Application of PRXL2A as new target in preparation of medicine for screening and / or treating chronic kidney diseases

Abstract

The invention provides an application of PRXL2A as a new target in preparation of drugs for screening and / or treating chronic kidney diseases, and particularly relates to an application of a reagent for detecting expression conditions of genes or proteins in a sample in preparation of chronic kidney disease detection products, the genes are PRXL2A genes, and the proteins comprise PRXL2A proteins. The invention discloses a protective effect of PRXL2A in chronic kidney diseases, and finds that PRXL2A protein is specifically expressed in proximal renal tubular epithelial cells in kidney tissues, so that the renal interstitial fibrosis level of the chronic kidney diseases can be reflected to a certain extent, and a reliable basis can be provided for auxiliary diagnosis of the chronic kidney diseases.

Description

Technical Field

[0001] The present invention relates to the technical field of mechanism analysis and treatment of chronic kidney disease, and specifically provides the use of PRXL2A as a new target in the preparation of drugs for screening and / or treating chronic kidney disease. It is not aimed at disease diagnosis and treatment, but is a target for the mechanism of action of PRXL2A in the development of chronic kidney disease and its use in the development of drugs for treating chronic kidney disease. Background Art

[0002] Chronic Kidney Disease (CKD) threatens the lives of more than 800 million people in the world. It has a high morbidity and mortality rate. It is estimated that there are more than 80 million adult CKD patients in my country alone, but there is no effective treatment yet. Therefore, it is urgent to develop new drugs to effectively alleviate renal damage. About 30-50% of the differences in renal function between individuals are determined by genetic factors. Understanding the molecular mechanism of genetic factors affecting CKD is a key scientific issue that must be answered when the results of genome-wide association study (GWAS) are used in translational medicine. Therefore, identifying the pathogenic genes of CKD and clarifying their pathogenic mechanisms are of great significance in guiding the development of related drugs and precise targeted treatments for CKD. Integrating the GWAS of renal function (eGFR) and the regulatory map of genetic variation on the transcriptome (eQTL) is an effective research method for identifying CKD pathogenic genes. In 2017, Ko et al. integrated the GWAS of eGFR with the renal eQTL regulatory map and identified only 9 potential pathogenic genes of CKD; in 2018, Qiu et al. used microdissected tubules and glomeruli and integrated their eQTL regulatory maps with the GWAS of eGFR, but only identified 24 potential pathogenic genes of CKD. The applicant integrated multi-omics analysis, overcame the influence of cell heterogeneity, targeted the phenotype of CKD, revealed the potential pathogenic genes of CKD, and analyzed in which major cells of the kidney they play a pathogenic role.

[0003] Renal fibrosis is a key stage and common pathological change in the progression of various chronic kidney diseases. The proximal renal tubules are generally considered to be an important target of renal injury due to their important functions and characteristics in the renal system, and also play an important role in the occurrence and development of renal fibrosis. Therefore, finding new proximal tubular injury regulators and exploring their mechanisms in injury regulation and renal fibrosis are of great significance for intervening in renal injury, renal fibrosis progression, further delaying CKD disease progression, and developing targeted treatment strategies.

[0004] The applicant combined multi-omics integrated analysis and identified that PRXL2A is specifically expressed in proximal tubular cells in kidney tissue and is a potential pathogenic gene for CKD. Summary of the invention

[0005] In order to overcome the problems in the prior art, the present invention provides the use of PRXL2A as a new target in the preparation of drugs for screening and / or treating chronic kidney disease, and through multi-omics integrated analysis, reveals the potential pathogenic genes and mechanisms of CKD, and traces its "pathogenic" cells from the single cell level.

[0006] In order to achieve the above-mentioned purpose, the present invention adopts the following technical scheme: the use of a reagent for detecting the expression of a gene or protein in a sample in the preparation of a detection product for screening chronic kidney disease and / or a drug for treating chronic kidney disease, characterized in that: the gene is the PRXL2A gene, and the protein includes the PRXL2A protein.

[0007] Preferably, the protein further comprises one or more of BAX protein, HAVCR1 protein, CD68 protein and FIBRONECTIN protein.

[0008] Preferably, the detection product detects the expression of PRXL2A gene and / or PRXL2A protein in the sample by one or more of fluorescent quantitative PCR, Southern hybridization, Northern hybridization, fluorescence in situ hybridization, DNA microarray, high-throughput sequencing, and immunoassay.

[0009] Preferably, the immunoassay comprises one or more of ELISA, radioimmunoassay, immunohistochemistry, and Western blotting.

[0010] Preferably, the reagent for detecting the expression of a gene or protein in a sample comprises primers and / or probes capable of specifically amplifying the PRXL2A gene, or comprises antibodies capable of specifically binding to the PRXL2A protein.

[0011] Preferably, the sample is derived from tissue or peripheral blood.

[0012] Preferably, the chronic kidney disease is characterized by renal fibrosis.

[0013] The present invention also provides a nucleotide composition for targeted knockout of mouse PRXL2A gene, comprising a primer pair consisting of primer sequences SEQ ID NO.1 and SEQ ID NO.2, wherein the primer sequence SEQ ID NO.1 is shown as GTTAGTGTTCCTTGGGAAGATG, and the primer sequence SEQ ID NO.2 is shown as AAAGTCAGACGTGTGACTAAC.

[0014] As another aspect of the present invention, the present invention provides a biomarker for chronic kidney disease, which is PRXL2A protein.

[0015] Preferably, the reagents for detecting the above biomarkers comprise primers and / or probes capable of specifically amplifying the PRXL2A gene, or comprise antibodies capable of specifically binding to the PRXL2A protein. Through these reagents, when the PRXL2A gene is mutated, silenced or downregulated, it indicates a risk of chronic kidney disease.

[0016] The present invention provides use of the above biomarkers in diagnosing and / or treating chronic kidney disease.

[0017] The present invention provides use of a reagent for detecting the above-mentioned biomarker in preparing a reagent for diagnosing chronic kidney disease.

[0018] In kidney tissue, PRXL2A is specifically expressed in proximal tubular epithelial cells. In proximal tubular epithelial cells with Prxl2a knockout, reactive oxygen levels increase, inducing mitochondrial apoptosis, reducing ATP production, affecting proximal tubular epithelial cell function and ultimately affecting kidney function. Reduced PRXL2A expression levels specifically cause proximal tubular epithelial cell damage and exacerbate proximal tubular epithelial cell damage in CKD models.

[0019] In CKD kidney tissue, the decrease in Prxl2a gene expression level will lead to the aggravation of CKD, which is specifically manifested in the increase of serum urea nitrogen and serum creatinine levels, the physiological and biochemical indicators of chronic kidney disease, the increase of the transcription level of the kidney injury factor gene Havcr1, the increase of pathological section injury score, and the increase of inflammatory factors and fibrosis level-related factors in the kidney tissue of Prxl2a knockout mice.

[0020] The beneficial effects of the present invention are as follows:

[0021] The present invention constructs CKD model mice based on gene-edited mice to verify the pathogenic effects of the identified pathogenic genes and analyze their molecular mechanisms. It is identified that PRXL2A is specifically expressed in proximal tubular cells in kidney tissue and is a potential pathogenic gene for CKD, which is a new potential drug target for the development of targeted treatment of CKD. The present invention found that PRXL2A protein is specifically expressed in proximal tubular epithelial cells in kidney tissue and can reflect the level of renal interstitial fibrosis in chronic kidney disease to a certain extent, revealing the protective role of PRXL2A in chronic kidney disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1The expression levels of Prxl2a mRNA and PRXL2A protein in wild-type and knockout mice, where A is the Prxl2a mRNA level in wild-type and Prxl2a knockout mice, B is the PRXL2A protein level in wild-type and Prxl2a knockout mice, and C is the quantitative result of PRXL2A protein expression in wild-type and Prxl2a knockout mice;

[0023] Figure 2 Serum urea nitrogen and serum creatinine levels, which are indicators of renal tissue renal function impairment in wild-type and Prxl2a knockout mice in normal physiological state and CKD state, wherein A is the serum urea nitrogen level of wild-type, heterozygous and homozygous knockout mice before and after cisplatin induction, B is the serum creatinine level of knockout mice in the control group and cisplatin-induced group; C is the serum urea nitrogen level of wild-type, heterozygous and homozygous knockout mice before and after aristolochic acid induction, D is the serum creatinine level of knockout mice in the control group and aristolochic acid-induced group;

[0024] Figure 3 The tissue sections of wild-type and Prxl2a knockout mice in normal physiological state and CKD state are stained, among which A is H&E staining of kidney tissue in cisplatin-induced model, B is PAS staining of kidney tissue in cisplatin-induced model; C is H&E staining of kidney tissue in aristolochic acid-induced model, and D is PAS staining of kidney tissue in aristolochic acid-induced model;

[0025] Figure 4 The mRNA levels of HAVCR1, a renal injury-related factor, in the kidney tissues of wild-type and Prxl2a knockout mice in normal physiological and CKD states;

[0026] Figure 5 The mRNA levels of CD68, an inflammation-related factor in kidney tissues of wild-type and Prxl2a knockout mice in normal physiological and CKD states;

[0027] Figure 6 The protein levels and quantification of FIBRONECTIN, a fibrosis-related factor in renal tissue, in wild-type and Prxl2a knockout mice in normal physiological state and CKD state, where A is the mRNA level of Tgfb1, an upstream marker of the signal pathway that induces the production of fibrosis factors in the cisplatin-induced model control group and the induced group, B is the protein immunoblotting result of fibronectin in the cisplatin-induced model, and C is the quantitative result of fibronectin; D is the mRNA level of Tgfb1, an upstream marker of the signal pathway that induces the production of fibrosis factors in the aristolochic acid-induced model control group and the induced group, E is the protein immunoblotting result of fibronectin in the aristolochic acid-induced model, and F is the quantitative result of fibronectin;

[0028] Figure 7 Immunofluorescence staining of kidney tissue sections of wild-type and Prxl2a knockout mice. The blue dye DAPI represents the cell nucleus, the green FITC fluorescently labeled LTL is a proximal tubule-specific marker, and the red Cy3 fluorescently labels the target protein PRXL2A. A is an immunofluorescence staining photo at 20 times, and B is an immunofluorescence staining photo at 10 times.

[0029] Figure 8 Cell proliferation and cytotoxicity of primary renal tubular epithelial cells of wild-type and Prxl2a knockout mice under normal physiological state and drug stimulation state, where A, B, and C are the cell death rates of wild-type and knockout cells respectively when stimulated with cisplatin at different concentrations (5μM, 10μM, 20μM, 40μM) and time (6h, 24h, 48h), and D, E, and F are the cytotoxicity of wild-type and knockout cells respectively when stimulated with aristolochic acid at different concentrations (5μM, 10μM, 20μM, 40μM) and time (6h, 24h, 48h);

[0030] Fig. 9 Cellular ROS levels and ATP production of primary renal tubular epithelial cells of wild-type and Prxl2a knockout mice in normal physiological state and CKD state, where A is the reactive oxygen levels of wild-type and knockout cells in normal state, induced by reactive oxygen positive induction reagent Roshup, and induced by Cisplatin, respectively, and B is the result of ATP detection of cells of different genotypes in the control group and induced group;

[0031] Fig.10 Figure 2 is the mRNA level, protein level and quantification of Bax, a mitochondrial apoptosis-related factor in primary renal tubular epithelial cells of wild-type and Prxl2a knockout mice under normal physiological state and CKD state, where A is the mRNA level of Bax in the cisplatin-induced model, B is the protein immunoblot result of BAX protein in the cisplatin-induced model, and C is Fig.10 B is the quantitative result of BAX protein; D is the mRNA level of Bax in the aristolochic acid-induced model; E is the protein immunoblot result of BAX protein in the aristolochic acid-induced model; F is Fig.10 E. Quantification results of BAX protein. DETAILED DESCRIPTION

[0032] In order to better illustrate the purpose, technical solutions and advantages of the present invention, the present application will be further described below in conjunction with specific embodiments.

[0033] Example 1 Detection of the role of Prx12a gene in disease progression in CKD mice

[0034] 1. Construction and detection of gene knockout mice

[0035] (1) Primer sequences: F1-GTTAGTGTTCCTTGGGAAGATG; R1-AAAGTCAGACGTGTGACTAAC;

[0036] (2) Genome extraction: Some tissues of newborn mice were collected and genome extracted using a genome extraction kit (Acori Biotech, AG21009) according to the steps;

[0037] (3) Genomic PCR amplification: The PCR amplification system was prepared using PCR reagent (Ibotek Biotech, RK20719) according to the following system, and then amplification was performed according to the following PCR reaction procedure.

[0038] Table 1 PCR amplification system and PCR reaction procedure

[0039]

[0040] The PCR stock solution was sent to Qingke Biotechnology Company for sequencing. The knockout mice had a deletion of 4 consecutive bases of GTGA in the Prxl2a gene sequence, the wild-type mice had no base deletion, and the heterozygous mice had double peaks in sequencing.

[0041] The renal tissues of homozygous and heterozygous knockout mice and wild-type mice were tested for the mRNA level of Prxl2a gene and the protein level of PRXL2A by Quantitative Real-time PCR and Western blot technology, respectively. Figure 1 shown. Figure 1 Figure A shows that the Prxl2a mRNA level in Prxl2a knockout mice is significantly lower than that in wild-type mice. Figure 1 Figure B shows that the expression level of Prxl2a knockout mice (Prxl2a+ / -) is reduced by about 40% relative to wild-type mice, and Prxl2a knockout mice (Prxl2a- / -) basically do not express PRXL2A protein relative to wild-type mice (Wild-type), indicating that the knockout mice were successfully constructed.

[0042] 2. CKD model construction and testing

[0043] The CKD model of wild-type and Prxl2a knockout mice was constructed by drug induction. Wild-type and Prxl2a knockout mice aged 6-8 weeks were selected (commissioned and purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd.) and randomly divided into a control group and an experimental group, with 6-8 mice in each group. The mice in the cisplatin-induced model experimental group were intraperitoneally injected with 20 mg / kg cisplatin, and the mice in the control group were intraperitoneally injected with the corresponding volume of solvent saline. The mice were sacrificed 3 days later to obtain blood and kidney tissue. The mice in the aristolochic acid-induced model experimental group were intraperitoneally injected with 3 mg / kg aristolochic acid, once every 3 days, for 4 times, and the mice in the control group were intraperitoneally injected with the corresponding volume of solvent saline. The mice were sacrificed 2 weeks after the injection to obtain blood and kidney tissue.

[0044] In the normal physiological activities of mammals, the creatinine and urea nitrogen produced by metabolism will be filtered through the kidneys in time. When the filtration function of the kidneys is impaired, the levels of serum creatinine and serum urea nitrogen will be abnormally increased. The serum of each group of mice was collected, and the levels of serum creatinine and serum urea nitrogen of each group of mice were detected by urea nitrogen detection kit and creatinine detection kit. The kidney tissues of each group of mice were taken for histopathological section staining (H&E staining and PAS staining). RNA was extracted from the kidney tissues and real-time fluorescence quantitative PCR was used to detect the kidney injury marker Havcr1.

[0045] 1. Serum creatinine and serum urea nitrogen detection: Serum creatinine and serum urea nitrogen were detected in mice using a creatinine assay kit (Nanjing Jiancheng, C011-2-1) and a urea nitrogen colorimetric assay kit (Invitrogen, EIABUN) according to the instructions provided by the manufacturer.

[0046] 2. Quantitative Real-time PCR:

[0047] (1) RNA extraction: prepare grinding tubes and magnetic beads, collect 50-100 mg of tissue, operate on ice throughout the process, first add 500 μL Trizol (in a tissue disruptor) and lyse for 20-30 seconds. After lysis, quickly place on ice and transfer to a new RNasefree EP tube that has been cooled on ice. After standing on ice for a few minutes, add 1 / 5 volume of chloroform, shake and mix, and stand for 15 minutes. Centrifuge at 4°C, 12000 rpm, and 15 minutes. Prepare 1.5 mL of RNase free EP and pre-cool it on ice. Take out the sample from the centrifuge and carefully aspirate the top layer of clear liquid into a new EP tube with an RNasefree pipette tip. Add isopropanol of the same volume as the supernatant, shake and mix, let stand for 10 min, centrifuge at 4°C, 12000 rpm, 10 min, discard the supernatant, and keep only the white precipitate at the bottom of the tube. After drying the tube wall, add 1 mL of 70% ethanol prepared with DEPC water, shake and mix, centrifuge at 4°C, 12000 rpm, 10 min, discard the supernatant, dry the tube wall, add appropriate amount of DEPC water to dissolve the white precipitate, and measure the RNA concentration in a micro-UV spectrophotometer.

[0048] (2) Reverse transcription: Use the reverse transcription kit (Lambolide Biotechnology, F0202) to prepare the reverse transcription reaction system and the recommended reaction procedure according to the instructions for use. (3) Real-time fluorescence quantitative PCR: Use the real-time fluorescence quantitative kit (Lambolide Biotechnology, R0202) to prepare the reaction system according to the qPCR reaction system recommended in the instructions, adjust the template concentration to control the CT value within the confidence interval, use ABI's QuantStudio 6Flex fluorescence quantitative PCR instrument to collect data according to the qPCR reaction procedure recommended in the instructions, and use the ΔΔCT method for data processing.

[0049] 3. Western Blot:

[0050] (1) Protein extraction: prepare grinding tubes, magnetic beads, about 50-100 mg of tissue, prepare lysis buffer + protease inhibitor in advance: 50 μL RIPA / 10 mg tissue, 100×PMSF or 100×inhibitor cocktail, run the 3D cell disruptor with the standard recommended program, put on ice immediately after 30 seconds of a program, if not sufficient, repeat again, after tissue disruption, centrifuge at 4°C, 12000 rpm, 3 minutes to collect the supernatant. (2) Protein quantification, use the BCA kit (Novozyme, E112-BCA) according to the instructions for use for protein quantification and protein concentration calculation. (3) Western blot: Use SDS-PAGE gel rapid preparation kit (Sevier, G2037) to prepare 8% separation gel and 5% stacking gel for sample preparation. Perform electrophoresis and transfer according to the recommended conditions of Sevier high-resolution electrophoresis buffer and rapid transfer buffer. Block with 5% skim milk powder for 1 hour. Use primary antibodies such as PRXL2A (Sigma, HPA009025, 1:500) and FIBRONECTIN (Sigma, F3648, 1:1000). Incubate with primary antibody at 4°C overnight and then wash with TBST. Incubate with secondary antibody and then wash with TBST. Then use ECL chemiluminescence for band detection.

[0051] Figure 2 A shows cisplatin-induced Figure 2 C shows that after aristolochic acid induction, the serum urea nitrogen levels of wild-type, heterozygous and homozygous knockout mice were significantly increased compared with the uninduced control group, and the serum urea nitrogen level of knockout mice in the induced group was significantly higher than that of wild-type mice. Figure 2 B and 2D show that the serum creatinine level of knockout mice in the induced group was significantly higher than that of wild-type mice. Figure 2 The results showed that renal function impairment was aggravated after Prxl2a gene knockout. Figure 3 A, 3C are H&E staining of kidney tissue. Figure 3 B and 3D are PAS staining of kidney tissue. It can be seen from Figures 3A and 3B that the gene knockout mice induced by cisplatin showed severe desquamation of renal tubular epithelial cells and dilation of the tubular lumen compared with the induced wild-type mice, reflecting that the renal tubular damage in the knockout mice was more severe. Figure 4 It can be seen that the level of kidney tissue damage factor Havcr1 in the knockout mice of the induced group was significantly increased compared with the wild-type, which also indicates that kidney tissue damage is aggravated after gene knockout.

[0052] In the progression of CKD, kidney tissue damage will lead to an inflammatory response in the kidney, and cells will try to repair themselves. One of the main characteristics is the induction of fibrosis factors to protect the tissue. In the process of continuous damage and repair, kidney fibrosis will eventually occur. Excessive fibrosis will make it difficult for the kidney to perform normal physiological functions. Therefore, the kidneys of each group of mice were quantitatively detected by real-time fluorescence to detect inflammatory factors and fibrosis factors. Figure 5 The results showed that the mRNA level of inflammatory factor Cd68 in the knockout mice of the induced group was significantly higher than that of the wild-type mice, indicating that the inflammatory response of the knockout mice was more severe. Figure 6 A and 6D show that the mRNA level of Tgfb1, an upstream marker of the signaling pathway that induces the production of fibrotic factors, was higher in the knockout mice in the induced group. Figure 6 B. 6E is the result of Western blotting of fibronectin (FN), one of the fibrosis factors. Figure 6 C is Figure 6 The quantitative results of B, Figure 6 F is Figure 6 E Quantitative results showed that the level of fibrotic proteins in the knockout mice in the induced group was significantly higher than that in the wild type. Figure 6 The results showed that the level of renal tissue fibrosis in the knockout mice in the induced group was more severe than that in the wild type.

[0053] Therefore, by detecting the renal tissue damage, serum urea nitrogen, serum creatinine levels, and the mRNA levels of damage factors and fibrosis factors in renal tissue, and the expression levels of fibrosis proteins in wild-type mice and gene knockout mice, the results showed that the renal function impairment, renal tissue damage, inflammatory response and renal fibrosis levels of Prxl2a gene knockout mice were more severe, indicating that the progression of chronic kidney disease in mice after knocking out the Prxl2a gene was more severe, and Prxl2a may play a protective role in the progression of CKD.

[0054] Example 2 Detection of cell-specific expression of PRXL2A in the kidney

[0055] Immunofluorescence staining was used to detect the expression and distribution of PRXL2A protein in kidney tissue sections of wild-type mice and Prxl2a knockout mice. Figure 7 , where the blue fluorescence is DAPI dye, which is a nuclear dye, the green fluorescence is FITC green fluorescence labeled Lotus japonicus lectin (FITC-LTL), LTL is a marker that can specifically bind to the proximal tubular brush border, and the PRXL2A protein is labeled with red fluorescence, Figure 7 A and B are immunofluorescence staining photos at different magnifications. Figure 7The results showed that in wild-type mice, red fluorescence localization of PRXL2A protein was only found in the proximal renal tubules where green fluorescence appeared, while there was no red fluorescence localization in other parts such as the glomerulus and collecting ducts. In Prxl2a gene knockout mice, there was no red fluorescence of PRXL2A protein in the proximal renal tubules, indicating that PRXL2A protein is specifically expressed in the proximal tubular epithelial cells in the kidney tissue.

[0056] 1. Tissue immunofluorescence staining:

[0057] (1) Slide baking: Place the slides carrying the specimens one by one into the slide rack and then into an adjustable thermostat, adjust the temperature to 65°C, and leave for about 60-120 minutes. (2) Dewaxing and dehydration: After the slides are baked, the following routine dewaxing with xylene solution and dehydration with different gradients of alcohol are carried out. The specific process is: xylene I 10min-xylene II 10min-xylene III 10min-100% alcohol I 5min-95% alcohol I 5min-85% alcohol I 5min-75% alcohol II 5min, rinse with water 3 times, 5min each time. (3) Antigen repair: Slowly put the slides into the 0.01M citrate buffer (PH6.0) antigen repair box heated to 95°C and keep warm for 30-40min. After the end, cool naturally at room temperature for about 30-60min, remove the slides after cooling to room temperature, and rinse the slides with PBS buffer for 5min×3 times. (4) Blocking and inactivating endogenous peroxidase: Place the specimen in an incubation box, add 3% H2O2 to the dewaxed slide specimen and incubate at room temperature for 25 minutes. After taking it out, slowly rinse it with the prepared PBS buffer for 5 minutes × 3 times. (5) Cell permeabilization: Incubate it with 0.2% NP40 at room temperature for 10 minutes, then slowly rinse it with PBS for 5 minutes × 3 times. (6) Serum blocking: Gently wipe the water on the slide and incubate it with 5% FBS at room temperature for 60 minutes. (7) Primary antibody incubation: Add the prepared primary antibody reagent, PRXL2A (sigma, HPA009025) at a concentration of 1:100, LTL (vector laboratories, FL-1321-2) at a concentration of 1:300, and incubate it at 4°C overnight. (8) Take it out the next morning, wait for it to cool to room temperature, and rinse it with PBS buffer for 5 minutes × 3 times. Then, add appropriate amount of HRP goat anti-rabbit secondary antibody, incubate at room temperature for 50 minutes, and then rinse with PBS buffer for 5 minutes × 3 times; Immunofluorescence (TSA): Prepare Cy3-TSA reagent (Sevier, G1635) according to the Seville TSA kit, add appropriate amount of the prepared reagent, incubate at room temperature for 10 minutes, and then rinse with PBS buffer for 5 minutes × 3 times; add appropriate amount of DAPI staining solution, incubate at room temperature for 10 minutes, and then rinse with PBS buffer for 5 minutes × 3 times; seal the slide with anti-fluorescence quencher. (9) Observe the staining of the specimen slices under a microscope and take pictures for preservation.

[0058] Example 3 Prx12a is involved in regulating mitochondrial damage in renal proximal tubular epithelial cells

[0059] Example 1 reflects that after Prxl2a is knocked out, the kidney tissue of the renal disease induced model mice is more severely damaged, especially the renal tubules are severely damaged, and Example 2 proves that PRXL2A is specifically expressed in the proximal tubular epithelial cells in the kidney tissue. Therefore, Example 3 verifies the signal regulation that Prxl2a may affect in the proximal tubular epithelial cells. Specific steps:

[0060] 1. Extraction and cell culture of primary renal tubular epithelial cells from mouse kidney

[0061] (1) Mice were anesthetized by intraperitoneal injection of 20 μL / mg ready-to-use 1.25% Avertin solution. After anesthesia, the mice were sacrificed by dislocation of the neck, and quickly immersed in 75% ethanol for about 2 minutes for disinfection. (2) The abdominal cavity was cut open to remove the kidneys, the renal capsule was peeled off, and the kidneys were placed in an EP tube containing pre-cooled 1640 culture medium and cut into pieces. Collagenase I with a final concentration of 200 μg / mL was added and mixed. The cells were incubated at 37°C for 50 minutes until the tissue fragments basically disappeared. (3) Single TEC cells were collected by filtering through 100 μm, 70 μm, and 40 μm meshes in turn, centrifuged at 1500 rpm for 10 minutes, and the supernatant was discarded. The cells were resuspended with 5-10 times the volume of red blood cell lysis buffer, shaken for 5 seconds, incubated at room temperature for 2 minutes, centrifuged at 300g for 10 minutes at room temperature, and the supernatant was discarded. The culture medium was resuspended and counted. (4) The cell adhesion was observed, and the medium was changed every other day after the cells adhered.

[0062] 2. CCK-8 detection

[0063] When the density of primary renal tubular epithelial cells reached about 80-90%, they were plated and after the cells adhered, they were stimulated with 5 μM, 10 μM, 20 μM, 40 μM cisplatin or aristolochic acid for 6, 24, and 48 hours, respectively. Cell proliferation and cytotoxicity detection kits (Novozyme, A311-02) were used to perform corresponding tests and calculations according to the instructions.

[0064] 3. ROS and ATP detection

[0065] When the density of primary renal tubular epithelial cells reached about 80-90%, the cells were plated, and after the cells adhered, they were stimulated with 50 μM cisplatin for 4-6 hours, and the reactive oxygen species detection kit (Biyuntian, S0033) was used to perform corresponding detection and calculation according to the instructions. When the density of primary renal tubular epithelial cells reached about 80-90%, the cells were plated, and after the cells adhered, they were stimulated with 50 μM cisplatin for 4-6 hours, and the ATP fluorescence cell viability detection kit (Yisheng, 40210ES10) was used to perform corresponding detection and calculation according to the instructions.

[0066] Primary renal tubular epithelial cells were extracted from mouse kidneys and tested for cell proliferation and cytotoxicity by CCK-8 method. Figure 8 As shown, different concentrations and time gradients of cisplatin or aristolochic acid induce stimulation of cells. In the induced group, the death rate of knockout cells was higher than that of the wild-type group, indicating that the knockout cells were more seriously damaged. The reactive oxygen levels of cells were detected by cisplatin stimulation of primary mouse renal tubular epithelium. Reactive oxygen in cells is a natural byproduct of oxygen metabolism. It will maintain balance during normal metabolism, but the reactive oxygen level will increase under factors such as stress stimulation, which may cause oxidative stress and cause serious damage to the cell structure. The test results are shown in Fig. 9 A. In the induced group, the level of reactive oxygen species in the knockout cells increased relative to the wild type, indicating that the knockout cells may be more seriously damaged. ATP is the direct energy source of cells and is mainly produced in large quantities through mitochondrial oxidative phosphorylation. Proximal tubular epithelial cells participate in the reabsorption function of the kidney and require a large amount of energy supply. They are sensitive to energy, and interruption of energy supply can easily cause cell death. ATP detection was performed on cells in the control group and the induced group. The results are shown in Fig. 9 B. The ATP level of Prxl2a knockout cells is lower than that of wild-type cells. The results show that the oxidative phosphorylation of knockout cells may be affected, and the mitochondrial structure and function may be damaged. Further verification is needed. At the same time, the low ATP level of knockout cells may be an important cause of their death. To further verify whether the mitochondrial function of the cells is damaged, the mRNA level and protein level of the mitochondrial apoptosis marker gene Bax were detected. The results are shown in Fig.10 , Fig.10 A and 10D are the mRNA levels of Bax. The mRNA levels of Bax in Prxl2a knockout cells in the induced group were significantly higher than those in the control group. Fig.10 B, 10E are the results of western blot of BAX protein. Fig.10 C is Fig.10 The quantitative results of B, Fig.10 F is Fig.10 The quantitative results of D showed that the BAX protein level in the knockout mice in the induced group was significantly higher than that in the wild type. Fig.10 The results showed that mitochondrial apoptosis in renal tubular epithelial cells of gene knockout mice in the induced group was more serious than that of the wild type.

[0067] Therefore, by detecting the reactive oxygen levels, ATP levels, and mRNA and BAX protein levels of the apoptosis marker Bax in the primary renal tubular epithelial cells of the kidney tissues of wild-type mice and gene knockout mice under stimulation-induced and control groups, it was shown that Prxl2a knockout increased the reactive oxygen levels and decreased ATP production in renal tubular epithelial cells, which may be due to the fact that its knockout aggravated the mitochondrial damage of renal tubular epithelial cells, reflecting that Prxl2a is involved in regulating oxidative stress damage in renal proximal tubular epithelial cells.

[0068] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. Use of a reagent for detecting the expression of a gene or protein in a sample in the preparation of a test product for screening chronic kidney disease and / or a drug for treating chronic kidney disease, characterized in that: The gene is the PRXL2A gene, and the protein includes the PRXL2A protein.

2. The use according to claim 1, characterized in that: The protein also includes one or more of BAX protein, HAVCR1 protein, CD68 protein and FIBRONECTIN protein.

3. The use according to claim 1, characterized in that: The detection product detects the expression of PRXL2A gene and / or PRXL2A protein in a sample by one or more of fluorescent quantitative PCR, Southern hybridization, Northern hybridization, fluorescent in situ hybridization, DNA microarray, high-throughput sequencing, and immunoassay.

4. The use according to claim 3, characterized in that: The immunoassay includes one or more of ELISA, radioimmunoassay, immunohistochemistry, and Western blotting.

5. The use according to claim 1, characterized in that: The reagent for detecting the expression of a gene or protein in a sample comprises primers and / or probes capable of specifically amplifying the PRXL2A gene, or comprises antibodies capable of specifically binding to the PRXL2A protein.

6. The use according to claim 1, characterized in that: The sample is derived from tissue or peripheral blood.

7. The use according to claim 1, characterized in that: The chronic kidney disease is characterized by renal fibrosis.

8. A nucleotide composition for targeted knockout of mouse PRXL2A gene, characterized in that: The primer pair comprises a primer sequence of SEQ ID NO.1 and SEQ ID NO.2, wherein the primer sequence of SEQ ID NO.1 is shown as GTTAGTGTTCCTTGGGAAGATG, and the primer sequence of SEQ ID NO.2 is shown as AAAGTCAGACGTGTGACTAAC.

9. A biomarker for screening chronic kidney disease, characterized in that: The biomarkers include PRXL2A protein.

10. A reagent for detecting the biomarker according to claim 9, characterized in that: The method comprises primers and / or probes capable of specifically amplifying the PRXL2A gene, or comprises antibodies capable of specifically binding to the PRXL2A protein.

Images