaging of OsHTT6 mutant lines, overexpression transgenic lines and wild type Nanguizhan before and after high temperature stress treatment.

[0050] Figure 4 The Fv / Fm, survival rate, ion leakage rate and plant height detection results of OsHTT6 mutant lines, overexpression transgenic lines and wild type Nanguizhan before and after high temperature stress treatment, shown in A-D in the figure in turn; in the figure, *** p<0.001, all compared with the wild type.

[0051] Figure 5 The yield trait detection results of the OsHTT6 mutant strain, the overexpression transgenic strain and the wild type Nanguizhan; the detection results of single plant yield, first order branch number, average effective tiller number and average seed setting rate are shown as A to D in the figure respectively; *p<0.05; ***p<0.001, all compared with the wild type. DETAILED DESCRIPTION

[0052] The present application will be further described below in conjunction with the drawings and specific examples, but the examples do not limit the present application in any form. Unless otherwise specified, the reagents, methods and equipment used in the present application are conventional reagents, methods and equipment in the technical field.

[0053] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0054] The nucleotide sequence of the promoter of the OsHTT6 gene in the embodiments of the present application is shown as SEQ ID NO. 1; the nucleotide sequence of the OsHTT6 gene (gDNA) is shown as SEQ ID NO. 2, and the amino acid sequence of the OsHTT6 protein encoded thereby is shown as SEQ ID NO. 3.

[0055] Example 1: Obtaining of the OsHTT6 protein function loss mutant rice strain

[0056] The present application utilizes the CRISPR / Cas9 technology to mutate the OsHTT6 gene, and obtains the OsHTT6 gene mutant strain, i.e. the OsHTT6 protein function loss mutant strain htt6-1 and htt6-2.

[0057] The process for obtaining the mutant strain is as follows:

[0058] 1. Design of sgRNA target sequence and linker primer

[0059] The target sequence is designed based on the OsHTT6 gene (the nucleotide sequence of the gene is shown as SEQ ID NO. 2) by using the targetDesign program (http: / / skl.scau.edu.cn / targetdesign / ), and the method is described in the reference (DOI: http: / / dx.doi.org / 10.1016 / j.molp.2017.06.004).

[0060] The sgRNA target sequence (5'→3') designed in this example is as follows:

[0061] Target-HTT6-U6: CTGGTGGTTAACATACCAGG (as shown in SEQ ID NO. 4)

[0062] The linker primers with sticky ends designed on the basis of the sgRNA target sequence (5'→3') are as follows:

[0063] Target-HTT6-U6F: ggcaCTGGTGGTTAACATACCAGG (as shown in SEQ ID NO. 5)

[0064] Target-HTT6-U6R: aaacCCTGGTATGTTAACCACCAG (as shown in SEQ ID NO. 6)

[0065] 2. Construction of pU6-gRNA vector containing Target-HTT6 fragment

[0066] The linker primers Target-HTT6-U6F / R with sticky ends described above were synthesized by Beijing Qianke Biotechnology Co., Ltd. After denaturation at 90°C for 30 s, the synthesized linker primers were cooled to room temperature to complete annealing, and then the annealed primers were ligated to the enzyme-digested pU6-gRNA vector. After PCR amplification and sequencing verification, the pU6-gRNA vector containing the Target-HTT6-U6 fragment was obtained.

[0067] The PCR primers used for PCR verification were Target-HTT6-U6F / Target-HTT6-U6R.

[0068] 3. Construction of pCRISPR / Cas9 vector containing Target-HTT6-U6 fragment

[0069] The expression cassette of the Target-HTT6-U6 fragment was cut from the pU6-gRNA vector containing the Target-HTT6-U6 fragment constructed above, and was ligated to the pCRISPR / Cas9 vector containing the Cas9 expression cassette. After PCR amplification and sequencing verification, the pCRISPR / Cas9 vector containing the Target-HTT6-U6 fragment was obtained.

[0070] 4. Screening of mutant lines

[0071] The pCRISPR / Cas9 vector containing the Target-HTT6-U6 fragment constructed was transformed into callus of rice indica variety Nanguizhan by Agrobacterium-mediated genetic transformation method. After secondary screening, differentiation and rooting, the obtained plants were planted in a net house, and positive mutant lines were screened for sequencing identification.

[0072] 5. Sequencing identification of mutation sites of mutant lines

[0073] Genomic DNA (gDNA) of the positive mutant line was extracted, and used as a template to perform PCR amplification with primers (5'→3') HTT6TF (TCGTGTTTTGTTGCGACCTG, as shown in SEQ ID NO. 7) and HTT6TR (CCTGGTATGTTAACCACCAG, as shown in SEQ ID NO. 8), and the amplified product was purified and sent to Beijing Genesee Biotech Co., Ltd. for sequencing. The sequencing results were compared with the target sequence of the wild type Nanguizhan plant before mutation, and the mutation was analyzed.

[0074] The reaction system used for PCR amplification was as follows: 1 μL of template gDNA, 1 μL of each of primers HTT6TF and HTT6R, 10 μL of 2 × Taq Mix, and ddH2O to make up 20 μL; and the reaction conditions used for PCR amplification were as follows: 94 ℃ for 2 min; 94 ℃ for 20 sec, 58 ℃ for 20 sec, 72 ℃ for 30 sec, 30 cycles; and 72 ℃ for 5 min.

[0075] Through sequencing identification, the mutation of the OsHTT6 gene mutant lines htt6-1 and htt6-2 obtained in the embodiment was as follows:

[0076] WT: AGAAGGATCTGTTCCACCTGGTATGTTAACCACCAG

[0077] htt6-1: AGAAGGATCTGTTCCACCTG-TATGTTAACCACCAG

[0078] htt6-2: AGAAGGATCTGTTCCACCT------TTAACCACCAG

[0079] Among them, WT represents the wild type; htt6-1 and htt6-2 represent different mutant lines; and "-" in the sequence represents base deletion. It can be known through comparison that the target sequence of the mutant line obtained in the embodiment has one or more base deletions compared with the wild type, indicating that the OsHTT6 gene is successfully mutated, and the corresponding mutant line is obtained.

[0080] Example 2: Obtaining of OsHTT6 protein overexpression transgenic rice lines

[0081] 1. Obtaining of overexpression transgenic rice lines

[0082] In this embodiment, the overexpression recombinant vector of OsHTT6 gene was transformed into callus of wild type indica rice variety Nanguizhan by Agrobacterium EHA105 mediated genetic transformation method, and the overexpression transgenic rice lines were constructed. The method was described in the reference (Zhou L Y, Jiang D G, Wu H, et al. Establishment of rice transformation system based on TAC vector [J]. Acta Genetica Sinica, 2005, 32(005): 514-518.).

[0083] After screening, pre-differentiation and differentiation, TO generation transformed plants were obtained and PCR and fluorescent quantitative PCR detection were performed to determine whether they were positive transformed plants. The obtained positive transformed plants were selfed to obtain transgenic 1 (T1) generation lines. Ten plants in each line which were positive by PCR detection were selfed to obtain T2 generation lines. T2 generation lines were subjected to PCR detection again to obtain two T2 generation homozygous lines derived from different TO generation plants, which were named as OEHTT6-1 and OEHTT6-2, respectively.

[0084] 2. Detection of expression amount of OsHTT6

[0085] The total RNA of flag leaves at flowering stage of wild type Nanguizhan, OsHTT6 mutant lines htt6-1 and htt6-2, and overexpression transgenic lines OEHTT6-1 and OEHTT6-2 were extracted and reverse transcribed into cDNA. The obtained cDNA was used as a template for qPCR reaction to detect the expression amount change of target gene OsHTT6, and the internal reference was Actin.

[0086] The primers used in qPCR reaction were as follows:

[0087] qPCR primer F: TCAACGAGCTCTTCGCTCTG

[0088] qPCR primer R: ATGTACGGCACCACCACATC

[0089] Internal reference primer F: CACATTCCAGCAGATGTGGA

[0090] Internal reference primer R: GCGATAACAGCTCCTCTTGG

[0091] The reaction system used in qPCR reaction was as follows: template cDNA 2 μL, primer F / primer R 0.5 μL each, 2×SYBR GREEN Master Mix 10 μL, DEPC water 20 μL; the reaction condition used in qPCR reaction was as follows: 95 ℃ 3 min; 95 ℃ 5 sec, 58 ℃ 10 sec, 72 ℃ 15 sec.

[0092] The expression of the OsHTT6 gene in OsHTT6 mutant lines, overexpressing transgenic lines, and wild-type Nanguizhanzhong is as follows: Figure 1 As shown. By Figure 1 It can be seen that the OsHTT6 gene is highly expressed in the overexpression transgenic lines OEHTT6-1 and OEHTT6-2, and lowly expressed in the mutant lines htt6-1 and htt6-2 (significantly lower than the wild type). This low expression is only observed because the OsHTT6 gene expression level in the overexpression transgenic lines is excessively high. Figure 1 (Not obvious), indicating that the present invention has successfully constructed the OsHTT6 mutant line and the OsHTT6 overexpression transgenic line.

[0093] Example 3: Tests on the tolerance of mutant lines and overexpression transgenic lines to high temperature stress.

[0094] In this embodiment, the wild-type Nanguizhan, the mutant lines htt6-1 and htt6-2 identified in Examples 1 and 2, and the overexpressing transgenic lines OEHTT6-1 and OEHTT6-2 were subjected to high-temperature stress treatment. The phenotypic changes of the plants before high-temperature treatment, 3 days after high-temperature treatment, and 7 days after recovery at normal temperature were compared. The effects of the mutant or overexpressing OsHTT6 gene on the high-temperature stress tolerance of rice were observed by detecting the Fv / Fm, survival rate, ion leakage, and plant height after high-temperature stress treatment.

[0095] The high-temperature stress treatment process is as follows:

[0096] Several plump seeds of wild-type Nan Guizhan (WT), mutant lines htt6-1 and htt6-2, and overexpression transgenic lines OEHTT6-1 and OEHTT6-2 were selected, soaked in water, and then transferred to 96-well plates for hydroponics after germination. After 14 days of growth, seedlings with uniform growth were selected for high-temperature stress treatment. The high-temperature stress treatment conditions were: 45℃, 12h light / 12h dark, and the high-temperature stress treatment time was 7 days. After high-temperature stress treatment, the seedlings were placed at 28℃ to recover for 7 days.

[0097] Determination of ion leakage rate (R1 / R2): Add 10 mL of sterile ddH2O to a 15 mL sterile centrifuge tube. Cut 0.05 g of leaves from rice seedlings of similar size into small pieces and place them in the 15 mL centrifuge tube, ensuring the leaves are completely immersed. Shake at 100 rpm overnight at room temperature. After overnight incubation, invert the 15 mL centrifuge tube to mix thoroughly, and then measure the value R1 using a conductivity meter. After obtaining the value R1, boil the 15 mL centrifuge tube in boiling water for 15 minutes. After naturally cooling to room temperature, perform a second measurement using a conductivity meter to obtain the value R2. The ratio of R1 to R2 is the ion leakage rate.

[0098] The phenotypes of the OsHTT6 mutant lines, overexpression transgenic lines and wild type Nanguizhan before and after high temperature stress treatment are shown in Figure 2 As can be seen from Figure 2 , after 3 days of high temperature treatment and 7 days of normal temperature recovery, the leaf of the htt6-1 and htt6-2 mutant lines did not wither and die after high temperature stress treatment, while the wild type control and overexpression transgenic lines all showed high temperature intolerance.

[0099] The chlorophyll fluorescence imaging of the OsHTT6 mutant lines, overexpression transgenic lines and wild type Nanguizhan before and after high temperature stress treatment is shown in Figure 3 The Fv / Fm, survival rate, ion leakage rate and plant height detection results of the OsHTT6 mutant lines, overexpression transgenic lines and wild type Nanguizhan before and after high temperature stress treatment are shown in A-D of Figure 4 As can be known from A of Figure 3 and Figure 4 , compared with the wild type control, the Fv / Fm of the OsHTT6 overexpression transgenic lines significantly decreased after high temperature stress treatment, indicating that it was not heat tolerant. As can be known from Figure 4 , compared with the wild type control, the survival rate of the htt6-1 and htt6-2 mutant lines significantly increased (p<0.001) by 13.5% and 10.4% respectively, and the ion leakage rate decreased by 3.5% and 2.5% respectively, but the Fv / Fm, ion leakage rate and plant height had no significant difference compared with the wild type control, while the Fv / Fm of the OsHTT6 overexpression transgenic lines significantly decreased (p<0.001), the survival rate also significantly decreased (p<0.001), and the ion leakage rate significantly increased (p<0.001).

[0100] The above results show that the expression of the OsHTT6 gene can be significantly improved by mutation to improve the tolerance of rice to high temperature stress.

[0101] Example 4 Yield trait detection of mutant lines and overexpression transgenic lines

[0102] Select several full seeds of wild type Nanguizhan (WT), mutant lines htt6-1 and htt6-2, and overexpression transgenic lines OEHTT6-1 and OEHTT6-2, and cultivate them according to the conventional planting management method to maturity for yield trait analysis (measure the yield per plant, the number of primary branches, the average effective tiller number and the average seed setting rate respectively).

[0103] The yield trait detection results of the OsHTT6 mutant lines, overexpression transgenic lines and wild type Nanguizhan are shown in Figure 5 ; Figure 5A-D in the table are the detection results of single plant yield, primary branch number, average effective tiller number and average seed setting rate, respectively. Figure 5 It can be seen that the average seed setting rate of the OsHTT6 mutant lines has a significant difference (p<0.05) with the wild type control, the single plant yield, primary branch number and average effective tiller number of the OsHTT6 mutant lines all have significant differences (p<0.001) with the wild type control, and the single plant yield of the htt6-1 and htt6-2 mutant lines is increased by 12.0 g and 12.6 g, respectively, compared with the wild type.

[0104] The above results show that the expression of the OsHTT6 gene can be significantly improved by mutation, and the primary branch number, average effective tiller number, average seed setting rate and single plant yield of rice can be significantly improved, and thus the yield of rice can be improved.

[0105] The above examples are the preferred embodiments of the present application, but the embodiments of the present application are not limited by the above examples, and any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present application should be equivalent replacement methods, and are all included in the protection scope of the present application.

Claims

1. Application of OsHTT6 protein or gene encoding OsHTT6 protein in regulating the tolerance of rice to high temperature stress, characterized in that, The expression of the OsHTT6 protein in rice is inhibited, and the high-temperature stress tolerance of the rice is improved; the amino acid sequence of the OsHTT6 protein is shown as SEQ ID NO.

3.

2. Use of OsHTT6 protein or a gene encoding OsHTT6 protein in regulating yield of rice, characterized in that, The expression of the OsHTT6 protein in rice is inhibited, and the yield of the rice is improved; the amino acid sequence of the OsHTT6 protein is shown as SEQ ID NO.

3.

3. Use according to claim 1 or 2, characterized in that, The nucleotide sequence of the gene encoding the OsHTT6 protein is shown as SEQ ID NO.

2.

4. A method for improving tolerance to high temperature stress and / or yield in rice, characterized by, The expression of the OsHTT6 protein in rice is inhibited, and the amino acid sequence of the OsHTT6 protein is shown as SEQ ID NO.

3.

5. The method of claim 4, wherein, The expression of the OsHTT6 protein in rice is inhibited by interfering with the expression of the gene encoding the OsHTT6 protein, or by mutating the coding region or the promoter of the gene encoding the OsHTT6 protein, or by knockout.

6. The method of claim 5, wherein, The expression of the OsHTT6 protein in rice is inhibited by interfering with the expression of the gene encoding the OsHTT6 protein by RNA interference technology, or by mutating the coding region or the promoter of the gene encoding the OsHTT6 protein by a gene editing system, or by knockout of the gene sequence encoding the OsHTT6 protein by homologous recombination.

7. The use of an agent inhibiting the expression of OsHTT6 protein in improving the tolerance of rice to high temperature stress or in the preparation of a product for improving the tolerance of rice to high temperature stress, characterized in that, The amino acid sequence of the OsHTT6 protein is shown as SEQ ID NO. 3; the reagent inhibits the expression of the OsHTT6 protein in rice by interfering with the expression of the gene encoding the OsHTT6 protein by RNA interference technology, or by mutating the coding region or the promoter of the gene encoding the OsHTT6 protein by a gene editing system, or by knockout of the gene sequence encoding the OsHTT6 protein by homologous recombination.

8. Use of an agent that inhibits the expression of OsHTT6 protein in cultivating rice plants with improved tolerance to high temperature stress, characterized in that, The amino acid sequence of the OsHTT6 protein is shown as SEQ ID NO. 2; the reagent inhibits the expression of the OsHTT6 protein in rice by interfering with the expression of the gene encoding the OsHTT6 protein by RNA interference technology, or by mutating the coding region or the promoter of the gene encoding the OsHTT6 protein by a gene editing system, or by knockout of the gene sequence encoding the OsHTT6 protein by homologous recombination.

9. Use of an agent that inhibits the expression of OsHTT6 protein in increasing yield of rice or in the manufacture of a product for increasing yield of rice, characterized in that, The amino acid sequence of the OsHTT6 protein is shown as SEQ ID NO. 3; the reagent inhibits the expression of the OsHTT6 protein in rice by interfering with the expression of the gene encoding the OsHTT6 protein by RNA interference technology, or by mutating the coding region or the promoter of the gene encoding the OsHTT6 protein by a gene editing system, or by knockout of the gene sequence encoding the OsHTT6 protein by homologous recombination.

10. Use of an agent that inhibits the expression of OsHTT6 protein in the cultivation of yield- enhancing rice plants, characterized in that, The amino acid sequence of the OsHTT6 protein is shown as SEQ ID NO. 3; the reagent inhibits the expression of the gene encoding the OsHTT6 protein through RNA interference technology, or inhibits the expression of the OsHTT6 protein in rice by mutating the coding region or the promoter of the gene encoding the OsHTT6 protein through a gene editing system, or inhibits the expression of the OsHTT6 protein in rice by knocking out the gene sequence encoding the OsHTT6 protein through homologous recombination.

Images